| Clone Name | rbags7f18 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK099445.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021G10, full insert sequence Length = 1814 Score = 111 bits (56), Expect = 1e-21 Identities = 139/169 (82%) Strand = Plus / Minus Query: 72 gattctggtttcttgatctgcttctgcaactgcngcaagtcatgctcaagcacatcncta 131 ||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||| || Sbjct: 1523 gattctgtcttcttgatctgcttctgcagctgtggcaggtcatgctcaagcacatcgctg 1464 Query: 132 agtgcctttgatgcctntgngagctcctcgnnactgatcgaaatgggaggggctaatcgg 191 | ||||| ||||| | || |||||||| |||||| || | ||||| ||||||| | Sbjct: 1463 aacgccttcgatgcttctgcaagctcctcaggactgattgacagcggaggcgctaatctg 1404 Query: 192 attatggtgtcatgcgtgggctttgntagaatgcccctctcctttagct 240 |||||||||||||| |||||||||| |||| ||| |||||||| |||| Sbjct: 1403 attatggtgtcatgtgtgggctttgccagaacgcctctctccttcagct 1355
>gb|AC145383.3| Oryza sativa chromosome 3 BAC OSJNBa0038E17 genomic sequence, complete sequence Length = 141691 Score = 65.9 bits (33), Expect = 5e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 177 ggaggggctaatcggattatggtgtcatgcgtgggctttgntagaatgcccctctccttt 236 ||||| ||||||| ||||||||||||||| |||||||||| |||| ||| |||||||| Sbjct: 77895 ggaggcgctaatctgattatggtgtcatgtgtgggctttgccagaacgcctctctccttc 77954 Query: 237 agct 240 |||| Sbjct: 77955 agct 77958 Score = 65.9 bits (33), Expect = 5e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 72 gattctggtttcttgatctgcttctgcaactgcngcaagtcatgctcaagcacatc 127 ||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||| Sbjct: 74009 gattctgtcttcttgatctgcttctgcagctgtggcaggtcatgctcaagcacatc 74064
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 65.9 bits (33), Expect = 5e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 177 ggaggggctaatcggattatggtgtcatgcgtgggctttgntagaatgcccctctccttt 236 ||||| ||||||| ||||||||||||||| |||||||||| |||| ||| |||||||| Sbjct: 24702348 ggaggcgctaatctgattatggtgtcatgtgtgggctttgccagaacgcctctctccttc 24702407 Query: 237 agct 240 |||| Sbjct: 24702408 agct 24702411 Score = 65.9 bits (33), Expect = 5e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 72 gattctggtttcttgatctgcttctgcaactgcngcaagtcatgctcaagcacatc 127 ||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||| Sbjct: 24698462 gattctgtcttcttgatctgcttctgcagctgtggcaggtcatgctcaagcacatc 24698517
>emb|AL732379.5|CNS08C92 Oryza sativa chromosome 3, . BAC OSJNBa0025B02 of library OSJNBa from chromosome 3 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 136470 Score = 65.9 bits (33), Expect = 5e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 177 ggaggggctaatcggattatggtgtcatgcgtgggctttgntagaatgcccctctccttt 236 ||||| ||||||| ||||||||||||||| |||||||||| |||| ||| |||||||| Sbjct: 133635 ggaggcgctaatctgattatggtgtcatgtgtgggctttgccagaacgcctctctccttc 133694 Query: 237 agct 240 |||| Sbjct: 133695 agct 133698 Score = 65.9 bits (33), Expect = 5e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 72 gattctggtttcttgatctgcttctgcaactgcngcaagtcatgctcaagcacatc 127 ||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||| Sbjct: 129749 gattctgtcttcttgatctgcttctgcagctgtggcaggtcatgctcaagcacatc 129804
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 65.9 bits (33), Expect = 5e-08 Identities = 56/64 (87%) Strand = Plus / Plus Query: 177 ggaggggctaatcggattatggtgtcatgcgtgggctttgntagaatgcccctctccttt 236 ||||| ||||||| ||||||||||||||| |||||||||| |||| ||| |||||||| Sbjct: 24619178 ggaggcgctaatctgattatggtgtcatgtgtgggctttgccagaacgcctctctccttc 24619237 Query: 237 agct 240 |||| Sbjct: 24619238 agct 24619241 Score = 65.9 bits (33), Expect = 5e-08 Identities = 50/56 (89%) Strand = Plus / Plus Query: 72 gattctggtttcttgatctgcttctgcaactgcngcaagtcatgctcaagcacatc 127 ||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||| Sbjct: 24615292 gattctgtcttcttgatctgcttctgcagctgtggcaggtcatgctcaagcacatc 24615347
>gb|AY107876.1| Zea mays PCO089175 mRNA sequence Length = 1203 Score = 65.9 bits (33), Expect = 5e-08 Identities = 139/177 (78%), Gaps = 6/177 (3%) Strand = Plus / Minus Query: 65 tgcctccgattctggtttcttgatctgcttctgcaactgcngc------aagtcatgctc 118 |||||| |||||||| || || ||||||||||||| |||| || ||||||||||| Sbjct: 906 tgcctcagattctggcttttttatctgcttctgcagctgcagctgtggcaagtcatgctc 847 Query: 119 aagcacatcnctaagtgcctttgatgcctntgngagctcctcgnnactgatcgaaatggg 178 ||||| || ||||| ||||| ||||| | || |||||||| |||||| | | ||| Sbjct: 846 cagcacgtcactaagcgccttggatgcttctgcaagctcctcaggactgattgtgagggg 787 Query: 179 aggggctaatcggattatggtgtcatgcgtgggctttgntagaatgcccctctcctt 235 ||| || | ||||||||| |||||||| ||||| || | || |||||| |||||||| Sbjct: 786 aggagcaagtcggattatagtgtcatgtgtgggtttcgctaaaatgcctctctcctt 730
>gb|BT024061.1| Zea mays clone EL01N0441H04 mRNA sequence Length = 1350 Score = 58.0 bits (29), Expect = 1e-05 Identities = 138/177 (77%), Gaps = 6/177 (3%) Strand = Plus / Minus Query: 65 tgcctccgattctggtttcttgatctgcttctgcaactgc------ngcaagtcatgctc 118 |||||| |||||||| || || ||||||||||||| |||| |||||||||| || Sbjct: 1065 tgcctcagattctggcttttttatctgcttctgcagctgcagctgtggcaagtcatgttc 1006 Query: 119 aagcacatcnctaagtgcctttgatgcctntgngagctcctcgnnactgatcgaaatggg 178 ||||| || ||||| ||||| ||||| | || |||||||| |||||| | | ||| Sbjct: 1005 cagcacgtcactaagcgccttggatgcttctgcaagctcctcaggactgattgtgagggg 946 Query: 179 aggggctaatcggattatggtgtcatgcgtgggctttgntagaatgcccctctcctt 235 ||| || | ||||||||| |||||||| ||||| || | || |||||| |||||||| Sbjct: 945 aggagcaagtcggattatagtgtcatgtgtgggtttcgctaaaatgcctctctcctt 889
>emb|BX005108.8| Zebrafish DNA sequence from clone CH211-268B13 in linkage group 9, complete sequence Length = 171835 Score = 42.1 bits (21), Expect = 0.78 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 ctggtttcttgatctgcttct 96 ||||||||||||||||||||| Sbjct: 87483 ctggtttcttgatctgcttct 87463
>gb|AC010145.10| Homo sapiens BAC clone RP11-355H10 from 2, complete sequence Length = 198960 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 gaatgcccctctcctttagc 239 |||||||||||||||||||| Sbjct: 14930 gaatgcccctctcctttagc 14949 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,081,856 Number of Sequences: 3902068 Number of extensions: 1081856 Number of successful extensions: 14920 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 14886 Number of HSP's gapped (non-prelim): 34 length of query: 240 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 218 effective length of database: 17,147,199,772 effective search space: 3738089550296 effective search space used: 3738089550296 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)