>ref|XM_742885.1| Aspergillus fumigatus Af293 transcription initiation factor TFIID
           subunit beta (Afu5g03660) partial mRNA
          Length = 1551

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 59  gcagctgaagcggcggcgag 78
           ||||||||||||||||||||
Sbjct: 790 gcagctgaagcggcggcgag 809

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 68      gcggcggcgagactgttcg 86
               |||||||||||||||||||
Sbjct: 2896659 gcggcggcgagactgttcg 2896641

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 15      agcttcaccggctcgtaga 33
               |||||||||||||||||||
Sbjct: 2972107 agcttcaccggctcgtaga 2972125

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 69       cggcggcgagactgttcga 87
                |||||||||||||||||||
Sbjct: 14970774 cggcggcgagactgttcga 14970792

>dbj|AP005429.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0701F11
          Length = 154950

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 69    cggcggcgagactgttcga 87
             |||||||||||||||||||
Sbjct: 40220 cggcggcgagactgttcga 40238

>gb|AF029365.1|AF029365 Rhodobacter capsulatus B10 nuo gene cluster, NADH-CoQ reductase
            subunits NUOA (nuoA), NUOB (nuoB), NUOC (nuoC), NUOD
            (nuoD), NUOE (nuoE), NUOF (nuoF), NUOG (nuoG), NUOH
            (nuoH), NUOI (nuoI), NUOJ (nuoJ), NUOK (nuoK), NUOL
            (nuoL), NUOM (nuoM), and NUON (nuoN) genes, and BIRA
            (birA) gene, complete cds
          Length = 19614

 Score = 38.2 bits (19), Expect = 7.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 15   agcttcaccggctcgtaga 33
            |||||||||||||||||||
Sbjct: 1783 agcttcaccggctcgtaga 1765


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 447,980
Number of Sequences: 3902068
Number of extensions: 447980
Number of successful extensions: 24355
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24286
Number of HSP's gapped (non-prelim): 69
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)