Clone Information

BLAST Search Result

Clone Name	rbags8d20
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|X63052.1\|HVCP29 Hordeum vulgare gene for CP29 precursor for ...	783	0.0
2	gb\|AC135460.3\| Oryza sativa (japonica cultivar-group) chromosome...	293	2e-76
3	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	293	2e-76
4	dbj\|AK104824.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	293	2e-76
5	dbj\|AK098872.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	293	2e-76
6	dbj\|AK061295.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	293	2e-76
7	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	293	2e-76
8	dbj\|D85512.1\| Oryza sativa (japonica cultivar-group) CP26 mRNA, ...	268	1e-68
9	gb\|AY105650.1\| Zea mays PCO135935 mRNA sequence	250	3e-63
10	gb\|U23188.1\|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein...	246	5e-62
11	gb\|U23189.1\|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein...	220	3e-54
12	gb\|AY855171.1\| Eleusine coracana subsp. coracana clone 1 light h...	210	3e-51
13	gb\|M12152.1\|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene...	113	5e-22
14	ref\|NM_192636.1\| Oryza sativa (japonica cultivar-group), predic...	109	7e-21
15	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	109	7e-21
16	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	109	7e-21
17	dbj\|AP005313.3\| Oryza sativa (japonica cultivar-group) genomic D...	109	7e-21
18	dbj\|AP003278.5\| Oryza sativa (japonica cultivar-group) genomic D...	109	7e-21
19	dbj\|AP005700.3\| Oryza sativa (japonica cultivar-group) genomic D...	109	7e-21
20	dbj\|AK121563.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
21	dbj\|AK119173.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
22	emb\|X13909.1\|OSCABR2 Rice cab2R gene for light harvesting chloro...	109	7e-21
23	dbj\|AK104350.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
24	dbj\|AK104288.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
25	dbj\|AK104281.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
26	dbj\|AK060851.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
27	dbj\|AK058305.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	109	7e-21
28	ref\|XM_478729.1\| Oryza sativa (japonica cultivar-group), mRNA	105	1e-19
29	ref\|XM_507374.1\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
30	ref\|XM_507373.1\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
31	ref\|XM_507372.1\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
32	ref\|XM_507371.1\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
33	ref\|XM_507370.1\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
34	ref\|XM_507369.1\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
35	ref\|XM_506410.2\| PREDICTED Oryza sativa (japonica cultivar-group...	105	1e-19
36	gb\|AC135564.4\| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom...	105	1e-19
37	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	105	1e-19
38	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
39	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
40	dbj\|AP004270.3\| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
41	emb\|X63205.1\|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin...	105	1e-19
42	dbj\|AK109399.2\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
43	dbj\|AK119545.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
44	dbj\|AK119533.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
45	dbj\|AK104495.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
46	dbj\|AK104465.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
47	dbj\|AK104224.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
48	dbj\|AK103999.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
49	dbj\|AK103926.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
50	dbj\|AK066762.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
51	dbj\|AK061512.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
52	dbj\|AK058315.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
53	gb\|AF061577.1\|AF061577 Oryza sativa chlorophyll a/b binding prot...	105	1e-19
54	dbj\|D00642.1\|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN...	105	1e-19
55	emb\|X13908.1\|OSCABR1 Rice cab1R gene for light harvesting chloro...	101	2e-18
56	gb\|BC053854.1\| Homo sapiens cDNA clone IMAGE:5194336, partial cds	101	2e-18
57	dbj\|D00641.1\|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN...	101	2e-18
58	ref\|NM_191799.1\| Oryza sativa (japonica cultivar-group), predic...	98	3e-17
59	gb\|AY100470.1\| Oryza sativa (indica cultivar-group) putative sol...	98	3e-17
60	dbj\|AB211497.1\| Lemna paucicostata LpCAB1 mRNA for CAB homologue...	98	3e-17
61	dbj\|AP003292.2\| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
62	emb\|X68682.1\|ZMLHCB Z.mays mRNA for type II light-harvesting chl...	98	3e-17
63	dbj\|AK104176.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
64	dbj\|AK103946.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
65	dbj\|AK068972.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
66	dbj\|AK062725.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
67	gb\|AY112240.1\| Zea mays CL187_6 mRNA sequence	98	3e-17
68	dbj\|AK058312.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
69	dbj\|AK058289.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
70	gb\|AF479779.1\| Chlamydomonas reinhardtii major light-harvesting ...	96	1e-16
71	gb\|AF479777.1\| Chlamydomonas reinhardtii major light-harvesting ...	96	1e-16
72	gb\|DQ122900.1\| Chlamydomonas incerta chloroplast light-harvestin...	96	1e-16
73	dbj\|AB051208.1\| Chlamydomonas reinhardtii mRNA for light-harvest...	96	1e-16
74	dbj\|AB051204.1\| Chlamydomonas reinhardtii gene for light-harvest...	96	1e-16
75	dbj\|AK061619.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	94	4e-16
76	gb\|AF079590.1\|AF079590 Sorghum bicolor photosystem II type II ch...	94	4e-16
77	gb\|AF104631.3\| Chlamydomonas reinhardtii light harvesting comple...	90	7e-15
78	emb\|X12735.1\|HVCAB2 Barley Cab-2 gene for major light-harvesting...	90	7e-15
79	gb\|M29334.1\|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ...	90	7e-15
80	gb\|AF330793.1\|AF330793 Chlamydomonas reinhardtii light-harvestin...	88	3e-14
81	dbj\|AB051209.1\| Chlamydomonas reinhardtii mRNA for light-harvest...	88	3e-14
82	dbj\|AB051205.1\| Chlamydomonas reinhardtii gene for light-harvest...	88	3e-14
83	gb\|AY171229.1\| Chlamydomonas reinhardtii light-harvesting comple...	86	1e-13
84	emb\|X14794.1\|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding...	86	1e-13
85	gb\|AF022739.1\|AF022739 Oryza sativa chlorophyll a-b binding prot...	86	1e-13
86	dbj\|AB051210.1\| Chlamydomonas reinhardtii mRNA for light-harvest...	86	1e-13
87	gb\|AF495473.1\| Chlamydomonas reinhardtii major light-harvesting ...	84	4e-13
88	dbj\|D00571.1\|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light...	84	4e-13
89	emb\|X14505.1\|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro...	84	4e-13
90	dbj\|AB051206.1\| Chlamydomonas reinhardtii gene for light-harvest...	84	4e-13
91	gb\|AY389597.1\| Hyacinthus orientalis chloroplast chlorophyll a/b...	82	2e-12
92	dbj\|AB050007.2\| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, c...	82	2e-12
93	emb\|X55892.1\|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo...	82	2e-12
94	gb\|U51632.1\|PPU51632 Pinus palustris type 2 light-harvesting chl...	82	2e-12
95	gb\|L23107.1\|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c...	78	3e-11
96	gb\|AY646197.1\| Chlorella pyrenoidosa chloroplast light-harvestin...	74	4e-10
97	emb\|X61915.1\|PTCABP P.thunbergii cab gene	74	4e-10
98	gb\|AY617092.1\| Pinus monophylla chloroplast light harvesting chl...	74	4e-10
99	gb\|M37489.1\|PINCABII2 Pinus sylvestris chlorophyll a/b-binding p...	74	4e-10
100	gb\|AF247178.1\|AF247178 Picea glauca needle chlorophyll a/b-bindi...	74	4e-10
101	gb\|AF139465.2\|AF139465 Vigna radiata LHCII type III chlorophyll ...	74	4e-10
102	emb\|AJ309102.1\|PPI309102 Pinus pinaster partial mRNA for putativ...	74	4e-10
103	gb\|AF104630.1\|AF104630 Chlamydomonas reinhardtii light harvestin...	74	4e-10
104	gb\|AF495472.1\| Chlamydomonas reinhardtii major light-harvesting ...	72	2e-09
105	gb\|AF165529.1\|AF165529 Rumex palustris chlorophyll a/b binding p...	72	2e-09
106	gb\|U73218.1\|TAU73218 Triticum aestivum chlorophyll a/b-binding p...	72	2e-09
107	gb\|M24072.1\|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi...	72	2e-09
108	emb\|X53398.1\|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl...	70	6e-09
109	emb\|AJ313013.1\|PCO313013 Pinus contorta cab gene for chlorophyll...	70	6e-09
110	emb\|AJ843976.1\| Plantago major partial mRNA for light harvesting...	70	6e-09
111	gb\|DQ018376.1\| Pinus krempfii chloroplast putative light harvest...	70	6e-09
112	gb\|AY617095.1\| Pinus nelsonii chloroplast light harvesting chlor...	70	6e-09
113	gb\|AY617093.1\| Pinus remota chloroplast light harvesting chlorop...	70	6e-09
114	gb\|AY617084.1\| Pinus contorta chloroplast light harvesting chlor...	70	6e-09
115	gb\|AY617083.1\| Pinus radiata chloroplast light harvesting chloro...	70	6e-09
116	gb\|AY617082.1\| Pinus ponderosa chloroplast light harvesting chlo...	70	6e-09
117	gb\|AY617081.1\| Pinus echinata chloroplast light harvesting chlor...	70	6e-09
118	emb\|Z49749.1\|PMLHCABBP P.menziesii mRNA for light-harvesting chl...	70	6e-09
119	emb\|X67714.1\|PCCABA P.contorta cab gene for chlorophyll a/b bind...	70	6e-09
120	gb\|AY109324.1\| Zea mays CL187_1 mRNA sequence	70	6e-09
121	gb\|U51634.1\|PPU51634 Pinus palustris type 2 light-harvesting chl...	70	6e-09
122	gb\|U51633.1\|PPU51633 Pinus palustris type 1 light-harvesting chl...	70	6e-09
123	gb\|U74295.1\|OSU74295 Oryza sativa chlorophyll a/b binding protei...	70	6e-09
124	emb\|X54856.1\|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi...	68	2e-08
125	gb\|AY786530.1\| Haematococcus pluvialis chloroplast major light-h...	66	1e-07
126	emb\|X54090.1\|GHCAB G.hirsutum cab gene for chlorophyll ab bindin...	66	1e-07
127	gb\|AY267624.1\| Bigelowiella natans chlorophyll a/b-binding prote...	66	1e-07
128	gb\|AF479778.1\| Chlamydomonas reinhardtii major light-harvesting ...	66	1e-07
129	gb\|AY617088.1\| Pinus flexilis chloroplast light harvesting chlor...	66	1e-07
130	gb\|AY617086.1\| Pinus roxburghii chloroplast light harvesting chl...	66	1e-07
131	gb\|AY617085.1\| Pinus merkusii chloroplast light harvesting chlor...	66	1e-07
132	gb\|S73603.1\| Pinus thunbergii chlorophyll a/b-binding protein (L...	66	1e-07
133	emb\|X13407.1\|PTCAB Pinus thunbergii cab mRNA for light-harvestin...	66	1e-07
134	emb\|X89023.1\|HVLHCIITI H.vulgare mRNA for LHC II type I protein	66	1e-07
135	emb\|X81808.1\|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h...	66	1e-07
136	emb\|X14506.1\|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro...	66	1e-07
137	gb\|AY554168.1\| Nicotiana tabacum chloroplast chlorophyll a-b bin...	66	1e-07
138	gb\|AF017998.1\|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin...	66	1e-07
139	gb\|U43707.1\|PAU43707 Picea abies chlorophyll a/b binding protein...	66	1e-07
140	dbj\|AB026686.1\| Physcomitrella patens mRNA for chlorophyll a/b-b...	66	1e-07
141	gb\|AF398746.1\|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, ...	64	4e-07
142	gb\|AF398740.1\|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B)...	64	4e-07
143	emb\|X63197.1\|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p...	64	4e-07
144	emb\|AJ635207.1\| Triticum durum ssp. durum partial mRNA for putat...	64	4e-07
145	emb\|X06602.1\|EGLHCPAB Euglena gracilis mRNA for light harvesting...	64	4e-07
146	gb\|M10144.1\|WHTCAB Wheat major chlorophyll a/b-binding protein g...	64	4e-07
147	emb\|X61361.1\|EGLHCAB E.gracilis gene for light harvesting chloro...	62	2e-06
148	gb\|DQ018375.1\| Pinus gerardiana chloroplast putative light harve...	62	2e-06
149	gb\|AY617094.1\| Pinus longaeva chloroplast light harvesting chlor...	62	2e-06
150	gb\|AY617091.1\| Pinus strobus chloroplast light harvesting chloro...	62	2e-06
151	gb\|AY617090.1\| Pinus monticola chloroplast light harvesting chlo...	62	2e-06
152	gb\|AY617089.1\| Pinus lambertiana chloroplast light harvesting ch...	62	2e-06
153	gb\|AY617087.1\| Pinus chiapensis chloroplast light harvesting chl...	62	2e-06
154	gb\|L29644.1\|EGRLHCPII Euglena gracilis chlorophyll a/b binding p...	62	2e-06
155	gb\|AF458406.1\|AF458406 Brassica oleracea chlorophyll a/b binding...	60	6e-06
156	emb\|AJ538464.1\|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC...	60	6e-06
157	emb\|X81810.1\|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig...	60	6e-06
158	emb\|X81809.1\|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh...	60	6e-06
159	gb\|AY104614.1\| Zea mays PCO084486 mRNA sequence	60	6e-06
160	dbj\|AP006706.1\| Lotus japonicus genomic DNA, chromosome 3, clone...	60	6e-06
161	gb\|M21397.1\|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab...	60	6e-06
162	dbj\|AB115772.1\| Physcomitrella patens subsp. patens PpLhcb2 gene...	58	2e-05
163	emb\|AJ234428.1\|HVU234428 Hordeum vulgare partial mRNA; clone cMW...	58	2e-05
164	emb\|Z16408.1\|PSLHCB51 P.sylvestris Lhcb5*1 mRNA encoding Lhcb5 p...	58	2e-05
165	emb\|X16647.1\|RSCHABBP Radish mRNA for chlorophyll a/b binding pr...	58	2e-05
166	gb\|M60049.1\|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,...	58	2e-05
167	gb\|AF398747.1\|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gen...	56	9e-05
168	gb\|AF398745.1\|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, e...	56	9e-05
169	gb\|AF398744.1\|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons ...	56	9e-05
170	gb\|AF398743.1\|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, ex...	56	9e-05
171	gb\|AF398741.1\|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C)...	56	9e-05
172	gb\|AF398739.1\|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene,...	56	9e-05
173	gb\|AF398738.1\|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) ...	56	9e-05
174	gb\|AF398737.1\|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, e...	56	9e-05
175	gb\|AF398736.1\|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) ge...	56	9e-05
176	gb\|AF398735.1\|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) ge...	56	9e-05
177	gb\|AF398734.1\|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB...	56	9e-05
178	gb\|AF398733.1\|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB...	56	9e-05
179	gb\|AF398732.1\|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-...	56	9e-05
180	gb\|AF398731.1\|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A)...	56	9e-05
181	gb\|AF398730.1\|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) g...	56	9e-05
182	gb\|AF398729.1\|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-...	56	9e-05
183	gb\|AF398728.1\|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) ...	56	9e-05
184	gb\|AF398726.1\|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) ge...	56	9e-05
185	gb\|AF398725.1\|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) ge...	56	9e-05
186	gb\|AF398723.1\|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-...	56	9e-05
187	dbj\|AB122118.1\| Chlamydomonas reinhardtii LhcI-5 gene for light-...	56	9e-05
188	emb\|X12981.1\|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll...	56	9e-05
189	gb\|M30622.1\|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-...	56	9e-05
190	gb\|AY267623.1\| Bigelowiella natans chlorophyll a/b-binding prote...	54	4e-04
191	gb\|AY617096.1\| Picea sitchensis chloroplast light harvesting chl...	54	4e-04
192	gb\|AF268321.1\|AF268321 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
193	gb\|AF268320.1\|AF268320 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
194	gb\|AF268319.1\|AF268319 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
195	gb\|AF003128.1\|AF003128 Mesembryanthemum crystallinum chlorophyll...	54	4e-04
196	gb\|AY389606.1\| Hyacinthus orientalis chloroplast chlorophyll A-B...	52	0.001
197	ref\|NM_128995.2\| Arabidopsis thaliana LHB1B1; chlorophyll bindin...	50	0.006
198	ref\|NM_126537.2\| Arabidopsis thaliana LHCB2.2; chlorophyll bindi...	50	0.006
199	ref\|NM_001036246.1\| Arabidopsis thaliana ATP binding / kinase/ p...	50	0.006
200	ref\|NM_001036402.1\| Arabidopsis thaliana O-acetyltransferase AT2...	50	0.006
201	ref\|NM_001036401.1\| Arabidopsis thaliana O-acetyltransferase AT2...	50	0.006
202	ref\|NM_128994.2\| Arabidopsis thaliana LHB1B2; chlorophyll bindin...	50	0.006
203	ref\|NM_179900.1\| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ...	50	0.006
204	gb\|AY389549.1\| Hyacinthus orientalis chloroplast chlorophyll A-B...	50	0.006
205	gb\|DQ226725.1\| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence	50	0.006
206	gb\|BT014450.1\| Lycopersicon esculentum clone 133776F, mRNA sequence	50	0.006
207	emb\|X16436.1\|SACAB Mustard cab gene for chlorophyll a/b-binding ...	50	0.006
208	gb\|AF517869.1\| Griffithsia japonica isolate Gj446 light-harvest ...	50	0.006
209	gb\|AY142513.1\| Arabidopsis thaliana putative photosystem II type...	50	0.006
210	gb\|AY288914.1\| Brassica oleracea chlorophyll a/b binding protein...	50	0.006
211	gb\|AY045806.1\| Arabidopsis thaliana putative photosystem II type...	50	0.006
212	gb\|AF339687.1\| Arabidopsis thaliana putative photosystem II type...	50	0.006
213	gb\|AF326864.1\| Arabidopsis thaliana putative photosystem II type...	50	0.006
214	gb\|AY120776.1\| Arabidopsis thaliana putative photosystem II type...	50	0.006
215	gb\|AY093372.1\| Arabidopsis thaliana putative chlorophyll a/b bin...	50	0.006
216	gb\|AC007211.6\| Arabidopsis thaliana chromosome 2 BAC F1O13 genom...	50	0.006
217	gb\|AC004481.3\| Arabidopsis thaliana chromosome 2 clone F13P17 ma...	50	0.006
218	gb\|AC004077.3\| Arabidopsis thaliana chromosome 2 clone T31E10 ma...	50	0.006
219	gb\|AY081587.1\| Arabidopsis thaliana photosystem II type I chloro...	50	0.006
220	gb\|AY079110.1\| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	50	0.006
221	gb\|AY079101.1\| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	50	0.006
222	gb\|AY066036.1\| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com...	50	0.006
223	gb\|AY065125.1\| Arabidopsis thaliana photosystem II type I chloro...	50	0.006
224	gb\|AY062563.1\| Arabidopsis thaliana putative chlorophyll a/b bin...	50	0.006
225	gb\|AF419587.1\|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.006
226	gb\|AF419548.1\|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.006
227	gb\|AF428397.1\|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.006
228	gb\|AY054218.1\| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com...	50	0.006
229	gb\|AF398727.1\|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, e...	50	0.006
230	gb\|AF398724.1\|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB...	50	0.006
231	gb\|AY039561.1\| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	50	0.006
232	gb\|AF372886.1\|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ...	50	0.006
233	gb\|AF324693.2\|AF324693 Arabidopsis thaliana At2g34430 (At2g34430...	50	0.006
234	emb\|BX819881.1\|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co...	50	0.006
235	emb\|BX819347.1\|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co...	50	0.006
236	emb\|BX819270.1\|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co...	50	0.006
237	emb\|BX821505.1\|CNS0A93G Arabidopsis thaliana Full-length cDNA Co...	50	0.006
238	emb\|BX820206.1\|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co...	50	0.006
239	emb\|BX820202.1\|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co...	50	0.006
240	emb\|BX820019.1\|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co...	50	0.006
241	emb\|BX820007.1\|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co...	50	0.006
242	emb\|BX819668.1\|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co...	50	0.006
243	emb\|BX821638.1\|CNS0A92F Arabidopsis thaliana Full-length cDNA Co...	50	0.006
244	emb\|BX819509.1\|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co...	50	0.006
245	emb\|BX822910.1\|CNS0A63G Arabidopsis thaliana Full-length cDNA Co...	50	0.006
246	dbj\|AB206466.1\| Adiantum capillus-veneris AcCab1 gene for chloro...	50	0.006
247	gb\|AY086307.1\| Arabidopsis thaliana clone 23727 mRNA, complete s...	50	0.006
248	gb\|AF134123.1\| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA...	50	0.006
249	gb\|AF134122.1\| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA...	50	0.006
250	gb\|AF139467.2\|AF139467 Vigna radiata LHCII type I chlorophyll a/...	50	0.006
251	emb\|X61287.1\|LECAB9 L.esculentum Cab9 gene for type I (26 kD) CP...	50	0.006
252	emb\|X02358.1\|PECAB25 Petunia gene for chlorophyll a/b binding pr...	50	0.006
253	emb\|X17697.1\|MDCHBP Apple light-harvesting chlorophyll a/b bindi...	50	0.006
254	emb\|Y13865.1\|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi...	50	0.006
255	emb\|X15894.1\|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b...	50	0.006
256	emb\|X64459.1\|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ...	50	0.006
257	emb\|X64460.1\|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c...	50	0.006
258	emb\|X52743.1\|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/...	50	0.006
259	emb\|X16535.1\|GMCAB4 G.max DNA for Cab4	50	0.006
260	gb\|BT002103.1\| Arabidopsis thaliana putative photosystem II type...	50	0.006
261	gb\|K00975.1\|PETCAB10 Petunia major chlorophyll a/b binding prote...	50	0.006
262	gb\|K00973.1\|PETCAB3 Petunia major chlorophyll a/b binding protei...	50	0.006
263	gb\|M30620.1\|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-...	50	0.006
264	gb\|M21396.1\|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin...	50	0.006
265	gb\|L07119.1\|COTIIABINA Gossypium hirsutum chloroplast photosyste...	50	0.006
266	dbj\|D14002.1\|LAUCAB Lettuce mRNA for light-harvesting chlorophyl...	50	0.006
267	dbj\|AB012638.1\| Nicotiana sylvestris Lhcb15, Lhcb16 genes for ...	50	0.006
268	ref\|NM_124807.2\| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH...	48	0.023
269	ref\|NM_124808.3\| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA...	48	0.023
270	gb\|DQ185425.1\| Rosa roxburghii clone C40 defense-related mRNA, p...	48	0.023
271	emb\|X61610.1\|BNLHCB3C B.napus gene for LHCII Type III chlorophyl...	48	0.023
272	gb\|AF104633.2\| Chlamydomonas reinhardtii light harvesting comple...	48	0.023
273	gb\|AF361858.1\| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl...	48	0.023
274	gb\|AY057735.1\| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl...	48	0.023
275	gb\|S68728.1\| LHC Ib-21=light-harvesting complex I [Hordeum vulga...	48	0.023
276	gb\|AF372917.1\|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN...	48	0.023
277	emb\|BX830083.1\|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co...	48	0.023
278	emb\|BX831260.1\|CNS09ZEV Arabidopsis thaliana Full-length cDNA Co...	48	0.023
279	emb\|BX831139.1\|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co...	48	0.023
280	gb\|AF110786.1\|AF110786 Volvox carteri f. nagariensis clone G18 l...	48	0.023
281	gb\|AF195794.1\|AF195794 Chlamydomonas reinhardtii chlorophyll A-B...	48	0.023
282	gb\|AF134126.1\| Arabidopsis thaliana chromosome V Lhcb3 protein (...	48	0.023
283	dbj\|AP004756.2\| Oryza sativa (japonica cultivar-group) genomic D...	48	0.023
284	emb\|X61609.1\|BNLHCB3B B.napus gene for LHC II Type III chlorophy...	48	0.023
285	dbj\|AB122119.1\| Chlamydomonas reinhardtii LhcI-6 gene for light-...	48	0.023
286	dbj\|AB122114.1\| Chlamydomonas reinhardtii LhcI-1 gene for light-...	48	0.023
287	dbj\|AB010695.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	48	0.023
288	emb\|X02356.1\|PECAB91R Petunia gene for chlorophyll a/b binding p...	48	0.023
289	emb\|X65119.1\|CRCABI1MR C.reinhardtii cabI-1 mRNA for light harve...	48	0.023
290	gb\|AF218305.1\|AF218305 Hordeum vulgare chlorophyll a/b binding p...	48	0.023
291	dbj\|AK066997.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.023
292	gb\|AF143691.1\|AF143691 Arabidopsis thaliana type III chlorophyll...	48	0.023
293	gb\|K00976.1\|PETCAB102 Petunia major chlorophyll a/b binding prot...	48	0.023
294	gb\|K00974.1\|PETCAB4 Petunia major chlorophyll a/b binding protei...	48	0.023
295	dbj\|AP008949.1\| Lotus japonicus genomic DNA, chromosome 2, clone...	48	0.023
296	gb\|M34396.1\|PMJCABF3 Polystichum munitum chlorophyll a/b-binding...	48	0.023
297	gb\|DQ226825.1\| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence	46	0.091
298	gb\|BT014208.1\| Lycopersicon esculentum clone 133385R, mRNA sequence	46	0.091
299	gb\|AF517872.1\| Griffithsia japonica isolate Gj241 light-harvest ...	46	0.091
300	emb\|BX819530.1\|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co...	46	0.091
301	gb\|U21113.1\|STU21113 Solanum tuberosum chlorophyll a/b binding p...	46	0.091
302	gb\|M30618.1\|TOMCBPD2 Tomato chlorophyll a/b-binding protein Cab-...	46	0.091
303	gb\|M14443.1\|TOMCBPA Tomato chlorophyll a/b-binding protein gene ...	46	0.091
304	gb\|M23531.1\|DUNCBP D.salina major chlorophyll binding protein mR...	46	0.091
305	dbj\|AU066541.1\| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	46	0.091
306	ref\|XM_507384.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
307	ref\|XM_507383.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
308	ref\|XM_507382.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
309	ref\|XM_478841.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.36
310	ref\|XM_507381.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
311	ref\|XM_507380.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
312	ref\|XM_507379.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
313	ref\|XM_506426.2\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.36
314	gb\|AY954738.1\| Ostreococcus tauri chloroplast chlorophyll a/b-bi...	44	0.36
315	gb\|AF398742.1\|AF398742 Centromadia pungens ASCAB9 (ASCAB9) gene,...	44	0.36
316	dbj\|AP003804.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.36
317	dbj\|AB122116.1\| Chlamydomonas reinhardtii LhcI-3 gene for light-...	44	0.36
318	dbj\|AK119176.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
319	emb\|X84308.1\|HVLHCA2 H.vulgare mRNA for photosysteme I antenna p...	44	0.36
320	dbj\|AK104651.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
321	dbj\|AK104608.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
322	dbj\|AK104283.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
323	dbj\|AK104177.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
324	dbj\|AK104127.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
325	dbj\|AK104016.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
326	dbj\|AK103966.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
327	dbj\|AK070051.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
328	dbj\|AK060987.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.36
329	gb\|AY105356.1\| Zea mays PCO075138 mRNA sequence	44	0.36
330	gb\|AY105333.1\| Zea mays PCO095488 mRNA sequence	44	0.36
331	dbj\|AP005228.3\| Homo sapiens genomic DNA, chromosome 18 clone:RP...	44	0.36
332	gb\|U22329.1\|VCU22329 Volvox carteri light harvesting complex a m...	44	0.36
333	dbj\|AP000874.4\| Homo sapiens genomic DNA, chromosome 18 clone:RP...	44	0.36
334	gb\|AY845254.1\| Pisum sativum light-harvesting chlorophyll-a/b bi...	42	1.4
335	ref\|NM_102733.2\| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND...	42	1.4
336	ref\|NM_102731.2\| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND...	42	1.4
337	ref\|NM_126540.2\| Arabidopsis thaliana LHCB2.1; chlorophyll bindi...	42	1.4
338	gb\|DQ124219.1\| Fagus sylvatica putative chlorophyll a/b-binding ...	42	1.4
339	gb\|AC003084.1\| Homo sapiens BAC clone CTB-84D4 from 7, complete ...	42	1.4
340	gb\|AY045787.1\| Arabidopsis thaliana At2g05100 mRNA sequence	42	1.4
341	gb\|AY091169.1\| Arabidopsis thaliana putative chlorophyll a/b-bin...	42	1.4
342	gb\|AY050935.1\| Arabidopsis thaliana putative photosystem II type...	42	1.4
343	emb\|AL939113.1\|SCO939113 Streptomyces coelicolor A3(2) complete ...	42	1.4
344	gb\|AY114594.1\| Arabidopsis thaliana chlorophyll a/b-binding prot...	42	1.4
345	gb\|AC007443.5\| Arabidopsis thaliana chromosome 2 clone F15L11 ma...	42	1.4
346	gb\|AC145591.5\| Mus musculus BAC clone RP24-176N2 from chromosome...	42	1.4
347	gb\|AY065165.1\| Arabidopsis thaliana chlorophyll a/b-binding prot...	42	1.4
348	gb\|AY058180.1\| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	42	1.4
349	gb\|AF428359.1\|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m...	42	1.4
350	gb\|AY052348.1\| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com...	42	1.4
351	gb\|AY052275.1\| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com...	42	1.4
352	gb\|AY045673.1\| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	42	1.4
353	gb\|DQ356257.1\| Homo sapiens isolate cftr10471_A cystic fibrosis ...	42	1.4
354	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.4
355	emb\|BX815726.1\|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
356	emb\|BX817619.1\|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co...	42	1.4
357	emb\|BX821952.1\|CNS0AABH Arabidopsis thaliana Full-length cDNA Co...	42	1.4
358	emb\|BX819843.1\|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co...	42	1.4
359	emb\|BX819702.1\|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
360	emb\|BX821844.1\|CNS0A936 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
361	emb\|BX821132.1\|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co...	42	1.4
362	emb\|BX819861.1\|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co...	42	1.4
363	emb\|BX819751.1\|CNS0A9F6 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
364	emb\|BX819688.1\|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
365	emb\|BX819687.1\|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
366	emb\|BX819683.1\|CNS0A80L Arabidopsis thaliana Full-length cDNA Co...	42	1.4
367	emb\|BX842010.1\|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co...	42	1.4
368	gb\|DP000025.1\| Gorilla gorilla gorilla target 1 genomic scaffold	42	1.4
369	gb\|AC022455.5\|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P...	42	1.4
370	gb\|AF312227.1\|AF312227 Citrus reticulata light-harvesting chloro...	42	1.4
371	gb\|AC008030.4\|AC008030 Arabidopsis thaliana chromosome I BAC F1N...	42	1.4
372	gb\|AY086905.1\| Arabidopsis thaliana clone 29298 mRNA, complete s...	42	1.4
373	gb\|AF134124.1\| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA...	42	1.4
374	emb\|AJ538931.1\|NTA538931 Nicotiana tabacum cDNA-AFLP-fragment BT...	42	1.4
375	emb\|AJ538874.1\|NTA538874 Nicotiana tabacum cDNA-AFLP-fragment BT...	42	1.4
376	emb\|AJ538840.1\|NTA538840 Nicotiana tabacum cDNA-AFLP-fragment BT...	42	1.4
377	emb\|AJ538493.1\|NTA538493 Nicotiana tabacum cDNA-AFLP-fragment BC...	42	1.4
378	dbj\|AP003629.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.4
379	dbj\|AB115771.1\| Physcomitrella patens subsp. patens PpLhcb1 gene...	42	1.4
380	emb\|X02357.1\|PECAB13 Petunia gene for chlorophyll a/b binding pr...	42	1.4
381	emb\|X58230.1\|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind...	42	1.4
382	emb\|X58229.1\|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin...	42	1.4
383	emb\|X03909.1\|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy...	42	1.4
384	emb\|X03908.1\|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy...	42	1.4
385	emb\|X95727.1\|BJMCAB1GE B.juncea mRNA for chlorophyll a/b-binding...	42	1.4
386	emb\|Z29965.1\|TRLHCABBP T.repens (Huia) mRNA for light-harvesting...	42	1.4
387	emb\|X16536.1\|GMCAB5 G.max DNA for Cab5	42	1.4
388	emb\|X57082.1\|PSCABII P.sativum Cab II gene for chlorophyll a/b-b...	42	1.4
389	gb\|BT001933.1\| Arabidopsis thaliana clone C105385 putative chlor...	42	1.4
390	gb\|AF034631.1\|AF034631 Panax ginseng chlorophyll a/b binding pro...	42	1.4
391	gb\|AF003127.1\|AF003127 Mesembryanthemum crystallinum chlorophyll...	42	1.4
392	gb\|U25812.1\|PSU25812 Pseudomonas syringae pv. syringae hrp gene ...	42	1.4
393	gb\|U01964.1\|GMU01964 Glycine max cv. Dare photosystem II type I ...	42	1.4
394	dbj\|AB012641.1\| Nicotiana sylvestris Lhcb1*9 gene for light harv...	42	1.4
395	dbj\|AB012640.1\| Nicotiana sylvestris Lhcb1*8 gene for light harv...	42	1.4
396	dbj\|AB012637.1\| Nicotiana sylvestris Lhcb12, Lhcb13, Lhcb1*4 g...	42	1.4
397	dbj\|AB012636.1\| Nicotiana sylvestris Lhcb1*1 gene for light harv...	42	1.4
398	dbj\|AB006081.1\| Fagus crenata mRNA for chlorophyll a/b-binding p...	42	1.4
399	ref\|NM_122728.1\| Arabidopsis thaliana chlorophyll binding AT5G28...	40	5.6
400	ref\|NM_116012.2\| Arabidopsis thaliana LHCA2; chlorophyll binding...	40	5.6
401	ref\|XM_478415.1\| Oryza sativa (japonica cultivar-group), mRNA	40	5.6
402	gb\|AC139637.17\| Mus musculus chromosome 15, clone RP24-253M12, c...	40	5.6
403	ref\|NM_001039970.1\| Homo sapiens protein tyrosine phosphatase, n...	40	5.6
404	ref\|NM_032781.3\| Homo sapiens protein tyrosine phosphatase, non-...	40	5.6
405	ref\|NM_006906.1\| Homo sapiens protein tyrosine phosphatase, non-...	40	5.6
406	gb\|CP000359.1\| Deinococcus geothermalis DSM 11300, complete genome	40	5.6
407	gb\|BT013404.1\| Lycopersicon esculentum clone 135718R, mRNA sequence	40	5.6
408	gb\|BT012757.1\| Lycopersicon esculentum clone 113701F, mRNA sequence	40	5.6
409	gb\|BT012040.1\| Arabidopsis thaliana At5g28450 mRNA sequence	40	5.6
410	gb\|CP000115.1\| Nitrobacter winogradskyi Nb-255, complete genome	40	5.6
411	gb\|AC142474.4\| Mus musculus BAC clone RP24-362N7 from chromosome...	40	5.6
412	ref\|XM_883654.1\| Candida albicans SC5314 hypothetical protein (C...	40	5.6
413	ref\|XM_707383.1\| Candida albicans SC5314 potential guanine nucle...	40	5.6
414	gb\|BC046435.1\| Homo sapiens protein tyrosine phosphatase, non-re...	40	5.6
415	gb\|BC064807.1\| Homo sapiens protein tyrosine phosphatase, non-re...	40	5.6
416	gb\|BC039897.1\| Homo sapiens protein tyrosine phosphatase, non-re...	40	5.6
417	emb\|Z22873.1\|TABETGLUA T.aestivum beta glucanase mRNA, complete CDS	40	5.6
418	emb\|CR555306.1\| Azoarcus sp. EbN1 complete genome	40	5.6
419	emb\|AL832541.1\|HSM803850 Homo sapiens mRNA; cDNA DKFZp547A0817 (...	40	5.6
420	emb\|AL132962.1\|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA...	40	5.6
421	gb\|AY065429.1\| Arabidopsis thaliana putative Lhca2 protein (At3g...	40	5.6
422	emb\|AL806524.10\| Mouse DNA sequence from clone RP23-158E10 on ch...	40	5.6
423	gb\|AC123776.5\| Homo sapiens chromosome 8, clone RP11-213I2, comp...	40	5.6
424	gb\|CP000301.1\| Rhodopseudomonas palustris BisB18, complete genome	40	5.6
425	dbj\|AK127312.1\| Homo sapiens cDNA FLJ45381 fis, clone BRHIP30210...	40	5.6
426	dbj\|AK090923.1\| Homo sapiens cDNA FLJ33604 fis, clone BRAMY20152...	40	5.6
427	dbj\|AK027333.1\| Homo sapiens cDNA FLJ14427 fis, clone HEMBA1006173	40	5.6
428	dbj\|AK055450.1\| Homo sapiens cDNA FLJ30888 fis, clone FEBRA20050...	40	5.6
429	gb\|AC103974.6\| Homo sapiens chromosome 11, clone RP11-1081L13, c...	40	5.6
430	gb\|BC028338.1\| Homo sapiens, clone IMAGE:5195357, mRNA	40	5.6
431	gb\|AY072483.1\| Arabidopsis thaliana Lhca2 protein (At3g61470; F2...	40	5.6
432	gb\|AY054670.1\| Arabidopsis thaliana Lhca2 protein (At3g61470; F2...	40	5.6
433	emb\|BX530075.7\| Zebrafish DNA sequence from clone CH211-1O14 in ...	40	5.6
434	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	5.6
435	emb\|AL731618.3\|OSJN00269 Oryza sativa genomic DNA, chromosome 4,...	40	5.6
436	emb\|BX822099.1\|CNS0A7GL Arabidopsis thaliana Full-length cDNA Co...	40	5.6
437	emb\|BX823150.1\|CNS0A635 Arabidopsis thaliana Full-length cDNA Co...	40	5.6
438	emb\|BX822082.1\|CNS0A5ZI Arabidopsis thaliana Full-length cDNA Co...	40	5.6
439	emb\|BX822402.1\|CNS0A5WB Arabidopsis thaliana Full-length cDNA Co...	40	5.6
440	emb\|BX823776.1\|CNS0A5AG Arabidopsis thaliana Full-length cDNA Co...	40	5.6
441	emb\|BX823614.1\|CNS0A5E1 Arabidopsis thaliana Full-length cDNA Co...	40	5.6
442	emb\|BX822984.1\|CNS0A4P7 Arabidopsis thaliana Full-length cDNA Co...	40	5.6
443	emb\|BX842122.1\|CNS09YDD Arabidopsis thaliana Full-length cDNA Co...	40	5.6
444	gb\|AC021093.16\|AC021093 Homo sapiens chromosome 8 clone RP11-213...	40	5.6
445	gb\|AY198376.1\| Citrus limon chlorophyll a/b-binding protein prec...	40	5.6
446	gb\|BC047349.1\| Mus musculus, clone IMAGE:3595895, mRNA	40	5.6
447	gb\|AC011200.9\|AC011200 Homo sapiens chromosome 8 clone RP11-71N3...	40	5.6
448	gb\|AC131042.6\| Homo sapiens chromosome 8, clone CTD-2607C6, comp...	40	5.6
449	gb\|AY088983.1\| Arabidopsis thaliana clone 123159 mRNA, complete ...	40	5.6
450	gb\|AF497482.1\| Micromonospora echinospora calicheamicin biosynth...	40	5.6
451	gb\|AF134120.1\| Arabidopsis thaliana Lhca2 protein (Lhca2) mRNA, ...	40	5.6
452	gb\|AF262038.1\|F21B23 Arabidopsis thaliana BAC F21B23	40	5.6
453	dbj\|BA000040.2\| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	5.6
454	dbj\|AP006618.1\| Nocardia farcinica IFM 10152 DNA, complete genome	40	5.6
455	dbj\|AP005320.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	5.6
456	dbj\|AB060245.1\| Macaca fascicularis brain cDNA clone:QflA-15249,...	40	5.6
457	emb\|X02360.1\|PECAB22R Petunia gene for chlorophyll a/b binding p...	40	5.6
458	emb\|X52744.1\|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/...	40	5.6
459	emb\|X60275.1\|LELHBC1G L.esculentum lhbC1 gene for LHCII type III	40	5.6
460	dbj\|AK102726.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.6
461	dbj\|AK069570.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.6
462	gb\|BT002070.1\| Arabidopsis thaliana Lhca2 protein (At3g61470) mR...	40	5.6
463	gb\|K00972.1\|PETCAB146 Petunia major chlorophyll a/b binding prot...	40	5.6
464	gb\|U68715.1\|BFU68715 Botryotinia fuckeliana endopolygalacturonas...	40	5.6
465	gb\|AF003129.1\|AF003129 Mesembryanthemum crystallinum chlorophyll...	40	5.6
466	dbj\|AP006852.1\| Candida albicans genomic DNA, chromosome 7, comp...	40	5.6
467	emb\|AL390254.6\|CNS06C7M Human chromosome 14 DNA sequence BAC R-9...	40	5.6
468	gb\|U21112.1\|STU21112 Solanum tuberosum chlorophyll a/b binding p...	40	5.6
469	emb\|X12861.1\|EGLHCI38 Euglena gracilis mRNA fragment for LHCI pr...	40	5.6
470	gb\|M15214.1\|TOMCBPH Tomato chlorophyll a/b-binding protein gene ...	40	5.6
471	gb\|M14444.1\|TOMCBPB Tomato chlorophyll a/b-binding protein gene ...	40	5.6
472	dbj\|AB008771.1\| Streptomyces thermoviolaceus nagA gene for beta-...	40	5.6

>emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for core chlorophyll a/b
            binding (CAB) protein of photosystem II (PSII)
          Length = 2689

 Score =  783 bits (395), Expect = 0.0
 Identities = 413/417 (99%), Gaps = 2/417 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    tagcagtggtccgaaactcccatcagtaaatcagnaacggtcatgtttcttctgcccttg 60
            |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||
Sbjct: 2443 tagcagtggtccgaaactcccatcag-aaatcag-aacggtcatgtttcttctgcccttg 2386

                                                                        
Query: 61   ntaatttacacgtacggcacattcgtactctcatacttttccccggtaaaattcacacag 120
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2385 ataatttacacgtacggcacattcgtactctcatacttttccccggtaaaattcacacag 2326

                                                                        
Query: 121  cacatcatgctgcatcgcacgcacgcatgcagctgagcatcaacagccgacggcggcgga 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2325 cacatcatgctgcatcgcacgcacgcatgcagctgagcatcaacagccgacggcggcgga 2266

                                                                        
Query: 181  cgggcaatcaacggccagctcacaggctgggcaccctctcggcggcgccggagatgacgg 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2265 cgggcaatcaacggccagctcacaggctgggcaccctctcggcggcgccggagatgacgg 2206

                                                                        
Query: 241  tgagcaggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccct 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2205 tgagcaggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccct 2146

                                                                        
Query: 301  cgccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgt 360
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2145 cgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgt 2086

                                                                     
Query: 361  tcttgatctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccga 417
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2085 tcttgatctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccga 2029



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 1    tagcagtggtccgaaactcccatcag 26
            ||||||||||||||||||||||||||
Sbjct: 2510 tagcagtggtccgaaactcccatcag 2485

to top

>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0091I11, complete sequence
          Length = 135993

 Score =  293 bits (148), Expect = 2e-76
 Identities = 189/203 (93%)
 Strand = Plus / Minus

                                                                         
Query: 202   acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
             |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 40261 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 40202

                                                                         
Query: 262   ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
             |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 40201 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 40142

                                                                         
Query: 322   tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
             ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 40141 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 40082

                                    
Query: 382   gcagcgccgcctggtcggggtcg 404
             |||||||||||||||| ||||||
Sbjct: 40081 gcagcgccgcctggtccgggtcg 40059

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  293 bits (148), Expect = 2e-76
 Identities = 189/203 (93%)
 Strand = Plus / Minus

                                                                           
Query: 202     acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
               |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7581175 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7581116

                                                                           
Query: 262     ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
               |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 7581115 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7581056

                                                                           
Query: 322     tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
               ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 7581055 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7580996

                                      
Query: 382     gcagcgccgcctggtcggggtcg 404
               |||||||||||||||| ||||||
Sbjct: 7580995 gcagcgccgcctggtccgggtcg 7580973

to top

>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full
           insert sequence
          Length = 1157

 Score =  293 bits (148), Expect = 2e-76
 Identities = 189/203 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 940 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 881

                                                                       
Query: 262 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
           |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 880 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 821

                                                                       
Query: 322 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 820 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 761

                                  
Query: 382 gcagcgccgcctggtcggggtcg 404
           |||||||||||||||| ||||||
Sbjct: 760 gcagcgccgcctggtccgggtcg 738

to top

>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full
           insert sequence
          Length = 1101

 Score =  293 bits (148), Expect = 2e-76
 Identities = 189/203 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 930 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 871

                                                                       
Query: 262 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
           |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 870 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 811

                                                                       
Query: 322 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 810 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 751

                                  
Query: 382 gcagcgccgcctggtcggggtcg 404
           |||||||||||||||| ||||||
Sbjct: 750 gcagcgccgcctggtccgggtcg 728

to top

>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full
           insert sequence
          Length = 1186

 Score =  293 bits (148), Expect = 2e-76
 Identities = 189/203 (93%)
 Strand = Plus / Minus

                                                                       
Query: 202 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 941 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 882

                                                                       
Query: 262 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
           |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 881 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 822

                                                                       
Query: 322 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 821 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 762

                                  
Query: 382 gcagcgccgcctggtcggggtcg 404
           |||||||||||||||| ||||||
Sbjct: 761 gcagcgccgcctggtccgggtcg 739

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  293 bits (148), Expect = 2e-76
 Identities = 189/203 (93%)
 Strand = Plus / Minus

                                                                           
Query: 202     acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
               |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7651262 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7651203

                                                                           
Query: 262     ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
               |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 7651202 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7651143

                                                                           
Query: 322     tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
               ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 7651142 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7651083

                                      
Query: 382     gcagcgccgcctggtcggggtcg 404
               |||||||||||||||| ||||||
Sbjct: 7651082 gcagcgccgcctggtccgggtcg 7651060

to top

>dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, partial sequence
          Length = 556

 Score =  268 bits (135), Expect = 1e-68
 Identities = 179/194 (92%)
 Strand = Plus / Minus

                                                                       
Query: 202 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 336

                                                                       
Query: 262 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
           |||||||||||||   | | |||||||||| ||| ||||||||||||||||| |||||||
Sbjct: 335 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 276

                                                                       
Query: 322 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
           ||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||| |
Sbjct: 275 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaacttca 216

                         
Query: 382 gcagcgccgcctgg 395
           ||||||||| ||||
Sbjct: 215 gcagcgccgtctgg 202

to top

>gb|AY105650.1| Zea mays PCO135935 mRNA sequence
          Length = 1366

 Score =  250 bits (126), Expect = 3e-63
 Identities = 194/217 (89%)
 Strand = Plus / Minus

                                                                        
Query: 199  ctcacaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccga 258
            ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1028 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 969

                                                                        
Query: 259  aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcct 318
            ||||||||||||||||   |   |||||||||| ||| || |||||||||||||| ||||
Sbjct: 968  aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 909

                                                                        
Query: 319  ggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 378
            ||||||||||| | | ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 908  ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 849

                                                 
Query: 379  tgagcagcgccgcctggtcggggtcggtggcgaggcc 415
            |||| |  || ||||||||||||||| |||| |||||
Sbjct: 848  tgaggatggcggcctggtcggggtcgctggccaggcc 812

to top

>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA,
           complete cds
          Length = 957

 Score =  246 bits (124), Expect = 5e-62
 Identities = 189/211 (89%)
 Strand = Plus / Minus

                                                                       
Query: 199 ctcacaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccga 258
           ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 886 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 827

                                                                       
Query: 259 aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcct 318
           ||||||||||||||||   |   |||||||||| ||| || |||||||||||||| ||||
Sbjct: 826 aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 767

                                                                       
Query: 319 ggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 378
           ||||||||||| | | ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 766 ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 707

                                          
Query: 379 tgagcagcgccgcctggtcggggtcggtggc 409
           |||| |  || ||||||||||||||| ||||
Sbjct: 706 tgaggatggcggcctggtcggggtcgctggc 676

to top

>gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-2) mRNA,
           complete cds
          Length = 1073

 Score =  220 bits (111), Expect = 3e-54
 Identities = 188/214 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
           ||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 881 acaggctaggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 822

                                                                       
Query: 262 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
           |||||||||||||   |   |||||||| | ||| || |||||||||||||| |||||||
Sbjct: 821 ggtcgctgaggtgcttggcgaggttctccacggggccttcgccggtgacgtaggcctgga 762

                                                                       
Query: 322 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
           |||||||| | | |||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 761 tgaagaaggcgaacatggagaacatcgcgagccggccgttcttgatctccttcaccttga 702

                                             
Query: 382 gcagcgccgcctggtcggggtcggtggcgaggcc 415
           | |  || ||||||||||||||| |||| |||||
Sbjct: 701 ggatggcggcctggtcggggtcgctggccaggcc 668

to top

>gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light harvesting protein
           mRNA, partial cds
          Length = 364

 Score =  210 bits (106), Expect = 3e-51
 Identities = 171/193 (88%)
 Strand = Plus / Minus

                                                                       
Query: 202 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 261
           ||||||||||  ||||||||||||| || |||||||||||||||||||||||||||||||
Sbjct: 193 acaggctgggtgccctctcggcggcaccagagatgacggtgagcaggttgttgccgaagg 134

                                                                       
Query: 262 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctgga 321
           |||||||||||||   |   |||||||||| ||| ||| |||| |||||||| |||||||
Sbjct: 133 ggtcgctgaggtgcttggcgaggttctcgacgggacccccgcctgtgacgtaggcctgga 74

                                                                       
Query: 322 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 381
           | |||||| | | ||||||||||||||||||||  |||||||||||||||||||||||||
Sbjct: 73  taaagaaggcgaacatggagaacatggccagcctgccgttcttgatctccttcaccttga 14

                        
Query: 382 gcagcgccgcctg 394
           |||| ||||||||
Sbjct: 13  gcagagccgcctg 1

to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  113 bits (57), Expect = 5e-22
 Identities = 113/132 (85%)
 Strand = Plus / Minus

                                                                        
Query: 248  gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
            ||||||| ||| |||||||  || |||| ||  ||||||||||| ||| |||| ||||||
Sbjct: 1495 gttgttggcgacggggtcggcgatgtggtcggccaggttctcgatggggcccttgccggt 1436

                                                                        
Query: 308  gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
            ||||   ||||| | ||||||||| | ||||||||||||||||||||| |||||||||||
Sbjct: 1435 gacgatggcctgaacgaagaagccgaacatggagaacatggccagccgcccgttcttgat 1376

                        
Query: 368  ctccttcacctt 379
            ||||||||||||
Sbjct: 1375 ctccttcacctt 1364

to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 713 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 654

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 653 aacatggcgaggcggccgttcttgatctccttcaccttgagc 612

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                            
Query: 282      aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
                |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 10793709 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 10793650

                                                          
Query: 342      aacatggccagccgtccgttcttgatctccttcaccttgagc 383
                |||||||| || || |||||||||||||||||||||||||||
Sbjct: 10793649 aacatggcgaggcggccgttcttgatctccttcaccttgagc 10793608



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 348     gccagccgtccgttcttgatctccttcacctt 379
               ||||| || |||||||||||||||||||||||
Sbjct: 7133596 gccaggcgaccgttcttgatctccttcacctt 7133565

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                            
Query: 282      aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
                |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 23604256 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 23604197

                                                          
Query: 342      aacatggccagccgtccgttcttgatctccttcaccttgagc 383
                |||||||| || || |||||||||||||||||||||||||||
Sbjct: 23604196 aacatggcgaggcggccgttcttgatctccttcaccttgagc 23604155



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                            
Query: 260      ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
                |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 30025084 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 30025025

                                                                            
Query: 320      gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
                || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 30025024 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 30024965

                    
Query: 380      gagc 383
                ||||
Sbjct: 30024964 gagc 30024961

to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                         
Query: 282   aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
             |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 17432 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 17373

                                                       
Query: 342   aacatggccagccgtccgttcttgatctccttcaccttgagc 383
             |||||||| || || |||||||||||||||||||||||||||
Sbjct: 17372 aacatggcgaggcggccgttcttgatctccttcaccttgagc 17331

to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                         
Query: 282   aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
             |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 66955 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 66896

                                                       
Query: 342   aacatggccagccgtccgttcttgatctccttcaccttgagc 383
             |||||||| || || |||||||||||||||||||||||||||
Sbjct: 66895 aacatggcgaggcggccgttcttgatctccttcaccttgagc 66854

to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                          
Query: 282    aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
              |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 130327 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 130268

                                                        
Query: 342    aacatggccagccgtccgttcttgatctccttcaccttgagc 383
              |||||||| || || |||||||||||||||||||||||||||
Sbjct: 130267 aacatggcgaggcggccgttcttgatctccttcaccttgagc 130226

to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagc 683

to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 783 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 724

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 723 aacatggcgaggcggccgttcttgatctccttcaccttgagc 682

to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                        
Query: 282  aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
            |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 1213 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1154

                                                      
Query: 342  aacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||| || || |||||||||||||||||||||||||||
Sbjct: 1153 aacatggcgaggcggccgttcttgatctccttcaccttgagc 1112

to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 777 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 718

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 717 aacatggcgaggcggccgttcttgatctccttcaccttgagc 676

to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagc 681

to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagc 683

to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagc 681

to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  109 bits (55), Expect = 7e-21
 Identities = 90/102 (88%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagc 681

to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 676 ctccttgaccttgagc 661

to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 822 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 763

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 762 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 703

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 702 ctccttgaccttgagc 687

to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 707 ctccttgaccttgagc 692

to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 860 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 801

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 800 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 741

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 740 ctccttgaccttgagc 725

to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Plus

                                                                         
Query: 248   gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
             ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 79011 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 79070

                                                                         
Query: 308   gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
             ||||   ||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 79071 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 79130

                             
Query: 368   ctccttcaccttgagc 383
             ||||||||||||||||
Sbjct: 79131 ctccttcaccttgagc 79146

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 248      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
                ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 21808805 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21808746

                                                                            
Query: 308      gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
                ||||   ||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 21808745 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21808686

                                
Query: 368      ctccttcaccttgagc 383
                ||||||||||||||||
Sbjct: 21808685 ctccttcaccttgagc 21808670

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 248      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
                ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 22434833 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 22434774

                                                                            
Query: 308      gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
                ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 22434773 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 22434714

                                
Query: 368      ctccttcaccttgagc 383
                |||||| |||||||||
Sbjct: 22434713 ctccttgaccttgagc 22434698



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 344      catggccagccgtccgttcttgatctcctt 373
                |||||| ||||| |||||||||||||||||
Sbjct: 23305209 catggcgagccgcccgttcttgatctcctt 23305180



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 386      cgccgcctggtcggggtcgg 405
                ||||||||||||||||||||
Sbjct: 19834168 cgccgcctggtcggggtcgg 19834187

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                            
Query: 248      gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
                ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 21801834 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21801775

                                                                            
Query: 308      gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
                ||||   ||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 21801774 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21801715

                                
Query: 368      ctccttcaccttgagc 383
                ||||||||||||||||
Sbjct: 21801714 ctccttcaccttgagc 21801699

to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                         
Query: 248   gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
             ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 95900 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 95841

                                                                         
Query: 308   gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
             ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 95840 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 95781

                             
Query: 368   ctccttcaccttgagc 383
             |||||| |||||||||
Sbjct: 95780 ctccttgaccttgagc 95765

to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  105 bits (53), Expect = 1e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                        
Query: 260  ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
            ||||||| |||||||| ||   |||||||||| ||| |||| ||||||||||   |||||
Sbjct: 2670 ggggtcggtgaggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctg 2611

                                                                        
Query: 320  gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
             | ||||||||| | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 2610 cacgaagaagccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 2551

                
Query: 380  gagc 383
            ||||
Sbjct: 2550 gagc 2547

to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 676 ctccttgaccttgagc 661

to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 700 ctccttgaccttgagc 685

to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 705 ctccttgaccttgagc 690

to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 804 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 745

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 744 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 685

                           
Query: 368 ctccttcaccttgagc 383
           ||||||||||||||||
Sbjct: 684 ctccttcaccttgagc 669

to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 707 ctccttgaccttgagc 692

to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 379 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 320

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 319 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 260

                           
Query: 368 ctccttcaccttgagc 383
           ||||||||||||||||
Sbjct: 259 ctccttcaccttgagc 244

to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 793 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 734

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 733 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 674

                           
Query: 368 ctccttcaccttgagc 383
           ||||||||||||||||
Sbjct: 673 ctccttcaccttgagc 658

to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  105 bits (53), Expect = 1e-19
 Identities = 115/136 (84%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| ||||||| ||| |||| || | |||||||||| ||| |||| ||||||
Sbjct: 785 gttgttggcgacggggtcggtgacgtggtcgaagaggttctcgatggggcccttgccggt 726

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||||| |||||| || | ||||||||||||||| || || |||||||||| 
Sbjct: 725 gacgatggcctggacgaagaatccgaacatggagaacatggcgaggcggccgttcttgag 666

                           
Query: 368 ctccttcaccttgagc 383
           ||||||||||||||||
Sbjct: 665 ctccttcaccttgagc 650

to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score =  101 bits (51), Expect = 2e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 282  aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
            |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 1174 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1115

                                                      
Query: 342  aacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||| || || ||||||||||||| |||||||||||||
Sbjct: 1114 aacatggcgaggcggccgttcttgatcttcttcaccttgagc 1073

to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  101 bits (51), Expect = 2e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||| | ||||||||| | |||||||
Sbjct: 791 aggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagccgaacatggag 732

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 731 aacatggcgaggcggccgttcttgatctccttcaccttgagc 690

to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  101 bits (51), Expect = 2e-18
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| ||||||||| | |||||||
Sbjct: 763 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 704

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || || ||||||||||||||||||||||||
Sbjct: 703 aacatggcgaggcggcctttcttgatctccttcaccttgagc 662

to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 747 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 688

                                                                       
Query: 320 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 687 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 628

               
Query: 380 gagc 383
           ||||
Sbjct: 627 gagc 624

to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Plus

                                                                         
Query: 260   ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
             |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 13927 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 13986

                                                                         
Query: 320   gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
             || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 13987 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 14046

                 
Query: 380   gagc 383
             ||||
Sbjct: 14047 gagc 14050

to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 284 gttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaa 343
           |||||||| ||| |||| |||||| |||   ||||||| |||||| || | |||||||||
Sbjct: 634 gttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggagaa 575

                                               
Query: 344 catggccagccgtccgttcttgatctccttcacctt 379
           ||| ||||||||||||||||||||||||||||||||
Sbjct: 574 catcgccagccgtccgttcttgatctccttcacctt 539

to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                         
Query: 260   ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
             |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 21074 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 21015

                                                                         
Query: 320   gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
             || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 21014 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 20955

                 
Query: 380   gagc 383
             ||||
Sbjct: 20954 gagc 20951

to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 789 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 730

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||| | ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 729 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 670

                           
Query: 368 ctccttcaccttgagc 383
           ||||||||||||||||
Sbjct: 669 ctccttcaccttgagc 654

to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769

                                                                       
Query: 320 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709

               
Query: 380 gagc 383
           ||||
Sbjct: 708 gagc 705

to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769

                                                                       
Query: 320 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709

               
Query: 380 gagc 383
           ||||
Sbjct: 708 gagc 705

to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||
Sbjct: 821 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 762

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   | ||||| ||||||||| | ||||||||||||||| || || || ||||||||
Sbjct: 761 gacgatggtctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 702

                           
Query: 368 ctccttcaccttgagc 383
           |||||| |||||||||
Sbjct: 701 ctccttgaccttgagc 686

to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771

                                                                       
Query: 320 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711

               
Query: 380 gagc 383
           ||||
Sbjct: 710 gagc 707

to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 307
           ||||||| ||| |||||||  || |||| || | |||||||||| ||| |||| ||||||
Sbjct: 437 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 378

                                                                       
Query: 308 gacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 367
           ||||   ||||| | ||||||||| | ||||||||||||||| || || |||||||||| 
Sbjct: 377 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 318

                           
Query: 368 ctccttcaccttgagc 383
           ||||||||||||||||
Sbjct: 317 ctccttcaccttgagc 302

to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
           |||||||  ||||||| ||  ||||||||| ||||| |||| ||||||||||   |||||
Sbjct: 813 ggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggtgacgatggcctg 754

                                                                       
Query: 320 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || ||||||||| | ||||||||||||||| || || || |||||||||||||| |||||
Sbjct: 753 gacgaagaagccgaacatggagaacatggcgaggcggccattcttgatctccttgacctt 694

               
Query: 380 gagc 383
           ||||
Sbjct: 693 gagc 690

to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 105/124 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctg 319
           |||||||  ||||||| ||  ||||||||| |  ||||||| ||||||||||   |||||
Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771

                                                                       
Query: 320 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || |||||| || | ||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711

               
Query: 380 gagc 383
           ||||
Sbjct: 710 gagc 707

to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 719 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 660

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 659 gaacatggccaggcggccgttcttgatctccttcacctt 621

to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 720 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 661

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 660 gaacatggccaggcggccgttcttgatctccttcacctt 622

to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 714 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 655

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 654 gaacatggccaggcggccgttcttgatctccttcacctt 616

to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 748 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 689

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| || |||||||||||||||||||||||
Sbjct: 688 gaacatggccaggcggccgttcttgatctccttcacctt 650

to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 281  caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
            |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 1590 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1531

                                                   
Query: 341  gaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||||||| || |||||||||||||||||||||||
Sbjct: 1530 gaacatggccaggcggccgttcttgatctccttcacctt 1492

to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| |||| |||| | | |||||
Sbjct: 313 aggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccgaacctggag 254

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||||||||||||||||||||
Sbjct: 253 aacatggcgaggcggccgttcttgatctccttcaccttgagc 212

to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||||| |||||| || | |||||||
Sbjct: 505 aggttctcgatgggtcccttgccggtgacgatggcctggacgaagaacccaaacatggag 446

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 445 aacatggcgaggcggccgttcttgagctccttcaccttgagc 404

to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 315 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
           ||||||| ||||||||| | |||||||||||||||||| || ||||||||||||||||||
Sbjct: 740 gcctggacgaagaagccgaacatggagaacatggccaggcggccgttcttgatctccttc 681

                
Query: 375 acctt 379
           |||||
Sbjct: 680 acctt 676

to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                       
Query: 284 gttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaa 343
           |||||||| ||||||||  |||||||||   ||||| | |||||| || | |||||||||
Sbjct: 900 gttctcgaggggccccttcccggtgacgatggcctgcacgaagaatccgaacatggagaa 841

                                               
Query: 344 catggccagccgtccgttcttgatctccttcacctt 379
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 840 catggccaggcgtccgttcttgatctccttgacctt 805

to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                        
Query: 284  gttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaa 343
            |||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||||||
Sbjct: 1120 gttctcgagggggcccttcccggtgacgatggcctgcacgaagaacccgaacatggagaa 1061

                                                
Query: 344  catggccagccgtccgttcttgatctccttcacctt 379
            ||||||||| ||||||||||||||||||||||||||
Sbjct: 1060 catggccaggcgtccgttcttgatctccttcacctt 1025

to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 702 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 643

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||| ||||| || |||||||||||||||||||||||
Sbjct: 642 gaacatagccaggcggccgttcttgatctccttcacctt 604

to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 718 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 659

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||| ||||| || |||||||||||||||||||||||
Sbjct: 658 gaacatagccaggcggccgttcttgatctccttcacctt 620

to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                        
Query: 281  caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
            |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 1399 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1340

                                                   
Query: 341  gaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||| ||||| || |||||||||||||||||||||||
Sbjct: 1339 gaacatagccaggcggccgttcttgatctccttcacctt 1301

to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctggatgaagaag 329
           |||||| || |||||||||  | ||| |||| |||||| |||   ||||| | |||||||
Sbjct: 733 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 674

                                                             
Query: 330 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || | |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 673 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 624

to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 282  aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
            ||||||||||  || |||| ||||||||||   ||||||| ||||||||| | |||||| 
Sbjct: 1607 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccgaacatggaa 1548

                                                      
Query: 342  aacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||| || || |||||||||| ||||||||||||||||
Sbjct: 1547 aacatggcgaggcggccgttcttgagctccttcaccttgagc 1506

to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 284 gttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaa 343
           |||||||| ||| |||| ||||||||||   ||||||| |||||| |||| |||||||||
Sbjct: 764 gttctcgatggggcccttgccggtgacgatggcctggacgaagaaacccaacatggagaa 705

                                                 
Query: 344 catggccagccgtccgttcttgatctccttcaccttga 381
           |||||| || || ||||| |||| ||||||||||||||
Sbjct: 704 catggcgaggcggccgttattgaactccttcaccttga 667

to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctggatgaagaag 329
           |||||| || |||||||||  | ||| |||| |||||| |||   ||||| | |||||||
Sbjct: 717 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 658

                                                             
Query: 330 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           || | |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 657 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 608

to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  cacaggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatg 338
            ||||||||||  | ||| |||| |||||| |||   ||||| | ||||||||| | ||||
Sbjct: 1432 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1373

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 1372 gagaacatggccaggcggccgttcttgatctccttcacctt 1332

to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcac 376
           ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 785 gaagaagccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 732

to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 51/54 (94%)
 Strand = Plus / Minus

                                                                 
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcac 376
           ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 778 gaagaagccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 725

to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  cacaggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatg 338
            ||||||||||  | ||| |||| |||||| |||   ||||| | ||||||||| | ||||
Sbjct: 1345 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1286

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||||||||| || |||||||||||||||||||||||
Sbjct: 1285 gagaacatggccaggcggccgttcttgatctccttcacctt 1245

to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 82/96 (85%)
 Strand = Plus / Minus

                                                                       
Query: 284 gttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaa 343
           |||||| || ||||||| |||||| |||   ||||||| ||||||||| | |||||| ||
Sbjct: 397 gttctccaatggccccttgccggtcacgatcgcctggacgaagaagccgaacatggataa 338

                                               
Query: 344 catggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||  || ||||||||||||||||||||
Sbjct: 337 catggccagcctgccattcttgatctccttcacctt 302

to top

>dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, complete cds
          Length = 952

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 76/88 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 agggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaacatggcca 351
           |||| ||||||||||| ||||| | ||||| |  ||||||||||| ||||| ||||||||
Sbjct: 827 aggggccctcgccggtcacgtaggactggacggcgaagcccagcacggagaccatggcca 768

                                       
Query: 352 gccgtccgttcttgatctccttcacctt 379
           | || ||||||||||||||||| |||||
Sbjct: 767 ggcggccgttcttgatctccttgacctt 740



 Score = 46.1 bits (23), Expect = 0.091
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 236 gacggtgagcaggttgttgccgaaggggtcg 266
           |||||| |||||||||| |||||||||||||
Sbjct: 883 gacggtcagcaggttgtagccgaaggggtcg 853

to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           ||||||||||  || |||| ||||||||||   ||||||| |||||| || | |||||||
Sbjct: 737 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaacccgaacatggag 678

                                                   
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttga 381
           |||||||| || || |||||||||| ||||||||||||||
Sbjct: 677 aacatggcgaggcggccgttcttgagctccttcaccttga 638

to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||| | ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 627 gaagaagccgaacatggagaacatggccagccgcccgttctttatctccttcacctt 571

to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || | ||||||||||   ||||||| |||||| || | |||||||
Sbjct: 798 aggttctcgatggggcctttgccggtgacgatggcctggacgaagaaaccgaacatggag 739

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || |||||||||| |||||| |||||
Sbjct: 738 aacatggccaggcggccgttcttgagctccttaacctt 701

to top

>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc
           II) mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 537

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgag 382
           ||||||||| | ||||  |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 450 gaagaagccgaacatgctgaacatggccagacgaccgttcttgatctccttcaccttgag 391

            
Query: 383 c 383
           |
Sbjct: 390 c 390

to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                         
Query: 335  catggagaacatggccagccgtccgttcttgatctccttcacctt 379
            ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 2943 catggagaacatggccagccgaccgttcttaatctccttcacctt 2899

to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgkacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding protein (Cab) mRNA,
           partial cds
          Length = 583

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 329 catggagaacatggccagccgaccgttcttaatctccttcacctt 285

to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||| | ||||||||||||||||||||| |||||||| | ||||||||||||
Sbjct: 760 gaagaagccgaacatggagaacatggccagccgcccgttctttagctccttcacctt 704

to top

>gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll a/b binding protein
           (CipLhcb3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1047

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||||||||||||||| ||| ||||||||||||||||| ||||||
Sbjct: 745 catggagaacatggccagccttccattcttgatctccttcactttgagc 697

to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||| | |||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 476 gaagaagccgaacatggagaacatcgccagccgcccgttcttaatctccttcacctt 420

to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 86/100 (86%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 726 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 667

                                                   
Query: 341 gaacatggcc-agccgtccgttcttgatctccttcacctt 379
           |||||||||| || || |||||||||||||||||||||||
Sbjct: 666 gaacatggccaaggcg-ccgttcttgatctccttcacctt 628

to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 729 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 670

                                                  
Query: 341 gaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||   ||||| || |||||||||||||||||||||||
Sbjct: 669 gaacgatgccaggcggccgttcttgatctccttcacctt 631

to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                       
Query: 297 ccctcgccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgt 356
           |||| ||||||||||   ||||||| |||||| || | |||||||||||| || |||| |
Sbjct: 761 cccttgccggtgacgatggcctggacgaagaatccgaacatggagaacatagctagcctt 702

                                      
Query: 357 ccgttcttgatctccttcaccttgagc 383
           || ||||||| ||||||||||||||||
Sbjct: 701 ccattcttgagctccttcaccttgagc 675

to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 324 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| | ||| ||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 695 aagaagccaaacattgagaacatggcaaggcgaccgttcttgatctccttcaccttgagc 636

to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                        
Query: 281  caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatgga 340
            |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||||
Sbjct: 1750 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1691

                                                   
Query: 341  gaacatggccagccgtccgttcttgatctccttcacctt 379
            ||||   ||||| || |||||||||||||||||||||||
Sbjct: 1690 gaacgatgccaggcggccgttcttgatctccttcacctt 1652

to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                        
Query: 282  aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
            ||||||||||  || ||||  |||||||||   ||||||| |||||| || | |||||||
Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678

                                                      
Query: 342  aacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||| || || || ||||||| ||||||||||||||||
Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636

to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 815 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 756

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 755 aacatggccaaccgcccgttcttgatctccttcacctt 718

to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||| || || ||||  |||||||||   ||||||| |||||| || | |||||||
Sbjct: 617 aggttctccaacgggccctttccggtgacgatagcctggacgaagaatccgaacatggag 558

                                                     
Query: 342 aacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| ||||  |||||||||| |||||| |||||||||
Sbjct: 557 aacatggcaagcctgccgttcttgagctccttaaccttgagc 516

to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| |||| ||||||||||   ||||| | |||||| || | |||||| 
Sbjct: 742 aggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaacatggaa 683

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 682 aacatggccaagcgcccgttcttgagctccttcacctt 645

to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgaacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgaacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           ||||| |||| ||| |||| |||||| |||   ||||| | ||||||||| | |||||||
Sbjct: 634 aggttttcgatggggcccttgccggtcacgattgcctgcacgaagaagccgaacatggag 575

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||| |||||||| |||||||| | ||||||||||||
Sbjct: 574 aacatcgccagccgcccgttctttagctccttcacctt 537

to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                        
Query: 282  aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
            |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 1893 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 1834

                                                  
Query: 342  aacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||||| ||| |||||||||||||||||||||||
Sbjct: 1833 aacatggccaaccgcccgttcttgatctccttcacctt 1796

to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 85/102 (83%)
 Strand = Plus / Minus

                                                                        
Query: 282  aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
            ||||||||||  || ||||  |||||||||   ||||||| |||||| || | |||||||
Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678

                                                      
Query: 342  aacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||| || || || ||||||| ||||||||||||||||
Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636

to top

>gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 252

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                      
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacc 377
           ||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 43  catggagaacatggccagccgaccgttcttaatctccttcacc 1

to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| || |  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 216 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 157

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||| ||| |||||||||||||||||||||||
Sbjct: 156 aacatggccaaccgcccgttcttgatctccttcacctt 119

to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 294 ggcccctcgccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagc 353
           ||||||| ||||||||||   |||||||  || || || | |||||| |||||||| || 
Sbjct: 755 ggccccttgccggtgacgatggcctggacaaaaaacccgaacatggataacatggcgagg 696

                                         
Query: 354 cgtccgttcttgatctccttcaccttgagc 383
           || |||||||||||||||||||||||||||
Sbjct: 695 cggccgttcttgatctccttcaccttgagc 666

to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 338 ggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 674 ggagaacatggcaaggcggccgttcttgatctccttcaccttgagc 629

to top

>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex
           II protein m9 mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 577

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 281 caggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagccca-gcatgg 339
           |||||||| || ||| |||| |||||| |||   ||||||| ||||||||| | ||||| 
Sbjct: 391 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaagcatg- 333

                                                   
Query: 340 agaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| ||| ||||||||||||||||| |||||
Sbjct: 332 agaacatggccaaccgcccgttcttgatctccttgacctt 293

to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 315  gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
            ||||||| |||||| || | |||||||||||| ||||| || ||||||||||||||||| 
Sbjct: 1235 gcctggacgaagaacccaaacatggagaacattgccaggcggccgttcttgatctcctta 1176

                 
Query: 375  acctt 379
            |||||
Sbjct: 1175 acctt 1171

to top

>gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding protein II 2 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1147

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 315 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
           ||||| ||| ||||||| |||||||||||||| || || || ||||||||||||||||| 
Sbjct: 936 gcctgaatgtagaagccgagcatggagaacatagcaagacggccgttcttgatctccttg 877

                
Query: 375 acctt 379
           |||||
Sbjct: 876 acctt 872

to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||||| || |||||||||||||||||||||||
Sbjct: 663 gagaacatggccaggcggccgttcttgatctccttcacctt 623

to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgyccgttcttgagctccttcacctt 648

to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 692 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 648

to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 738 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 694

to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 724 catggagaacatggccagccgaccgttcttaatctctttcacctt 680

to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 339 gagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           ||||||||||| || || |||||||||||||||||||||||||||
Sbjct: 689 gagaacatggcaaggcggccgttcttgatctccttcaccttgagc 645

to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 315 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
           ||||||| |||||| || | ||||||||||||||||| ||| |||||||| | |||||||
Sbjct: 732 gcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctccttc 673

                
Query: 375 acctt 379
           |||||
Sbjct: 672 acctt 668

to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||| |||||||||| ||| |||||||||||||||||||||||
Sbjct: 747 catggaaaacatggccaaccgcccgttcttgatctccttcacctt 703

to top

>gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 600

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||||||| ||||  | ||||||||||||||||||||||||||||
Sbjct: 474 catggagaacatagccaatcttccgttcttgatctccttcaccttgagc 426

to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 335  catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1620 catggagaacatagcgagacgcccgttcttgatctccttcaccttgagc 1572

to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 315 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
           ||||||| |||||| || | ||||||||||||||||| ||| |||||||| | |||||||
Sbjct: 290 gcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctccttc 231

                
Query: 375 acctt 379
           |||||
Sbjct: 230 acctt 226

to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 315 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
           ||||||| |||||| || | ||| |||||||||||||  || ||||||||||||||||||
Sbjct: 740 gcctggacgaagaacccgaacattgagaacatggccaatcggccgttcttgatctccttc 681

                
Query: 375 acctt 379
           |||||
Sbjct: 680 acctt 676

to top

>gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1100

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | ||||||||||||||| ||||  || |||||||||
Sbjct: 986 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 927

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 926 tccttcacctt 916

to top

>gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | ||||||||||||||| ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 269 gaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtangcctggatgaagaa 328
           ||||||| || |||||||||| || || |||| ||||||||||   || || | ||||||
Sbjct: 777 gaggtggtcgaacaggttctccaatgggcccttgccggtgacgatagcttgcacgaagaa 718

                                                              
Query: 329 gcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
            || | ||| ||||||||||| || || || ||||||||||||||||||||
Sbjct: 717 cccgaacatagagaacatggcaagacggccattcttgatctccttcacctt 667

to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 324 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| | ||||||||||||||| || || || |||||||||||||| |||||||||
Sbjct: 681 aagaagccaaacatggagaacatggcgaggcggccattcttgatctccttaaccttgagc 622

to top

>emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting chlorophyll a/b protein
          Length = 681

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 35/36 (97%)
 Strand = Plus / Minus

                                               
Query: 344 catggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| |||||||||||||||||||||||
Sbjct: 236 catggccagccggccgttcttgatctccttcacctt 201

to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 324 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| | ||||||||||||||| || || || |||||||||||||| |||||||||
Sbjct: 886 aagaagccaaacatggagaacatggcgaggcggccattcttgatctccttaaccttgagc 827

to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 325  agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 4919 agaagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 4861



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 325  agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 1476 agaagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 1418



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 344  catggccagccgtccgttcttgatctccttcacctt 379
            |||||||||||| |||||||||| ||||||||||||
Sbjct: 7000 catggccagccggccgttcttgacctccttcacctt 6965



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 344 catggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| |||||||||| ||||||||||||
Sbjct: 216 catggccagccggccgttcttgacctccttcacctt 181



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 329  gcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttg 380
            |||||||||||  | ||||||||| || |||||||| | |||||||||||||
Sbjct: 3759 gcccagcatggccagcatggccaggcggccgttcttcacctccttcaccttg 3708

to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  ||||||||    ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacaatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648

to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  ||||||||    ||||| | |||||| || | |||||| 
Sbjct: 734 aggttctcgatgggtcccttcccggtgacaatggcctgaacgaagaatccgaacatggaa 675

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||||||||||||||||
Sbjct: 674 aacatggccaagcgcccgttcttgatctccttcacctt 637

to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 282 aggttctcgaagggcccctcgccggtgacgtangcctggatgaagaagcccagcatggag 341
           |||||||||| ||| ||||  |||||||||   ||||| | |||||| || | |||||| 
Sbjct: 745 aggttctcgatgggtccctttccggtgacgattgcctgcacgaagaatccgaacatggaa 686

                                                 
Query: 342 aacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||  || |||||||||| ||||||||||||
Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648

to top

>gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding protein (LHCPII) gene exons
            1-5, 5' end
          Length = 3122

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 325  agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
            |||||||||||||||  | ||||||||| || |||||||| | ||||||||||||||||
Sbjct: 2928 agaagcccagcatggccaccatggccagacggccgttcttcacctccttcaccttgagc 2870

to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 303 ccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 362
           |||||||||   ||||| | |||||| || | ||| |||||||| |||| || |||||||
Sbjct: 749 ccggtgacgatagcctgaacgaagaatccaaacatagagaacatagccaaccttccgttc 690

                            
Query: 363 ttgatctccttcacctt 379
           |||||||||||||||||
Sbjct: 689 ttgatctccttcacctt 673

to top

>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017
          Length = 330

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 303 ccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 362
           |||||||||   ||||| | |||||| || | ||||||||||||||| || |  ||||||
Sbjct: 283 ccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctgccgttc 224

                                
Query: 363 ttgatctccttcaccttgagc 383
           ||||||||||| |||||||||
Sbjct: 223 ttgatctcctttaccttgagc 203

to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 303 ccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 362
           |||||||||   ||||||| |||||| || | ||| || |||||||||| ||| ||||||
Sbjct: 758 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 699

                            
Query: 363 ttgatctccttcacctt 379
           |||| ||||||||||||
Sbjct: 698 ttgagctccttcacctt 682

to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 303 ccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 362
           |||||||||   ||||||| |||||| || | ||| || |||||||||| ||| ||||||
Sbjct: 755 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 696

                            
Query: 363 ttgatctccttcacctt 379
           |||| ||||||||||||
Sbjct: 695 ttgagctccttcacctt 679

to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 239 ggtgagcaggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggccc 298
           |||||||| |||||||  || |||||||  ||||||| ||  |||||||| ||| || ||
Sbjct: 963 ggtgagcacgttgttgttgacggggtcggcgaggtggtcgagcaggttctggaacgggcc 904

                                                                       
Query: 299 ctcgccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtcc 358
             |||||||||||    ||||||||||| | || || |||| || |||||| ||||  ||
Sbjct: 903 gacgccggtgacgagcccctggatgaagtaaccgaggatggcgagcatggcgagcctgcc 844

                                    
Query: 359 gttcttgatctccttcaccttgagc 383
           ||||||||||||||| | |||||||
Sbjct: 843 gttcttgatctccttgagcttgagc 819

to top

>dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590a,
             complete sequence
          Length = 16141

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                       
Query: 335   catggagaacatggccagccgtccgttcttgatctccttcac 376
             ||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 11294 catggagaacatggccaaccttccattcttgatctccttcac 11335

to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 303  ccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 362
            |||||||||   ||||| | |||||| || | ||||||||||||||| || |  ||||||
Sbjct: 1146 ccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctgccgttc 1087

                                 
Query: 363  ttgatctccttcaccttgagc 383
            ||||||||||| |||||||||
Sbjct: 1086 ttgatctcctttaccttgagc 1066

to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||||||||  || |||||||||||||||||||||||
Sbjct: 2894 gagaacatggccaatcgcccgttcttgatctccttcacctt 2854

to top

>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev
          Length = 326

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||| ||||| || || || |||||||||||||||||||||||||||
Sbjct: 72  catggaaaacattgcaagacgaccgttcttgatctccttcaccttgagc 120

to top

>emb|Z16408.1|PSLHCB51 P.sylvestris Lhcb5*1 mRNA encoding Lhcb5 protein
          Length = 1193

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 323 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||| ||||| ||||||||||||| || ||| || || ||||||||||||||
Sbjct: 834 gaagaagccgagcattgagaacatggccaaccttccatttttaatctccttcacctt 778

to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||||||||||||||||
Sbjct: 245 gagaacatagccaaccttccgttcttgatctccttcacctt 205

to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||||| || ||||||||||||||||| |||||
Sbjct: 677 gagaacatggccaggcggccgttcttgatctccttgacctt 637

to top

>gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial
           cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6
           and partial cds
          Length = 1083

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 909 tccttcacctt 899

to top

>gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1037

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 923 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 864

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 863 tccttcacctt 853

to top

>gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1102

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 988 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 929

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 928 tccttcacctt 918

to top

>gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1083

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 909 tccttcacctt 899

to top

>gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1085

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 971 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 912

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 911 tccttcacctt 901

to top

>gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1101

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 987 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 928

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 927 tccttcacctt 917

to top

>gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and
           6 and partial cds
          Length = 1083

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 909 tccttcacctt 899

to top

>gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and
           6 and partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6
           and partial cds
          Length = 1103

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309 acgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 368
           ||||| ||||||||||| ||  | | |||||||||||| || ||||  || |||||||||
Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930

                      
Query: 369 tccttcacctt 379
           |||||||||||
Sbjct: 929 tccttcacctt 919

to top

>dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-harvesting
            chlorophyll-a/b protein of photosystem I, complete cds
          Length = 1886

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 344  catggccagccgtccgttcttgatctccttcaccttgagc 383
            ||||||||| || ||||||||||||||||| |||||||||
Sbjct: 1442 catggccaggcggccgttcttgatctccttaaccttgagc 1403

to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 324 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| | ||| |||||||||||||  |||||||||||||  |||||||||||
Sbjct: 927 aagaagccaaacatagagaacatggccaatcgtccgttcttgagttccttcacctt 872

to top

>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end
          Length = 351

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 324 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 383
           |||||||| | |||||||||||| || || |  |||||||||||||||||||| ||||||
Sbjct: 236 aagaagccaaacatggagaacatagcaagtctgccgttcttgatctccttcactttgagc 177

to top

>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1284

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 333 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 924 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 878

to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 303 ccggtgacgtangcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 362
           |||||||||   ||||||  |||||| || | ||| || |||||||||| ||| ||||||
Sbjct: 724 ccggtgacgatggcctggncgaagaatccgaacatagaaaacatggccaaccgcccgttc 665

                            
Query: 363 ttgatctccttcacctt 379
           |||| ||||||||||||
Sbjct: 664 ttgagctccttcacctt 648

to top

>gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting complex protein LHCG12
           mRNA, complete cds
          Length = 1170

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 333 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 922 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 876

to top

>gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting complex protein LHCG11
           mRNA, complete cds
          Length = 1128

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 333 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 879 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 833

to top

>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA,
           complete cds
          Length = 1191

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 333 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 919 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 873

to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 357 ccgttcttgatctccttcaccttgagc 383
           |||||||||||||||||||||||||||
Sbjct: 668 ccgttcttgatctccttcaccttgagc 642

to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 42/46 (91%), Gaps = 1/46 (2%)
 Strand = Plus / Minus

                                                         
Query: 335 catggagaacatggcca-gccgtccgttcttgatctccttcacctt 379
           ||||||||||| ||||| |||  |||||||||||||||||||||||
Sbjct: 732 catggagaacagggccaagcctgccgttcttgatctccttcacctt 687

to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 728 gagaacatggcaagacgaccgttcttgagctccttcacctt 688

to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 1412 gagaacatggcaagacgaccgttcttgagctccttcacctt 1452

to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 2615 gagaacatagccaaccttccgttcttgagctccttcacctt 2655

to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 2615 gagaacatagccaaccttccgttcttgagctccttcacctt 2655

to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 723 gagaacatagccaaccttccgttcttgagctccttcacctt 683

to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 681 gagaacatagccaaccttccgttcttgagctccttcacctt 641

to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||||||  || ||||||||||||||||||||
Sbjct: 544 gagaacatagccagcctgccattcttgatctccttcacctt 504

to top

>gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence
          Length = 452

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||||||| || || |||||||||| |||||| |||||
Sbjct: 270 catggagaacatggcaagacgaccgttcttgagctcctttacctt 226

to top

>gb|BT014450.1| Lycopersicon esculentum clone 133776F, mRNA sequence
          Length = 1196

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 233 gatgacggtgagcaggttgttgccgaaggggtc 265
           |||||||||||||| ||||||||| ||||||||
Sbjct: 907 gatgacggtgagcaagttgttgccaaaggggtc 875

to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 339  gagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||| |||| || ||||||||| ||||||||||||||
Sbjct: 2246 gagaacatagccaaccttccgttcttaatctccttcacctt 2206

to top

>gb|AF517869.1| Griffithsia japonica isolate Gj446 light-harvest protein mRNA,
           partial cds
          Length = 758

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 343 acatggccagccgtccgttcttgatctcc 371
           |||||||||| ||||||||||||||||||
Sbjct: 520 acatggccaggcgtccgttcttgatctcc 492

to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| ||||  | ||||||||||||||||||||||||
Sbjct: 746 gagaacatagccaatcttccgttcttgatctccttcacctt 706

to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 723 gagaacatagccaaccttccgttcttgagctccttcacctt 683

to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 671 gagaacatagccaaccttccgttcttgagctccttcacctt 631

to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 668 gagaacatggcaagacgaccgttcttgagctccttcacctt 628

to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 339   gagaacatggccagccgtccgttcttgatctccttcacctt 379
             ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 81135 gagaacatggcaagacgaccgttcttgagctccttcacctt 81175

to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 339   gagaacatggccagccgtccgttcttgatctccttcacctt 379
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 95975 gagaacatagccaaccttccgttcttgagctccttcacctt 95935



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 339   gagaacatggccagccgtccgttcttgatctccttcacctt 379
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 93333 gagaacatagccaaccttccgttcttgagctccttcacctt 93373

to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 339   gagaacatggccagccgtccgttcttgatctccttcacctt 379
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 80869 gagaacatagccaaccttccgttcttgagctccttcacctt 80829



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 339   gagaacatggccagccgtccgttcttgatctccttcacctt 379
             |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 78227 gagaacatagccaaccttccgttcttgagctccttcacctt 78267

to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 668 gagaacatagccaaccttccgttcttgagctccttcacctt 628

to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 668 gagaacatggcaagacgaccgttcttgagctccttcacctt 628

to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 728 gagaacatggcaagacgaccgttcttgagctccttcacctt 688

to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 726 gagaacatggcaagacgaccgttcttgagctccttcacctt 686

to top

>gb|AF398727.1|AF398727 Dubautia laxa ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and
           partial cds
          Length = 1103

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| || ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacattgctagcctgccattcttgatctccttcacctt 919

to top

>gb|AF398724.1|AF398724 Argyroxiphium sandwicense ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and
           6 and partial cds
          Length = 1103

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 335 catggagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||||||| || ||||  || ||||||||||||||||||||
Sbjct: 963 catggagaacattgctagcctgccattcttgatctccttcacctt 919

to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 719 gagaacatagccaaccttccgttcttgagctccttcacctt 679

to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 739 gagaacatagccaaccttccgttcttgagctccttcacctt 699

to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 391 gagaacatagccaaccttccgttcttgagctccttcacctt 351

to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 709 gagaacatggcaagacgaccgttcttgagctccttcacctt 669

to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 699 gagaacatggcaagacgaccgttcttgagctccttcacctt 659

to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 710 gagaacatagccaaccttccgttcttgagctccttcacctt 670

to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 717 gagaacatggcaagacgaccgttcttgagctccttcacctt 677

to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 711 gagaacatggcaagacgaccgttcttgagctccttcacctt 671

to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 700 gagaacatagccaaccttccgttcttgagctccttcacctt 660

to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 703 gagaacatagccaaccttccgttcttgagctccttcacctt 663

to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 716 gagaacatggcaagacgaccgttcttgagctccttcacctt 676

to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 703 gagaacatagccaaccttccgttcttgagctccttcacctt 663

to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 704 gagaacatggcaagacgaccgttcttgagctccttcacctt 664

to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 216 gagaacatagccaaccttccgttcttgagctccttcacctt 256

to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 335  catggagaacatggccagccgtccgttcttgatctccttcacctt 379
            |||||||||||| |||||||  |||||||| | ||||||||||||
Sbjct: 1268 catggagaacatagccagcctaccgttcttcaactccttcacctt 1224

to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           |||||||| |||| || ||||||||||| ||||||||||||
Sbjct: 733 gagaacatagccaaccttccgttcttgagctccttcacctt 693

to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 718 gagaacatggcaagacgaccgttcttgagctccttcacctt 678

to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 339 gagaacatggccagccgtccgttcttgatctccttcacctt 379
           ||||||||||| || || |||||||||| ||||||||||||
Sbjct: 726 gagaacatggcaagacgaccgttcttgagctccttcacctt 686

to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 315 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 374
           ||||||| |||||| || | || |||||||||||||| ||  ||||||||||  ||||| 
Sbjct: 744 gcctggacgaagaacccgaacacggagaacatggccaacctaccgttcttgagttccttg 685

                    
Query: 375 accttgagc 383
           |||||||||
Sbjct: 684 accttgagc 676


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,231,452
Number of Sequences: 3902068
Number of extensions: 3231452
Number of successful extensions: 63022
Number of sequences better than 10.0: 472
Number of HSP's better than 10.0 without gapping: 475
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61528
Number of HSP's gapped (non-prelim): 1485
length of query: 419
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 397
effective length of database: 17,147,199,772
effective search space: 6807438309484
effective search space used: 6807438309484
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result