ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags7k02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predic... 50 0.003
2gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence 50 0.003
3gb|BT016816.1| Zea mays clone Contig649 mRNA sequence 50 0.003
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 50 0.003
5gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.003
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.003
7dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.003
8dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.003
9dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.003
10dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.003
11dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.003
12emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-... 46 0.049
13emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-... 44 0.19
14emb|BX058217.1|CNS09H31 Single read from an extremity of a full-... 44 0.19
15emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-... 44 0.19
16emb|BX050629.1|CNS09B89 Single read from an extremity of a full-... 44 0.19
17emb|BX048891.1|CNS099VZ Single read from an extremity of a full-... 44 0.19
18emb|BX048575.1|CNS099N7 Single read from an extremity of a full-... 44 0.19
19emb|BX047759.1|CNS0990J Single read from an extremity of a full-... 44 0.19
20emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-... 44 0.19
21emb|BX039669.1|CNS092RT Single read from an extremity of a full-... 44 0.19
22emb|BX037240.1|CNS090WC Single read from an extremity of a full-... 44 0.19
23emb|BX036580.1|CNS090E0 Single read from an extremity of a full-... 44 0.19
24emb|BX036124.1|CNS0901C Single read from an extremity of a full-... 44 0.19
25emb|BX029509.1|CNS08UXL Single read from an extremity of a full-... 44 0.19
26emb|BX028945.1|CNS08UHX Single read from an extremity of a full-... 44 0.19
27emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-... 44 0.19
28emb|BX027649.1|CNS08THX Single read from an extremity of a full-... 44 0.19
29emb|BX027278.1|CNS08T7M Single read from an extremity of a full-... 44 0.19
30emb|BX026134.1|CNS08SBU Single read from an extremity of a full-... 44 0.19
31emb|BX020909.1|CNS08OAP Single read from an extremity of a full-... 44 0.19
32emb|BX019905.1|CNS08NIT Single read from an extremity of a full-... 44 0.19
33emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-... 44 0.19
34emb|BX016863.1|CNS08L6B Single read from an extremity of a full-... 44 0.19
35emb|BX010707.1|CNS08GFB Single read from an extremity of a full-... 44 0.19
36emb|BX010159.1|CNS08G03 Single read from an extremity of a full-... 44 0.19
37emb|BX010158.1|CNS08G02 Single read from an extremity of a full-... 44 0.19
38emb|BX009177.1|CNS08F8T Single read from an extremity of a full-... 44 0.19
39emb|BX007586.1|CNS08E0M Single read from an extremity of a full-... 44 0.19
40gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, comple... 42 0.77
41gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, co... 42 0.77
42emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G2... 42 0.77
43ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diph... 42 0.77
44gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 0.77
45ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA 42 0.77
46gb|AY007505.3| Streptococcus mitis phage SM1,complete genome 40 3.0
47emb|BX013132.1|CNS08IAO Single read from an extremity of a full-... 40 3.0
48gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome... 40 3.0
49gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome... 40 3.0
50dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 3.0 
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2151

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 57   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
to top
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence
          Length = 2441

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 69   tgctgtttgggccacctttgccgcgtagg 97
            ||||| |||||||||||||||||||||||
Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
to top
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence
          Length = 1830

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 69   tgctgtttgggccacctttgccgcgtagg 97
            ||||| |||||||||||||||||||||||
Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 57      cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 120     aggggcggctttctctgccg 139
               ||||||||||||||||||||
Sbjct: 8815955 aggggcggctttctctgccg 8815974
to top
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05,
             complete sequence
          Length = 101799

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 57    cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
             |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 57      cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 120     aggggcggctttctctgccg 139
               ||||||||||||||||||||
Sbjct: 8813790 aggggcggctttctctgccg 8813809
to top
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full
            insert sequence
          Length = 2166

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 57   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
to top
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full
            insert sequence
          Length = 2862

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 57   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
to top
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full
            insert sequence
          Length = 2762

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 57   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
to top
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full
           insert sequence
          Length = 1271

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 57  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
           |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
to top
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full
            insert sequence
          Length = 1771

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 57   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 109
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
to top
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 46.1 bits (23), Expect = 0.049
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 47  ccgcaggcttcttctcggccgctgctg 73
           |||| ||||||||||||||||||||||
Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
to top
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 701 ggcttcttctcggccgctgctg 722
to top
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 349 ggcttcttctcggccgctgctg 370
to top
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 366 ggcttcttctcggccgctgctg 387
to top
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 343 ggcttcttctcggccgctgctg 364
to top
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 352 ggcttcttctcggccgctgctg 373
to top
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 692 ggcttcttctcggccgctgctg 671
to top
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 333

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 154 ggcttcttctcggccgctgctg 175
to top
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 354 ggcttcttctcggccgctgctg 375
to top
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 199 ggcttcttctcggccgctgctg 220
to top
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 367 ggcttcttctcggccgctgctg 388
to top
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 356 ggcttcttctcggccgctgctg 377
to top
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 289 ggcttcttctcggccgctgctg 310
to top
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 281 ggcttcttctcggccgctgctg 302
to top
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 332 ggcttcttctcggccgctgctg 353
to top
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 370 ggcttcttctcggccgctgctg 391
to top
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 353 ggcttcttctcggccgctgctg 374
to top
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 304 ggcttcttctcggccgctgctg 325
to top
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 350 ggcttcttctcggccgctgctg 371
to top
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 369 ggcttcttctcggccgctgctg 390
to top
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 669 ggcttcttctcggccgctgctg 648
to top
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 52  ggcttcttctcggccgctgctg 73
           ||||||||||||||||||||||
Sbjct: 362 ggcttcttctcggccgctgctg 383
to top
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence
          Length = 2129

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 69   tgctgtttgggccacctttgc 89
            |||||||||||||||||||||
Sbjct: 1655 tgctgtttgggccacctttgc 1635
to top
>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 128    ctttctctgccggaaccttca 148
              |||||||||||||||||||||
Sbjct: 107700 ctttctctgccggaaccttca 107720
to top
>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33
             Contains the 5' end of the CHD5 gene for  chromodomain
             helicase DNA binding protein 5, the RPL22 gene for
             ribosomal protein L22, eight novel genes, the ICMT gene
             for isoprenylcysteine carboxyl methyltransferase, possible
             ortholog of rodent transcription factor HES-3, the 3' end
             of the gene for brain acyl-CoA hydrolase (BACH) and seven
             CpG islands, complete sequence
          Length = 166518

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 193   ttgatggcatcctgttgtttc 213
             |||||||||||||||||||||
Sbjct: 94318 ttgatggcatcctgttgtttc 94298
to top
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate
           farnesyltransferase (Squalene synthetase) (SQS) (SS)
           (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA
          Length = 752

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 104 ctggaggaccagcagcagggg 124
           |||||||||||||||||||||
Sbjct: 292 ctggaggaccagcagcagggg 312
to top
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 101    cggctggaggaccagcagcag 121
              |||||||||||||||||||||
Sbjct: 616609 cggctggaggaccagcagcag 616629
to top
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA
          Length = 2649

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 101 cggctggaggaccagcagcag 121
           |||||||||||||||||||||
Sbjct: 265 cggctggaggaccagcagcag 285
to top
>gb|AY007505.3| Streptococcus mitis phage SM1,complete genome
          Length = 34692

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   ggagacttcggcttcccatt 194
             ||||||||||||||||||||
Sbjct: 12036 ggagacttcggcttcccatt 12017
to top
>emb|BX013132.1|CNS08IAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 52  ggcttcttctcggccgctgc 71
           ||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgc 396
to top
>gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1364E02,
            complete sequence
          Length = 126027

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 120  aggggcggctttctctgccg 139
            ||||||||||||||||||||
Sbjct: 6843 aggggcggctttctctgccg 6862
to top
>gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1364E02,
             complete sequence
          Length = 112265

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   aggggcggctttctctgccg 139
             ||||||||||||||||||||
Sbjct: 59108 aggggcggctttctctgccg 59127
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 31      ggcttcttctcggtcaccgc 50
               ||||||||||||||||||||
Sbjct: 1176320 ggcttcttctcggtcaccgc 1176339


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,720,963
Number of Sequences: 3902068
Number of extensions: 1720963
Number of successful extensions: 31733
Number of sequences better than 10.0: 50
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31611
Number of HSP's gapped (non-prelim): 122
length of query: 237
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 215
effective length of database: 17,147,199,772
effective search space: 3686647950980
effective search space used: 3686647950980
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top