ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags6p10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome... 42 2.4
2gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.4
3gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 42 2.4
4gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complet... 42 2.4
5gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complet... 42 2.4
6emb|BX284651.5| Mouse DNA sequence from clone RP23-308C21 on chr... 42 2.4
7emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clon... 42 2.4
8gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 2.4
9gb|AC160760.4| Mus musculus BAC clone RP23-449G13 from chromosom... 42 2.4
10dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
11dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
12gb|AC093702.4| Homo sapiens BAC clone RP11-1324I5 from 2, comple... 42 2.4
13gb|AC027296.21| Homo sapiens 3 BAC RP11-309L4 (Roswell Park Canc... 42 2.4
14emb|AJ300144.1|HVU300144 Hordeum vulgare srg6 gene for stress re... 42 2.4
15ref|XM_953380.1| Neurospora crassa OR74A hypothetical protein (N... 40 9.4
16ref|XM_329713.1| Neurospora crassa OR74A hypothetical protein (N... 40 9.4
17gb|AC125404.4| Mus musculus BAC clone RP23-10A1 from 12, complet... 40 9.4
18gb|AC091505.2| Sus scrofa clone RP44-331G21, complete sequence 40 9.4
19gb|AC104897.7| Mus musculus chromosome 12, clone RP23-300E12, co... 40 9.4
20gb|AE017245.1| Mycoplasma synoviae 53, complete genome 40 9.4
21gb|AC183798.2| Pan troglodytes BAC clone CH251-424F21 from chrom... 40 9.4
22dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 40 9.4
23gb|AC160929.2| Mus musculus BAC clone RP24-380G7 from chromosome... 40 9.4
24gb|AE005041.1| Halobacterium sp. NRC-1 section 72 of 170 of the ... 40 9.4
25emb|CR974580.6| Mouse DNA sequence from clone RP23-97P6 on chrom... 40 9.4
26emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 9.4
27gb|M59200.1|MVOSLA Methanococcus voltae S-layer structural prote... 40 9.4

>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence
          Length = 202649

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 111    gttatccatcaagttcagtta 131
              |||||||||||||||||||||
Sbjct: 195368 gttatccatcaagttcagtta 195348



to top

>gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0015F11,
              complete sequence
          Length = 177574

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 640    gagggatggtctaggcggcgacagctcgg 668
              ||||||||| |||||||||||||| ||||
Sbjct: 132219 gagggatggcctaggcggcgacagatcgg 132247



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 550   gcgtgtcgatggcggaggcga 570
             |||||||||||||||||||||
Sbjct: 39165 gcgtgtcgatggcggaggcga 39145



to top

>gb|AC125410.4| Mus musculus BAC clone RP23-146N3 from 3, complete sequence
          Length = 213701

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 20     tacttcatctgttcctaaata 40
              |||||||||||||||||||||
Sbjct: 172372 tacttcatctgttcctaaata 172352



to top

>gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complete sequence
          Length = 210519

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 20     tacttcatctgttcctaaata 40
              |||||||||||||||||||||
Sbjct: 204772 tacttcatctgttcctaaata 204792



to top

>emb|BX284651.5| Mouse DNA sequence from clone RP23-308C21 on chromosome X, complete
             sequence
          Length = 109915

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 82    aagtattaaggtatagataggagta 106
             ||||| |||||||||||||||||||
Sbjct: 67202 aagtagtaaggtatagataggagta 67226



to top

>emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02,
             complete sequence
          Length = 173171

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 610   ttgccggcgccggagaaaaag 630
             |||||||||||||||||||||
Sbjct: 53746 ttgccggcgccggagaaaaag 53766



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 200     ggccatgcaggccatgcaggg 220
               |||||||||||||||||||||
Sbjct: 4938328 ggccatgcaggccatgcaggg 4938308



to top

>gb|AC160760.4| Mus musculus BAC clone RP23-449G13 from chromosome 17, complete
             sequence
          Length = 174449

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 111   gttatccatcaagttcagtta 131
             |||||||||||||||||||||
Sbjct: 23794 gttatccatcaagttcagtta 23774



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 610      ttgccggcgccggagaaaaag 630
                |||||||||||||||||||||
Sbjct: 24933161 ttgccggcgccggagaaaaag 24933181



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 640      gagggatggtctaggcggcgacagctcgg 668
                ||||||||| |||||||||||||| ||||
Sbjct: 16046468 gagggatggcctaggcggcgacagatcgg 16046496



to top

>gb|AC093702.4| Homo sapiens BAC clone RP11-1324I5 from 2, complete sequence
          Length = 52568

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 111   gttatccatcaagttcagtta 131
             |||||||||||||||||||||
Sbjct: 43878 gttatccatcaagttcagtta 43858



to top

>gb|AC027296.21| Homo sapiens 3 BAC RP11-309L4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 127230

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 367   catgccatgtgtggtgtatag 387
             |||||||||||||||||||||
Sbjct: 76104 catgccatgtgtggtgtatag 76124



to top

>emb|AJ300144.1|HVU300144 Hordeum vulgare srg6 gene for stress responsive gene protein 6, exons
            1-11, cultivar Morex
          Length = 4197

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 27   tctgttcctaaatacttcttgttgg 51
            ||||||||||||||||| |||||||
Sbjct: 1488 tctgttcctaaatacttgttgttgg 1512



to top

>ref|XM_953380.1| Neurospora crassa OR74A hypothetical protein (NCU09966.1) partial
           mRNA
          Length = 1329

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 603 ggttgggttgccggcgccgg 622
           ||||||||||||||||||||
Sbjct: 632 ggttgggttgccggcgccgg 613



to top

>ref|XM_329713.1| Neurospora crassa OR74A hypothetical protein (NCU09966.1) partial
           mRNA
          Length = 1329

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 603 ggttgggttgccggcgccgg 622
           ||||||||||||||||||||
Sbjct: 632 ggttgggttgccggcgccgg 613



to top

>gb|AC125404.4| Mus musculus BAC clone RP23-10A1 from 12, complete sequence
          Length = 209092

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 200  ggccatgcaggccatgcagg 219
            ||||||||||||||||||||
Sbjct: 6508 ggccatgcaggccatgcagg 6527



to top

>gb|AC091505.2| Sus scrofa clone RP44-331G21, complete sequence
          Length = 188095

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 557   gatggcggaggcgaggcaga 576
             ||||||||||||||||||||
Sbjct: 36787 gatggcggaggcgaggcaga 36768



to top

>gb|AC104897.7| Mus musculus chromosome 12, clone RP23-300E12, complete sequence
          Length = 194600

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    tcttctcaataacaagtatt 88
             ||||||||||||||||||||
Sbjct: 72692 tcttctcaataacaagtatt 72673



to top

>gb|AE017245.1| Mycoplasma synoviae 53, complete genome
          Length = 799476

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    cttcttgttggagtaaaatt 60
             ||||||||||||||||||||
Sbjct: 30499 cttcttgttggagtaaaatt 30480



to top

>gb|AC183798.2| Pan troglodytes BAC clone CH251-424F21 from chromosome 7, complete
             sequence
          Length = 153775

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   ggccatgcaggccatgcagg 219
             ||||||||||||||||||||
Sbjct: 21445 ggccatgcaggccatgcagg 21464



to top

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 661    cagctcggtgaaggaggtga 680
              ||||||||||||||||||||
Sbjct: 189743 cagctcggtgaaggaggtga 189724



to top

>gb|AC160929.2| Mus musculus BAC clone RP24-380G7 from chromosome 12, complete sequence
          Length = 163333

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   ggccatgcaggccatgcagg 219
             ||||||||||||||||||||
Sbjct: 90479 ggccatgcaggccatgcagg 90498



to top

>gb|AE005041.1| Halobacterium sp. NRC-1 section 72 of 170 of the complete genome
          Length = 13759

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 314  cgctcgccgtcacgctcgta 333
            ||||||||||||||||||||
Sbjct: 4297 cgctcgccgtcacgctcgta 4278



to top

>emb|CR974580.6| Mouse DNA sequence from clone RP23-97P6 on chromosome 12, complete
              sequence
          Length = 197896

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     tcttctcaataacaagtatt 88
              ||||||||||||||||||||
Sbjct: 146217 tcttctcaataacaagtatt 146236



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia
              lipolytica
          Length = 4224103

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 489    aaatgtcgacttcagtcgatttta 512
              |||||||||||||||| |||||||
Sbjct: 377798 aaatgtcgacttcagttgatttta 377821



to top

>gb|M59200.1|MVOSLA Methanococcus voltae S-layer structural protein (sla) gene, complete
            cds
          Length = 2102

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 55   aaaattaaactagttcttctcaat 78
            ||||||||||| ||||||||||||
Sbjct: 1342 aaaattaaacttgttcttctcaat 1365


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,765,261
Number of Sequences: 3902068
Number of extensions: 4765261
Number of successful extensions: 80289
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80052
Number of HSP's gapped (non-prelim): 237
length of query: 685
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 662
effective length of database: 17,143,297,704
effective search space: 11348863080048
effective search space used: 11348863080048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top