| Clone Name | rbags8c02 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | dbj|AP005272.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... | 42 | 0.88 | 2 | gb|AC113493.9| Mus musculus chromosome 15, clone RP23-359H23, co... | 40 | 3.5 | 3 | gb|AC007372.4|AC007372 Homo sapiens chromosome 14 BAC containing... | 40 | 3.5 | 4 | emb|AL049837.4|CNS0000F Human chromosome 14 DNA sequence BAC R-9... | 40 | 3.5 |
|---|
>dbj|AP005272.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-172F10, complete sequence Length = 164943 Score = 42.1 bits (21), Expect = 0.88 Identities = 21/21 (100%) Strand = Plus / Plus Query: 75 ttcaaaactgaaacaccatgt 95 ||||||||||||||||||||| Sbjct: 84487 ttcaaaactgaaacaccatgt 84507
>gb|AC113493.9| Mus musculus chromosome 15, clone RP23-359H23, complete sequence Length = 207687 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tgctgttattacttgtaaag 34 |||||||||||||||||||| Sbjct: 125564 tgctgttattacttgtaaag 125583
>gb|AC007372.4|AC007372 Homo sapiens chromosome 14 BAC containing gene for type 2 iodothyronine deiodinase (DIO2) gene, complete CDS, complete sequence Length = 154796 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 tcatcattcaaaactgaaac 88 |||||||||||||||||||| Sbjct: 131475 tcatcattcaaaactgaaac 131494
>emb|AL049837.4|CNS0000F Human chromosome 14 DNA sequence BAC R-959A22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 168677 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 tcatcattcaaaactgaaac 88 |||||||||||||||||||| Sbjct: 43677 tcatcattcaaaactgaaac 43658 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,746,387 Number of Sequences: 3902068 Number of extensions: 1746387 Number of successful extensions: 29235 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 29230 Number of HSP's gapped (non-prelim): 5 length of query: 268 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 246 effective length of database: 17,147,199,772 effective search space: 4218211143912 effective search space used: 4218211143912 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)