>emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha
          Length = 1609

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 31/36 (86%)
 Strand = Plus / Minus

                                                
Query: 2    acgcctntatgncttcttgntggctgccttggtcac 37
            |||||| |||  ||||||| |||| |||||||||||
Sbjct: 1406 acgcctctatttcttcttgatggcagccttggtcac 1371

>emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMWG0716.rev
          Length = 325

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 31/36 (86%)
 Strand = Plus / Plus

                                               
Query: 2   acgcctntatgncttcttgntggctgccttggtcac 37
           |||||| |||  ||||||| |||| |||||||||||
Sbjct: 159 acgcctctatttcttcttgatggcagccttggtcac 194

>ref|XM_425200.1| PREDICTED: Gallus gallus similar to px19 (LOC427628), mRNA
          Length = 561

 Score = 36.2 bits (18), Expect = 4.4
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 15  ttcttgntggctgccttggtc 35
           |||||| ||||||||||||||
Sbjct: 545 ttcttggtggctgccttggtc 525

>gb|AF435570.1|AF435570 Gallus gallus clone TSCL PDGF-BB S27, mRNA sequence
          Length = 258

 Score = 36.2 bits (18), Expect = 4.4
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 15  ttcttgntggctgccttggtc 35
           |||||| ||||||||||||||
Sbjct: 163 ttcttggtggctgccttggtc 183

>emb|BX934599.2| Gallus gallus finished cDNA, clone ChEST91o11
          Length = 677

 Score = 36.2 bits (18), Expect = 4.4
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 15  ttcttgntggctgccttggtc 35
           |||||| ||||||||||||||
Sbjct: 522 ttcttggtggctgccttggtc 502

>emb|CR352501.1| Gallus gallus finished cDNA, clone ChEST176o6
          Length = 890

 Score = 36.2 bits (18), Expect = 4.4
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 15  ttcttgntggctgccttggtc 35
           |||||| ||||||||||||||
Sbjct: 728 ttcttggtggctgccttggtc 708

>emb|BX935862.1| Gallus gallus finished cDNA, clone ChEST162f10
          Length = 728

 Score = 36.2 bits (18), Expect = 4.4
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 15  ttcttgntggctgccttggtc 35
           |||||| ||||||||||||||
Sbjct: 573 ttcttggtggctgccttggtc 553


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,515
Number of Sequences: 3902068
Number of extensions: 91515
Number of successful extensions: 17235
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17228
Number of HSP's gapped (non-prelim): 7
length of query: 40
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 20
effective length of database: 17,155,003,908
effective search space: 343100078160
effective search space used: 343100078160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)