Clone Name	rbags6p08
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_470037.1| Oryza sativa (japonica cultivar-group), mRNA	170	1e-39
2	dbj|AK064984.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	1e-39
3	gb|AY104047.1| Zea mays PCO131880 mRNA sequence	141	1e-30
4	ref|XM_477083.1| Oryza sativa (japonica cultivar-group), mRNA	125	7e-26
5	dbj|AK063732.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	7e-26
6	gb|BT016220.1| Zea mays clone Contig53 mRNA sequence	105	6e-20
7	gb|AY104097.1| Zea mays PCO131882 mRNA sequence	105	6e-20
8	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	94	2e-16
9	gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genom...	94	2e-16
10	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	94	2e-16
11	ref|NM_129748.2| Arabidopsis thaliana structural constituent of ...	84	2e-13
12	gb|AY133561.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, comp...	84	2e-13
13	gb|AY048250.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, comp...	84	2e-13
14	gb|AY085726.1| Arabidopsis thaliana clone 17415 mRNA, complete s...	84	2e-13
15	dbj|AP006685.1| Lotus japonicus genomic DNA, chromosome 1, clone...	82	9e-13
16	gb|AY486481.1| Capsicum annuum 40S ribosomal protein S2 mRNA, pa...	78	1e-11
17	ref|NM_148602.2| Arabidopsis thaliana structural constituent of ...	74	2e-10
18	ref|NM_104632.3| Arabidopsis thaliana structural constituent of ...	74	2e-10
19	ref|NM_104640.3| Arabidopsis thaliana structural constituent of ...	74	2e-10
20	gb|AY133659.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, comp...	74	2e-10
21	gb|AY065030.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, comp...	74	2e-10
22	dbj|AK220575.1| Arabidopsis thaliana mRNA for ribosomal protein ...	74	2e-10
23	emb|BX814292.1|CNS0ABYL Arabidopsis thaliana Full-length cDNA Co...	74	2e-10
24	emb|BX815169.1|CNS0ABBY Arabidopsis thaliana Full-length cDNA Co...	74	2e-10
25	emb|BX817373.1|CNS0AAYC Arabidopsis thaliana Full-length cDNA Co...	74	2e-10
26	dbj|AB008017.1| Arabidopsis thaliana RF12 mRNA, partial cds	74	2e-10
27	gb|AC140104.22| Medicago truncatula clone mth2-10g22, complete s...	70	4e-09
28	gb|AC142395.41| Medicago truncatula clone mth2-18g1, complete se...	70	4e-09
29	gb|AC027036.12|AC027036 Arabidopsis thaliana chromosome 1 BAC T4...	70	4e-09
30	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	70	4e-09
31	dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic D...	70	4e-09
32	dbj|AB078516.1| Arabidopsis thaliana genomic DNA, chromosome 1, ...	70	4e-09
33	dbj|AB076984.1| Arabidopsis thaliana DNA, chromosome 1, clone:P1...	70	4e-09
34	ref|NM_115609.2| Arabidopsis thaliana structural constituent of ...	66	6e-08
35	gb|AY120723.1| Arabidopsis thaliana ribosomal protein S2, putati...	66	6e-08
36	gb|BT006200.1| Arabidopsis thaliana At3g57490 mRNA, complete cds	66	6e-08
37	gb|AY084252.1| Arabidopsis thaliana clone 101250 mRNA, complete ...	66	6e-08
38	gb|AC002339.3| Arabidopsis thaliana chromosome 2 clone T11A7 map...	64	2e-07
39	dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone...	62	9e-07
40	ref|NM_104618.2| Arabidopsis thaliana XW6; structural constituen...	58	1e-05
41	gb|AY072528.1| Arabidopsis thaliana ribosomal protein S2, putati...	58	1e-05
42	gb|AF386958.1|AF386958 Arabidopsis thaliana ribosomal protein S2...	58	1e-05
43	emb|BX816200.1|CNS0ABME Arabidopsis thaliana Full-length cDNA Co...	58	1e-05
44	gb|AY088743.1| Arabidopsis thaliana clone 93867 mRNA, complete s...	58	1e-05
45	dbj|AB008016.1| Arabidopsis thaliana XW6 mRNA, complete cds	58	1e-05
46	emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BA...	56	5e-05
47	emb|AJ132531.1|PAB132531 Picea abies mRNA for 40S ribosomal prot...	54	2e-04
48	gb|AC082643.6|AC082643 Arabidopsis thaliana chromosome 1 BAC F9K...	54	2e-04
49	gb|AC008051.3|F19C14 Sequence of BAC F19C14 from Arabidopsis tha...	54	2e-04
50	dbj|AB077822.1| Arabidopsis thaliana genomic DNA, chromosome 1, ...	54	2e-04
51	dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic D...	50	0.003
52	dbj|AP004349.3| Oryza sativa (japonica cultivar-group) genomic D...	50	0.003
53	emb|BX053311.1|CNS09DAR Single read from an extremity of a full-...	42	0.81
54	emb|BX053310.1|CNS09DAQ Single read from an extremity of a full-...	42	0.81
55	emb|BX018548.1|CNS08MH4 Single read from an extremity of a full-...	42	0.81
56	emb|BX071943.1|CNS09ROB Single read from an extremity of a full-...	42	0.81
57	emb|BX071942.1|CNS09ROA Single read from an extremity of a full-...	42	0.81
58	emb|BX071917.1|CNS09RNL Single read from an extremity of a full-...	42	0.81
59	emb|BX071916.1|CNS09RNK Single read from an extremity of a full-...	42	0.81
60	emb|BX071881.1|CNS09RML Single read from an extremity of a full-...	42	0.81
61	emb|BX071859.1|CNS09RLZ Single read from an extremity of a full-...	42	0.81
62	emb|BX071858.1|CNS09RLY Single read from an extremity of a full-...	42	0.81
63	emb|BX071840.1|CNS09RLG Single read from an extremity of a full-...	42	0.81
64	emb|BX071839.1|CNS09RLF Single read from an extremity of a full-...	42	0.81
65	emb|BX071831.1|CNS09RL7 Single read from an extremity of a full-...	42	0.81
66	emb|BX071830.1|CNS09RL6 Single read from an extremity of a full-...	42	0.81
67	emb|BX071825.1|CNS09RL1 Single read from an extremity of a full-...	42	0.81
68	emb|BX071824.1|CNS09RL0 Single read from an extremity of a full-...	42	0.81
69	emb|BX071803.1|CNS09RKF Single read from an extremity of a full-...	42	0.81
70	emb|BX071637.1|CNS09RFT Single read from an extremity of a full-...	42	0.81
71	emb|BX071158.1|CNS09R2I Single read from an extremity of a full-...	42	0.81
72	emb|BX071130.1|CNS09R1Q Single read from an extremity of a full-...	42	0.81
73	emb|BX071129.1|CNS09R1P Single read from an extremity of a full-...	42	0.81
74	emb|BX071127.1|CNS09R1N Single read from an extremity of a full-...	42	0.81
75	emb|BX071126.1|CNS09R1M Single read from an extremity of a full-...	42	0.81
76	emb|BX071354.1|CNS09R7Y Single read from an extremity of a full-...	42	0.81
77	emb|BX071353.1|CNS09R7X Single read from an extremity of a full-...	42	0.81
78	emb|BX070994.1|CNS09QXY Single read from an extremity of a full-...	42	0.81
79	emb|BX070993.1|CNS09QXX Single read from an extremity of a full-...	42	0.81
80	emb|BX070950.1|CNS09QWQ Single read from an extremity of a full-...	42	0.81
81	emb|BX070846.1|CNS09QTU Single read from an extremity of a full-...	42	0.81
82	emb|BX070845.1|CNS09QTT Single read from an extremity of a full-...	42	0.81
83	emb|BX070740.1|CNS09QQW Single read from an extremity of a full-...	42	0.81
84	emb|BX070706.1|CNS09QPY Single read from an extremity of a full-...	42	0.81
85	emb|BX070705.1|CNS09QPX Single read from an extremity of a full-...	42	0.81
86	emb|BX070571.1|CNS09QM7 Single read from an extremity of a full-...	42	0.81
87	emb|BX070283.1|CNS09QE7 Single read from an extremity of a full-...	42	0.81
88	emb|BX070282.1|CNS09QE6 Single read from an extremity of a full-...	42	0.81
89	emb|BX070250.1|CNS09QDA Single read from an extremity of a full-...	42	0.81
90	emb|BX070249.1|CNS09QD9 Single read from an extremity of a full-...	42	0.81
91	emb|BX070108.1|CNS09Q9C Single read from an extremity of a full-...	42	0.81
92	emb|BX069976.1|CNS09Q5O Single read from an extremity of a full-...	42	0.81
93	emb|BX069935.1|CNS09Q4J Single read from an extremity of a full-...	42	0.81
94	emb|BX069934.1|CNS09Q4I Single read from an extremity of a full-...	42	0.81
95	emb|BX069931.1|CNS09Q4F Single read from an extremity of a full-...	42	0.81
96	emb|BX069930.1|CNS09Q4E Single read from an extremity of a full-...	42	0.81
97	emb|BX069899.1|CNS09Q3J Single read from an extremity of a full-...	42	0.81
98	emb|BX069898.1|CNS09Q3I Single read from an extremity of a full-...	42	0.81
99	emb|BX069635.1|CNS09PW7 Single read from an extremity of a full-...	42	0.81
100	emb|BX061069.1|CNS09JA9 Single read from an extremity of a full-...	42	0.81
101	emb|BX061068.1|CNS09JA8 Single read from an extremity of a full-...	42	0.81
102	emb|BX061021.1|CNS09J8X Single read from an extremity of a full-...	42	0.81
103	emb|BX061020.1|CNS09J8W Single read from an extremity of a full-...	42	0.81
104	emb|BX061001.1|CNS09J8D Single read from an extremity of a full-...	42	0.81
105	emb|BX061000.1|CNS09J8C Single read from an extremity of a full-...	42	0.81
106	emb|BX069525.1|CNS09PT5 Single read from an extremity of a full-...	42	0.81
107	emb|BX069438.1|CNS09PQQ Single read from an extremity of a full-...	42	0.81
108	emb|BX069321.1|CNS09PNH Single read from an extremity of a full-...	42	0.81
109	emb|BX069320.1|CNS09PNG Single read from an extremity of a full-...	42	0.81
110	emb|BX069159.1|CNS09PIZ Single read from an extremity of a full-...	42	0.81
111	emb|BX069158.1|CNS09PIY Single read from an extremity of a full-...	42	0.81
112	emb|BX069055.1|CNS09PG3 Single read from an extremity of a full-...	42	0.81
113	emb|BX069054.1|CNS09PG2 Single read from an extremity of a full-...	42	0.81
114	emb|BX068864.1|CNS09PAS Single read from an extremity of a full-...	42	0.81
115	emb|BX068863.1|CNS09PAR Single read from an extremity of a full-...	42	0.81
116	emb|BX068807.1|CNS09P97 Single read from an extremity of a full-...	42	0.81
117	emb|BX068766.1|CNS09P82 Single read from an extremity of a full-...	42	0.81
118	emb|BX068578.1|CNS09P2U Single read from an extremity of a full-...	42	0.81
119	emb|BX068577.1|CNS09P2T Single read from an extremity of a full-...	42	0.81
120	emb|BX068555.1|CNS09P27 Single read from an extremity of a full-...	42	0.81
121	emb|BX068552.1|CNS09P24 Single read from an extremity of a full-...	42	0.81
122	emb|BX068466.1|CNS09OZQ Single read from an extremity of a full-...	42	0.81
123	emb|BX068465.1|CNS09OZP Single read from an extremity of a full-...	42	0.81
124	emb|BX068411.1|CNS09OY7 Single read from an extremity of a full-...	42	0.81
125	emb|BX068251.1|CNS09OTR Single read from an extremity of a full-...	42	0.81
126	emb|BX068250.1|CNS09OTQ Single read from an extremity of a full-...	42	0.81
127	emb|BX068238.1|CNS09OTE Single read from an extremity of a full-...	42	0.81
128	emb|BX068237.1|CNS09OTD Single read from an extremity of a full-...	42	0.81
129	emb|BX068218.1|CNS09OSU Single read from an extremity of a full-...	42	0.81
130	emb|BX068122.1|CNS09OQ6 Single read from an extremity of a full-...	42	0.81
131	emb|BX068121.1|CNS09OQ5 Single read from an extremity of a full-...	42	0.81
132	emb|BX068087.1|CNS09OP7 Single read from an extremity of a full-...	42	0.81
133	emb|BX068086.1|CNS09OP6 Single read from an extremity of a full-...	42	0.81
134	emb|BX067992.1|CNS09OMK Single read from an extremity of a full-...	42	0.81
135	emb|BX067991.1|CNS09OMJ Single read from an extremity of a full-...	42	0.81
136	emb|BX067780.1|CNS09OGO Single read from an extremity of a full-...	42	0.81
137	emb|BX067716.1|CNS09OEW Single read from an extremity of a full-...	42	0.81
138	emb|BX067715.1|CNS09OEV Single read from an extremity of a full-...	42	0.81
139	emb|BX067694.1|CNS09OEA Single read from an extremity of a full-...	42	0.81
140	emb|BX067693.1|CNS09OE9 Single read from an extremity of a full-...	42	0.81
141	emb|BX067671.1|CNS09ODN Single read from an extremity of a full-...	42	0.81
142	emb|BX067652.1|CNS09OD4 Single read from an extremity of a full-...	42	0.81
143	emb|BX067651.1|CNS09OD3 Single read from an extremity of a full-...	42	0.81
144	emb|BX067510.1|CNS09O96 Single read from an extremity of a full-...	42	0.81
145	emb|BX067509.1|CNS09O95 Single read from an extremity of a full-...	42	0.81
146	emb|BX067320.1|CNS09O3W Single read from an extremity of a full-...	42	0.81
147	emb|BX067319.1|CNS09O3V Single read from an extremity of a full-...	42	0.81
148	emb|BX067058.1|CNS09NWM Single read from an extremity of a full-...	42	0.81
149	emb|BX067057.1|CNS09NWL Single read from an extremity of a full-...	42	0.81
150	emb|BX067005.1|CNS09NV5 Single read from an extremity of a full-...	42	0.81
151	emb|BX067004.1|CNS09NV4 Single read from an extremity of a full-...	42	0.81
152	emb|BX066997.1|CNS09NUX Single read from an extremity of a full-...	42	0.81
153	emb|BX066996.1|CNS09NUW Single read from an extremity of a full-...	42	0.81
154	emb|BX066975.1|CNS09NUB Single read from an extremity of a full-...	42	0.81
155	emb|BX066965.1|CNS09NU1 Single read from an extremity of a full-...	42	0.81
156	emb|BX066964.1|CNS09NU0 Single read from an extremity of a full-...	42	0.81
157	emb|BX066801.1|CNS09NPH Single read from an extremity of a full-...	42	0.81
158	emb|BX066800.1|CNS09NPG Single read from an extremity of a full-...	42	0.81
159	emb|BX066799.1|CNS09NPF Single read from an extremity of a full-...	42	0.81
160	emb|BX066798.1|CNS09NPE Single read from an extremity of a full-...	42	0.81
161	emb|BX066700.1|CNS09NMO Single read from an extremity of a full-...	42	0.81
162	emb|BX066616.1|CNS09NKC Single read from an extremity of a full-...	42	0.81
163	emb|BX066615.1|CNS09NKB Single read from an extremity of a full-...	42	0.81
164	emb|BX066524.1|CNS09NHS Single read from an extremity of a full-...	42	0.81
165	emb|BX066523.1|CNS09NHR Single read from an extremity of a full-...	42	0.81
166	emb|BX066334.1|CNS09NCI Single read from an extremity of a full-...	42	0.81
167	emb|BX066328.1|CNS09NCC Single read from an extremity of a full-...	42	0.81
168	emb|BX066327.1|CNS09NCB Single read from an extremity of a full-...	42	0.81
169	emb|BX066316.1|CNS09NC0 Single read from an extremity of a full-...	42	0.81
170	emb|BX066315.1|CNS09NBZ Single read from an extremity of a full-...	42	0.81
171	emb|BX066258.1|CNS09NAE Single read from an extremity of a full-...	42	0.81
172	emb|BX066159.1|CNS09N7N Single read from an extremity of a full-...	42	0.81
173	emb|BX066158.1|CNS09N7M Single read from an extremity of a full-...	42	0.81
174	emb|BX065928.1|CNS09N18 Single read from an extremity of a full-...	42	0.81
175	emb|BX065829.1|CNS09MYH Single read from an extremity of a full-...	42	0.81
176	emb|BX065425.1|CNS09MN9 Single read from an extremity of a full-...	42	0.81
177	emb|BX065378.1|CNS09MLY Single read from an extremity of a full-...	42	0.81
178	emb|BX065377.1|CNS09MLX Single read from an extremity of a full-...	42	0.81
179	emb|BX065216.1|CNS09MHG Single read from an extremity of a full-...	42	0.81
180	emb|BX065215.1|CNS09MHF Single read from an extremity of a full-...	42	0.81
181	emb|BX065114.1|CNS09MEM Single read from an extremity of a full-...	42	0.81
182	emb|BX065102.1|CNS09MEA Single read from an extremity of a full-...	42	0.81
183	emb|BX065101.1|CNS09ME9 Single read from an extremity of a full-...	42	0.81
184	emb|BX065094.1|CNS09ME2 Single read from an extremity of a full-...	42	0.81
185	emb|BX065093.1|CNS09ME1 Single read from an extremity of a full-...	42	0.81
186	emb|BX064907.1|CNS09M8V Single read from an extremity of a full-...	42	0.81
187	emb|BX064904.1|CNS09M8S Single read from an extremity of a full-...	42	0.81
188	emb|BX064850.1|CNS09M7A Single read from an extremity of a full-...	42	0.81
189	emb|BX064849.1|CNS09M79 Single read from an extremity of a full-...	42	0.81
190	emb|BX064749.1|CNS09M4H Single read from an extremity of a full-...	42	0.81
191	emb|BX064686.1|CNS09M2Q Single read from an extremity of a full-...	42	0.81
192	emb|BX064669.1|CNS09M29 Single read from an extremity of a full-...	42	0.81
193	emb|BX064424.1|CNS09LVG Single read from an extremity of a full-...	42	0.81
194	emb|BX064400.1|CNS09LUS Single read from an extremity of a full-...	42	0.81
195	emb|BX064371.1|CNS09LTZ Single read from an extremity of a full-...	42	0.81
196	emb|BX064370.1|CNS09LTY Single read from an extremity of a full-...	42	0.81
197	emb|BX064322.1|CNS09LSM Single read from an extremity of a full-...	42	0.81
198	emb|BX064321.1|CNS09LSL Single read from an extremity of a full-...	42	0.81
199	emb|BX064305.1|CNS09LS5 Single read from an extremity of a full-...	42	0.81
200	emb|BX064304.1|CNS09LS4 Single read from an extremity of a full-...	42	0.81
201	emb|BX064281.1|CNS09LRH Single read from an extremity of a full-...	42	0.81
202	emb|BX064280.1|CNS09LRG Single read from an extremity of a full-...	42	0.81
203	emb|BX064099.1|CNS09LMF Single read from an extremity of a full-...	42	0.81
204	emb|BX064073.1|CNS09LLP Single read from an extremity of a full-...	42	0.81
205	emb|BX063980.1|CNS09LJ4 Single read from an extremity of a full-...	42	0.81
206	emb|BX063911.1|CNS09LH7 Single read from an extremity of a full-...	42	0.81
207	emb|BX063910.1|CNS09LH6 Single read from an extremity of a full-...	42	0.81
208	emb|BX063899.1|CNS09LGV Single read from an extremity of a full-...	42	0.81
209	emb|BX063898.1|CNS09LGU Single read from an extremity of a full-...	42	0.81
210	emb|BX063789.1|CNS09LDT Single read from an extremity of a full-...	42	0.81
211	emb|BX063788.1|CNS09LDS Single read from an extremity of a full-...	42	0.81
212	emb|BX063668.1|CNS09LAG Single read from an extremity of a full-...	42	0.81
213	emb|BX063445.1|CNS09L49 Single read from an extremity of a full-...	42	0.81
214	emb|BX063444.1|CNS09L48 Single read from an extremity of a full-...	42	0.81
215	emb|BX063405.1|CNS09L35 Single read from an extremity of a full-...	42	0.81
216	emb|BX063404.1|CNS09L34 Single read from an extremity of a full-...	42	0.81
217	emb|BX063337.1|CNS09L19 Single read from an extremity of a full-...	42	0.81
218	emb|BX063336.1|CNS09L18 Single read from an extremity of a full-...	42	0.81
219	emb|BX063242.1|CNS09KYM Single read from an extremity of a full-...	42	0.81
220	emb|BX063241.1|CNS09KYL Single read from an extremity of a full-...	42	0.81
221	emb|BX063113.1|CNS09KV1 Single read from an extremity of a full-...	42	0.81
222	emb|BX063086.1|CNS09KUA Single read from an extremity of a full-...	42	0.81
223	emb|BX063085.1|CNS09KU9 Single read from an extremity of a full-...	42	0.81
224	emb|BX063054.1|CNS09KTE Single read from an extremity of a full-...	42	0.81
225	emb|BX063034.1|CNS09KSU Single read from an extremity of a full-...	42	0.81
226	emb|BX062964.1|CNS09KQW Single read from an extremity of a full-...	42	0.81
227	emb|BX062963.1|CNS09KQV Single read from an extremity of a full-...	42	0.81
228	emb|BX062808.1|CNS09KMK Single read from an extremity of a full-...	42	0.81
229	emb|BX062697.1|CNS09KJH Single read from an extremity of a full-...	42	0.81
230	emb|BX062603.1|CNS09KGV Single read from an extremity of a full-...	42	0.81
231	emb|BX062602.1|CNS09KGU Single read from an extremity of a full-...	42	0.81
232	emb|BX062565.1|CNS09KFT Single read from an extremity of a full-...	42	0.81
233	emb|BX062564.1|CNS09KFS Single read from an extremity of a full-...	42	0.81
234	emb|BX062379.1|CNS09KAN Single read from an extremity of a full-...	42	0.81
235	emb|BX062378.1|CNS09KAM Single read from an extremity of a full-...	42	0.81
236	emb|BX062182.1|CNS09K56 Single read from an extremity of a full-...	42	0.81
237	emb|BX062181.1|CNS09K55 Single read from an extremity of a full-...	42	0.81
238	emb|BX062144.1|CNS09K44 Single read from an extremity of a full-...	42	0.81
239	emb|BX061931.1|CNS09JY7 Single read from an extremity of a full-...	42	0.81
240	emb|BX061930.1|CNS09JY6 Single read from an extremity of a full-...	42	0.81
241	emb|BX061919.1|CNS09JXV Single read from an extremity of a full-...	42	0.81
242	emb|BX061918.1|CNS09JXU Single read from an extremity of a full-...	42	0.81
243	emb|BX061843.1|CNS09JVR Single read from an extremity of a full-...	42	0.81
244	emb|BX061842.1|CNS09JVQ Single read from an extremity of a full-...	42	0.81
245	emb|BX061792.1|CNS09JUC Single read from an extremity of a full-...	42	0.81
246	emb|BX061791.1|CNS09JUB Single read from an extremity of a full-...	42	0.81
247	emb|BX061702.1|CNS09JRU Single read from an extremity of a full-...	42	0.81
248	emb|BX061681.1|CNS09JR9 Single read from an extremity of a full-...	42	0.81
249	emb|BX061680.1|CNS09JR8 Single read from an extremity of a full-...	42	0.81
250	emb|BX061669.1|CNS09JQX Single read from an extremity of a full-...	42	0.81
251	emb|BX061668.1|CNS09JQW Single read from an extremity of a full-...	42	0.81
252	emb|BX061633.1|CNS09JPX Single read from an extremity of a full-...	42	0.81
253	emb|BX061544.1|CNS09JNG Single read from an extremity of a full-...	42	0.81
254	emb|BX061543.1|CNS09JNF Single read from an extremity of a full-...	42	0.81
255	emb|BX061519.1|CNS09JMR Single read from an extremity of a full-...	42	0.81
256	emb|BX061307.1|CNS09JGV Single read from an extremity of a full-...	42	0.81
257	emb|BX060740.1|CNS09J14 Single read from an extremity of a full-...	42	0.81
258	emb|BX060739.1|CNS09J13 Single read from an extremity of a full-...	42	0.81
259	emb|BX060652.1|CNS09IYO Single read from an extremity of a full-...	42	0.81
260	emb|BX060487.1|CNS09IU3 Single read from an extremity of a full-...	42	0.81
261	emb|BX060486.1|CNS09IU2 Single read from an extremity of a full-...	42	0.81
262	emb|BX060405.1|CNS09IRT Single read from an extremity of a full-...	42	0.81
263	emb|BX060404.1|CNS09IRS Single read from an extremity of a full-...	42	0.81
264	emb|BX060387.1|CNS09IRB Single read from an extremity of a full-...	42	0.81
265	emb|BX060372.1|CNS09IQW Single read from an extremity of a full-...	42	0.81
266	emb|BX060371.1|CNS09IQV Single read from an extremity of a full-...	42	0.81
267	emb|BX059941.1|CNS09IEX Single read from an extremity of a full-...	42	0.81
268	emb|BX059940.1|CNS09IEW Single read from an extremity of a full-...	42	0.81
269	emb|BX059935.1|CNS09IER Single read from an extremity of a full-...	42	0.81
270	emb|BX059894.1|CNS09IDM Single read from an extremity of a full-...	42	0.81
271	emb|BX059879.1|CNS09ID7 Single read from an extremity of a full-...	42	0.81
272	emb|BX059663.1|CNS09I77 Single read from an extremity of a full-...	42	0.81
273	emb|BX059584.1|CNS09I50 Single read from an extremity of a full-...	42	0.81
274	emb|BX059507.1|CNS09I2V Single read from an extremity of a full-...	42	0.81
275	emb|BX059506.1|CNS09I2U Single read from an extremity of a full-...	42	0.81
276	emb|BX059400.1|CNS09HZW Single read from an extremity of a full-...	42	0.81
277	emb|BX059399.1|CNS09HZV Single read from an extremity of a full-...	42	0.81
278	emb|BX059254.1|CNS09HVU Single read from an extremity of a full-...	42	0.81
279	emb|BX059253.1|CNS09HVT Single read from an extremity of a full-...	42	0.81
280	emb|BX058903.1|CNS09HM3 Single read from an extremity of a full-...	42	0.81
281	emb|BX058767.1|CNS09HIB Single read from an extremity of a full-...	42	0.81
282	emb|BX058643.1|CNS09HEV Single read from an extremity of a full-...	42	0.81
283	emb|BX058228.1|CNS09H3C Single read from an extremity of a full-...	42	0.81
284	emb|BX058227.1|CNS09H3B Single read from an extremity of a full-...	42	0.81
285	emb|BX058200.1|CNS09H2K Single read from an extremity of a full-...	42	0.81
286	emb|BX058199.1|CNS09H2J Single read from an extremity of a full-...	42	0.81
287	emb|BX058179.1|CNS09H1Z Single read from an extremity of a full-...	42	0.81
288	emb|BX058148.1|CNS09H14 Single read from an extremity of a full-...	42	0.81
289	emb|BX058063.1|CNS09GYR Single read from an extremity of a full-...	42	0.81
290	emb|BX056739.1|CNS09FXZ Single read from an extremity of a full-...	42	0.81
291	emb|BX056607.1|CNS09FUB Single read from an extremity of a full-...	42	0.81
292	emb|BX056606.1|CNS09FUA Single read from an extremity of a full-...	42	0.81
293	emb|BX058009.1|CNS09GX9 Single read from an extremity of a full-...	42	0.81
294	emb|BX058008.1|CNS09GX8 Single read from an extremity of a full-...	42	0.81
295	emb|BX057993.1|CNS09GWT Single read from an extremity of a full-...	42	0.81
296	emb|BX057992.1|CNS09GWS Single read from an extremity of a full-...	42	0.81
297	emb|BX057951.1|CNS09GVN Single read from an extremity of a full-...	42	0.81
298	emb|BX057950.1|CNS09GVM Single read from an extremity of a full-...	42	0.81
299	emb|BX057949.1|CNS09GVL Single read from an extremity of a full-...	42	0.81
300	emb|BX057821.1|CNS09GS1 Single read from an extremity of a full-...	42	0.81
301	emb|BX057770.1|CNS09GQM Single read from an extremity of a full-...	42	0.81
302	emb|BX057769.1|CNS09GQL Single read from an extremity of a full-...	42	0.81
303	emb|BX057743.1|CNS09GPV Single read from an extremity of a full-...	42	0.81
304	emb|BX057733.1|CNS09GPL Single read from an extremity of a full-...	42	0.81
305	emb|BX057731.1|CNS09GPJ Single read from an extremity of a full-...	42	0.81
306	emb|BX057651.1|CNS09GNB Single read from an extremity of a full-...	42	0.81
307	emb|BX057604.1|CNS09GM0 Single read from an extremity of a full-...	42	0.81
308	emb|BX057603.1|CNS09GLZ Single read from an extremity of a full-...	42	0.81
309	emb|BX057541.1|CNS09GK9 Single read from an extremity of a full-...	42	0.81
310	emb|BX057540.1|CNS09GK8 Single read from an extremity of a full-...	42	0.81
311	emb|BX057539.1|CNS09GK7 Single read from an extremity of a full-...	42	0.81
312	emb|BX057343.1|CNS09GER Single read from an extremity of a full-...	42	0.81
313	emb|BX057264.1|CNS09GCK Single read from an extremity of a full-...	42	0.81
314	emb|BX057244.1|CNS09GC0 Single read from an extremity of a full-...	42	0.81
315	emb|BX057110.1|CNS09G8A Single read from an extremity of a full-...	42	0.81
316	emb|BX056786.1|CNS09FZA Single read from an extremity of a full-...	42	0.81
317	emb|BX056532.1|CNS09FS8 Single read from an extremity of a full-...	42	0.81
318	emb|BX055942.1|CNS09FBU Single read from an extremity of a full-...	42	0.81
319	emb|BX055805.1|CNS09F81 Single read from an extremity of a full-...	42	0.81
320	emb|BX055804.1|CNS09F80 Single read from an extremity of a full-...	42	0.81
321	emb|BX056362.1|CNS09FNI Single read from an extremity of a full-...	42	0.81
322	emb|BX056175.1|CNS09FIB Single read from an extremity of a full-...	42	0.81
323	emb|BX056105.1|CNS09FGD Single read from an extremity of a full-...	42	0.81
324	emb|BX056104.1|CNS09FGC Single read from an extremity of a full-...	42	0.81
325	emb|BX056083.1|CNS09FFR Single read from an extremity of a full-...	42	0.81
326	emb|BX056077.1|CNS09FFL Single read from an extremity of a full-...	42	0.81
327	emb|BX055743.1|CNS09F6B Single read from an extremity of a full-...	42	0.81
328	emb|BX055457.1|CNS09EYD Single read from an extremity of a full-...	42	0.81
329	emb|BX055246.1|CNS09ESI Single read from an extremity of a full-...	42	0.81
330	emb|BX053268.1|CNS09D9K Single read from an extremity of a full-...	42	0.81
331	emb|BX053267.1|CNS09D9J Single read from an extremity of a full-...	42	0.81
332	emb|BX055134.1|CNS09EPE Single read from an extremity of a full-...	42	0.81
333	emb|BX055133.1|CNS09EPD Single read from an extremity of a full-...	42	0.81
334	emb|BX055094.1|CNS09EOA Single read from an extremity of a full-...	42	0.81
335	emb|BX054871.1|CNS09EI3 Single read from an extremity of a full-...	42	0.81
336	emb|BX054860.1|CNS09EHS Single read from an extremity of a full-...	42	0.81
337	emb|BX054859.1|CNS09EHR Single read from an extremity of a full-...	42	0.81
338	emb|BX054831.1|CNS09EGZ Single read from an extremity of a full-...	42	0.81
339	emb|BX054830.1|CNS09EGY Single read from an extremity of a full-...	42	0.81
340	emb|BX053078.1|CNS09D4A Single read from an extremity of a full-...	42	0.81
341	emb|BX054549.1|CNS09E95 Single read from an extremity of a full-...	42	0.81
342	emb|BX054509.1|CNS09E81 Single read from an extremity of a full-...	42	0.81
343	emb|BX054508.1|CNS09E80 Single read from an extremity of a full-...	42	0.81
344	emb|BX054444.1|CNS09E68 Single read from an extremity of a full-...	42	0.81
345	emb|BX054367.1|CNS09E43 Single read from an extremity of a full-...	42	0.81
346	emb|BX054353.1|CNS09E3P Single read from an extremity of a full-...	42	0.81
347	emb|BX054352.1|CNS09E3O Single read from an extremity of a full-...	42	0.81
348	emb|BX054327.1|CNS09E2Z Single read from an extremity of a full-...	42	0.81
349	emb|BX054324.1|CNS09E2W Single read from an extremity of a full-...	42	0.81
350	emb|BX054275.1|CNS09E1J Single read from an extremity of a full-...	42	0.81
351	emb|BX054274.1|CNS09E1I Single read from an extremity of a full-...	42	0.81
352	emb|BX054037.1|CNS09DUX Single read from an extremity of a full-...	42	0.81
353	emb|BX054036.1|CNS09DUW Single read from an extremity of a full-...	42	0.81
354	emb|BX054008.1|CNS09DU4 Single read from an extremity of a full-...	42	0.81
355	emb|BX053832.1|CNS09DP8 Single read from an extremity of a full-...	42	0.81
356	emb|BX053678.1|CNS09DKY Single read from an extremity of a full-...	42	0.81
357	emb|BX052784.1|CNS09CW4 Single read from an extremity of a full-...	42	0.81
358	emb|BX052783.1|CNS09CW3 Single read from an extremity of a full-...	42	0.81
359	emb|BX052746.1|CNS09CV2 Single read from an extremity of a full-...	42	0.81
360	emb|BX052685.1|CNS09CTD Single read from an extremity of a full-...	42	0.81
361	emb|BX052684.1|CNS09CTC Single read from an extremity of a full-...	42	0.81
362	emb|BX052654.1|CNS09CSI Single read from an extremity of a full-...	42	0.81
363	emb|BX052653.1|CNS09CSH Single read from an extremity of a full-...	42	0.81
364	emb|BX052565.1|CNS09CQ1 Single read from an extremity of a full-...	42	0.81
365	emb|BX052564.1|CNS09CQ0 Single read from an extremity of a full-...	42	0.81
366	emb|BX052437.1|CNS09CMH Single read from an extremity of a full-...	42	0.81
367	emb|BX052436.1|CNS09CMG Single read from an extremity of a full-...	42	0.81
368	emb|BX052274.1|CNS09CHY Single read from an extremity of a full-...	42	0.81
369	emb|BX052273.1|CNS09CHX Single read from an extremity of a full-...	42	0.81
370	emb|BX052143.1|CNS09CEB Single read from an extremity of a full-...	42	0.81
371	emb|BX052137.1|CNS09CE5 Single read from an extremity of a full-...	42	0.81
372	emb|BX052037.1|CNS09CBD Single read from an extremity of a full-...	42	0.81
373	emb|BX051542.1|CNS09BXM Single read from an extremity of a full-...	42	0.81
374	emb|BX051541.1|CNS09BXL Single read from an extremity of a full-...	42	0.81
375	emb|BX051490.1|CNS09BW6 Single read from an extremity of a full-...	42	0.81
376	emb|BX051489.1|CNS09BW5 Single read from an extremity of a full-...	42	0.81
377	emb|BX051415.1|CNS09BU3 Single read from an extremity of a full-...	42	0.81
378	emb|BX051366.1|CNS09BSQ Single read from an extremity of a full-...	42	0.81
379	emb|BX050168.1|CNS09AVG Single read from an extremity of a full-...	42	0.81
380	emb|BX050094.1|CNS09ATE Single read from an extremity of a full-...	42	0.81
381	emb|BX050093.1|CNS09ATD Single read from an extremity of a full-...	42	0.81
382	emb|BX051156.1|CNS09BMW Single read from an extremity of a full-...	42	0.81
383	emb|BX051149.1|CNS09BMP Single read from an extremity of a full-...	42	0.81
384	emb|BX051109.1|CNS09BLL Single read from an extremity of a full-...	42	0.81
385	emb|BX051068.1|CNS09BKG Single read from an extremity of a full-...	42	0.81
386	emb|BX051039.1|CNS09BJN Single read from an extremity of a full-...	42	0.81
387	emb|BX050808.1|CNS09BD8 Single read from an extremity of a full-...	42	0.81
388	emb|BX050722.1|CNS09BAU Single read from an extremity of a full-...	42	0.81
389	emb|BX050652.1|CNS09B8W Single read from an extremity of a full-...	42	0.81
390	emb|BX050398.1|CNS09B1U Single read from an extremity of a full-...	42	0.81
391	emb|BX030924.1|CNS08W0W Single read from an extremity of a full-...	42	0.81
392	emb|BX030923.1|CNS08W0V Single read from an extremity of a full-...	42	0.81
393	emb|BX049263.1|CNS09A6B Single read from an extremity of a full-...	42	0.81
394	emb|BX049198.1|CNS09A4I Single read from an extremity of a full-...	42	0.81
395	emb|BX049197.1|CNS09A4H Single read from an extremity of a full-...	42	0.81
396	emb|BX049153.1|CNS09A39 Single read from an extremity of a full-...	42	0.81
397	emb|BX049152.1|CNS09A38 Single read from an extremity of a full-...	42	0.81
398	emb|BX048858.1|CNS099V2 Single read from an extremity of a full-...	42	0.81
399	emb|BX048845.1|CNS099UP Single read from an extremity of a full-...	42	0.81
400	emb|BX048844.1|CNS099UO Single read from an extremity of a full-...	42	0.81
401	emb|BX048777.1|CNS099ST Single read from an extremity of a full-...	42	0.81
402	emb|BX048776.1|CNS099SS Single read from an extremity of a full-...	42	0.81
403	emb|BX048729.1|CNS099RH Single read from an extremity of a full-...	42	0.81
404	emb|BX048692.1|CNS099QG Single read from an extremity of a full-...	42	0.81
405	emb|BX048603.1|CNS099NZ Single read from an extremity of a full-...	42	0.81
406	emb|BX048602.1|CNS099NY Single read from an extremity of a full-...	42	0.81
407	emb|BX046446.1|CNS09802 Single read from an extremity of a full-...	42	0.81
408	emb|BX046445.1|CNS09801 Single read from an extremity of a full-...	42	0.81
409	emb|BX048416.1|CNS099IS Single read from an extremity of a full-...	42	0.81
410	emb|BX048412.1|CNS099IO Single read from an extremity of a full-...	42	0.81
411	emb|BX048411.1|CNS099IN Single read from an extremity of a full-...	42	0.81
412	emb|BX048139.1|CNS099B3 Single read from an extremity of a full-...	42	0.81
413	emb|BX048045.1|CNS0998H Single read from an extremity of a full-...	42	0.81
414	emb|BX048044.1|CNS0998G Single read from an extremity of a full-...	42	0.81
415	emb|BX047975.1|CNS0996J Single read from an extremity of a full-...	42	0.81
416	emb|BX047936.1|CNS0995G Single read from an extremity of a full-...	42	0.81
417	emb|BX047848.1|CNS09930 Single read from an extremity of a full-...	42	0.81
418	emb|BX047847.1|CNS0992Z Single read from an extremity of a full-...	42	0.81
419	emb|BX047664.1|CNS098XW Single read from an extremity of a full-...	42	0.81
420	emb|BX047663.1|CNS098XV Single read from an extremity of a full-...	42	0.81
421	emb|BX047646.1|CNS098XE Single read from an extremity of a full-...	42	0.81
422	emb|BX047645.1|CNS098XD Single read from an extremity of a full-...	42	0.81
423	emb|BX047632.1|CNS098X0 Single read from an extremity of a full-...	42	0.81
424	emb|BX047631.1|CNS098WZ Single read from an extremity of a full-...	42	0.81
425	emb|BX047541.1|CNS098UH Single read from an extremity of a full-...	42	0.81
426	emb|BX047540.1|CNS098UG Single read from an extremity of a full-...	42	0.81
427	emb|BX047475.1|CNS098SN Single read from an extremity of a full-...	42	0.81
428	emb|BX047290.1|CNS098NI Single read from an extremity of a full-...	42	0.81
429	emb|BX047289.1|CNS098NH Single read from an extremity of a full-...	42	0.81
430	emb|BX047058.1|CNS098H2 Single read from an extremity of a full-...	42	0.81
431	emb|BX047057.1|CNS098H1 Single read from an extremity of a full-...	42	0.81
432	emb|BX047038.1|CNS098GI Single read from an extremity of a full-...	42	0.81
433	emb|BX047037.1|CNS098GH Single read from an extremity of a full-...	42	0.81
434	emb|BX046957.1|CNS098E9 Single read from an extremity of a full-...	42	0.81
435	emb|BX046956.1|CNS098E8 Single read from an extremity of a full-...	42	0.81
436	emb|BX046864.1|CNS098BO Single read from an extremity of a full-...	42	0.81
437	emb|BX046734.1|CNS09882 Single read from an extremity of a full-...	42	0.81
438	emb|BX046733.1|CNS09881 Single read from an extremity of a full-...	42	0.81
439	emb|BX046649.1|CNS0985P Single read from an extremity of a full-...	42	0.81
440	emb|BX046648.1|CNS0985O Single read from an extremity of a full-...	42	0.81
441	emb|BX046631.1|CNS09857 Single read from an extremity of a full-...	42	0.81
442	emb|BX046174.1|CNS097SI Single read from an extremity of a full-...	42	0.81
443	emb|BX046173.1|CNS097SH Single read from an extremity of a full-...	42	0.81
444	emb|BX045997.1|CNS097NL Single read from an extremity of a full-...	42	0.81
445	emb|BX045996.1|CNS097NK Single read from an extremity of a full-...	42	0.81
446	emb|BX045979.1|CNS097N3 Single read from an extremity of a full-...	42	0.81
447	emb|BX045978.1|CNS097N2 Single read from an extremity of a full-...	42	0.81
448	emb|BX045946.1|CNS097M6 Single read from an extremity of a full-...	42	0.81
449	emb|BX045945.1|CNS097M5 Single read from an extremity of a full-...	42	0.81
450	emb|BX045578.1|CNS097BY Single read from an extremity of a full-...	42	0.81
451	emb|BX045577.1|CNS097BX Single read from an extremity of a full-...	42	0.81
452	emb|BX045558.1|CNS097BE Single read from an extremity of a full-...	42	0.81
453	emb|BX045479.1|CNS09797 Single read from an extremity of a full-...	42	0.81
454	emb|BX045473.1|CNS09791 Single read from an extremity of a full-...	42	0.81
455	emb|BX045456.1|CNS0978K Single read from an extremity of a full-...	42	0.81
456	emb|BX045455.1|CNS0978J Single read from an extremity of a full-...	42	0.81
457	emb|BX045061.1|CNS096XL Single read from an extremity of a full-...	42	0.81
458	emb|BX045060.1|CNS096XK Single read from an extremity of a full-...	42	0.81
459	emb|BX044936.1|CNS096U4 Single read from an extremity of a full-...	42	0.81
460	emb|BX045248.1|CNS0972S Single read from an extremity of a full-...	42	0.81
461	emb|BX045247.1|CNS0972R Single read from an extremity of a full-...	42	0.81
462	emb|BX044874.1|CNS096SE Single read from an extremity of a full-...	42	0.81
463	emb|BX044873.1|CNS096SD Single read from an extremity of a full-...	42	0.81
464	emb|BX043075.1|CNS095EF Single read from an extremity of a full-...	42	0.81
465	emb|BX043074.1|CNS095EE Single read from an extremity of a full-...	42	0.81
466	emb|BX043038.1|CNS095DE Single read from an extremity of a full-...	42	0.81
467	emb|BX043037.1|CNS095DD Single read from an extremity of a full-...	42	0.81
468	emb|BX044562.1|CNS096JQ Single read from an extremity of a full-...	42	0.81
469	emb|BX044561.1|CNS096JP Single read from an extremity of a full-...	42	0.81
470	emb|BX044552.1|CNS096JG Single read from an extremity of a full-...	42	0.81
471	emb|BX044453.1|CNS096GP Single read from an extremity of a full-...	42	0.81
472	emb|BX044452.1|CNS096GO Single read from an extremity of a full-...	42	0.81
473	emb|BX044445.1|CNS096GH Single read from an extremity of a full-...	42	0.81
474	emb|BX044296.1|CNS096CC Single read from an extremity of a full-...	42	0.81
475	emb|BX044295.1|CNS096CB Single read from an extremity of a full-...	42	0.81
476	emb|BX044254.1|CNS096B6 Single read from an extremity of a full-...	42	0.81
477	emb|BX044221.1|CNS096A9 Single read from an extremity of a full-...	42	0.81
478	emb|BX043985.1|CNS0963P Single read from an extremity of a full-...	42	0.81
479	emb|BX043984.1|CNS0963O Single read from an extremity of a full-...	42	0.81
480	emb|BX043961.1|CNS09631 Single read from an extremity of a full-...	42	0.81
481	emb|BX043960.1|CNS09630 Single read from an extremity of a full-...	42	0.81
482	emb|BX043876.1|CNS0960O Single read from an extremity of a full-...	42	0.81
483	emb|BX043875.1|CNS0960N Single read from an extremity of a full-...	42	0.81
484	emb|BX043825.1|CNS095Z9 Single read from an extremity of a full-...	42	0.81
485	emb|BX043824.1|CNS095Z8 Single read from an extremity of a full-...	42	0.81
486	emb|BX043809.1|CNS095YT Single read from an extremity of a full-...	42	0.81
487	emb|BX043777.1|CNS095XX Single read from an extremity of a full-...	42	0.81
488	emb|BX043720.1|CNS095WC Single read from an extremity of a full-...	42	0.81
489	emb|BX043499.1|CNS095Q7 Single read from an extremity of a full-...	42	0.81
490	emb|BX043438.1|CNS095OI Single read from an extremity of a full-...	42	0.81
491	emb|BX043437.1|CNS095OH Single read from an extremity of a full-...	42	0.81
492	emb|BX043315.1|CNS095L3 Single read from an extremity of a full-...	42	0.81
493	emb|BX043314.1|CNS095L2 Single read from an extremity of a full-...	42	0.81
494	emb|BX043308.1|CNS095KW Single read from an extremity of a full-...	42	0.81
495	emb|BX043651.1|CNS095UF Single read from an extremity of a full-...	42	0.81
496	emb|BX043638.1|CNS095U2 Single read from an extremity of a full-...	42	0.81
497	emb|BX043291.1|CNS095KF Single read from an extremity of a full-...	42	0.81
498	emb|BX043290.1|CNS095KE Single read from an extremity of a full-...	42	0.81
499	emb|BX043280.1|CNS095K4 Single read from an extremity of a full-...	42	0.81
500	emb|BX043187.1|CNS095HJ Single read from an extremity of a full-...	42	0.81

---

>ref|XM_470037.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1064

 Score =  170 bits (86), Expect = 1e-39
 Identities = 172/202 (85%)
 Strand = Plus / Minus

                                                                       
Query: 46  gccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtc 105
           ||||| ||||| || ||||||| ||||| | |||||||| | |||| ||||  |||  | 
Sbjct: 822 gccttagtcggcttggccaagaggtcggtgtactcctggaatggagacttgacgaacttg 763

                                                                       
Query: 106 gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
           || ||||||||||||| ||| || ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 762 gtgtccctccagaagtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtg 703

                                                                       
Query: 166 gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
           |||||||| ||||||||||||||||||||||||||||| || || ||||||||||  |||
Sbjct: 702 gccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctca 643

                                 
Query: 226 ataccagcgaactggagcacct 247
           || || |||||||| |||||||
Sbjct: 642 atgccggcgaactgcagcacct 621

---

>dbj|AK064984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001C14, full
           insert sequence
          Length = 1084

 Score =  170 bits (86), Expect = 1e-39
 Identities = 172/202 (85%)
 Strand = Plus / Minus

                                                                       
Query: 46  gccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtc 105
           ||||| ||||| || ||||||| ||||| | |||||||| | |||| ||||  |||  | 
Sbjct: 864 gccttagtcggcttggccaagaggtcggtgtactcctggaatggagacttgacgaacttg 805

                                                                       
Query: 106 gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
           || ||||||||||||| ||| || ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 804 gtgtccctccagaagtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtg 745

                                                                       
Query: 166 gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
           |||||||| ||||||||||||||||||||||||||||| || || ||||||||||  |||
Sbjct: 744 gccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctca 685

                                 
Query: 226 ataccagcgaactggagcacct 247
           || || |||||||| |||||||
Sbjct: 684 atgccggcgaactgcagcacct 663

---

>gb|AY104047.1| Zea mays PCO131880 mRNA sequence
          Length = 873

 Score =  141 bits (71), Expect = 1e-30
 Identities = 119/136 (87%)
 Strand = Plus / Minus

                                                                       
Query: 112 ctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttg 171
           |||||||| | ||| || ||||| || ||||||||||| |||||||||||||||||||||
Sbjct: 571 ctccagaattcaggagtaaggaagccgtaggtcttcatgaggcagtcgaaggttgccttg 512

                                                                       
Query: 172 acnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaatacca 231
           || ||||||||||||||||| ||||| ||||| || || ||||||||||  ||||| |||
Sbjct: 511 acgaagttgccaagggtcttagtggagccacgggacgaggtgaagacatcctcaatgcca 452

                           
Query: 232 gcgaactggagcacct 247
           |||||||| |||||||
Sbjct: 451 gcgaactgcagcacct 436

---

>ref|XM_477083.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 831

 Score =  125 bits (63), Expect = 7e-26
 Identities = 155/187 (82%)
 Strand = Plus / Minus

                                                                       
Query: 61  gccaagatgtcggngaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 120
           ||||||| ||| | | |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 779 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 720

                                                                       
Query: 121 tnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacnaagttg 180
           | ||| || ||||| |||||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 719 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggccttgacgaagttg 660

                                                                       
Query: 181 ccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaataccagcgaactgg 240
           || |||||||||||||| || ||||| || |||||||| |  || || || |||||||||
Sbjct: 659 ccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcgatgccggcgaactgg 600

                  
Query: 241 agcacct 247
           |||||||
Sbjct: 599 agcacct 593

---

>dbj|AK063732.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-E09, full
           insert sequence
          Length = 869

 Score =  125 bits (63), Expect = 7e-26
 Identities = 155/187 (82%)
 Strand = Plus / Minus

                                                                       
Query: 61  gccaagatgtcggngaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 120
           ||||||| ||| | | |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 447 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 388

                                                                       
Query: 121 tnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgccttgacnaagttg 180
           | ||| || ||||| |||||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 387 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggccttgacgaagttg 328

                                                                       
Query: 181 ccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaataccagcgaactgg 240
           || |||||||||||||| || ||||| || |||||||| |  || || || |||||||||
Sbjct: 327 ccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcgatgccggcgaactgg 268

                  
Query: 241 agcacct 247
           |||||||
Sbjct: 267 agcacct 261

---

>gb|BT016220.1| Zea mays clone Contig53 mRNA sequence
          Length = 1159

 Score =  105 bits (53), Expect = 6e-20
 Identities = 163/201 (81%)
 Strand = Plus / Minus

                                                                       
Query: 47  ccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtcg 106
           |||| ||||| || ||||||| ||||| |||||||||| |||| |||||||   |  | |
Sbjct: 873 cctttgtcggcttagccaagaggtcggtgaactcctggaacggggtcttggcatacttgg 814

                                                                       
Query: 107 tctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 166
           ||||   |||||| | ||| |||||||| || |||||||||||||| || || |||||||
Sbjct: 813 tctcggcccagaactcaggagtgaggaagccgtaggtcttcatcagacaatcaaaggttg 754

                                                                       
Query: 167 ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
           ||||||| ||||| || || ||||||||||| ||||| || || || |||||||  ||||
Sbjct: 753 ccttgacgaagttaccgagtgtcttggtggagccacgggacgaggtaaagacatcttcaa 694

                                
Query: 227 taccagcgaactggagcacct 247
           | || ||||||||||| ||||
Sbjct: 693 tgccggcgaactggaggacct 673

---

>gb|AY104097.1| Zea mays PCO131882 mRNA sequence
          Length = 1083

 Score =  105 bits (53), Expect = 6e-20
 Identities = 163/201 (81%)
 Strand = Plus / Minus

                                                                       
Query: 47  ccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtcg 106
           |||| ||||| || ||||||| ||||| |||||||||| |||| |||||||   |  | |
Sbjct: 777 cctttgtcggcttagccaagaggtcggtgaactcctggaacggggtcttggcatacttgg 718

                                                                       
Query: 107 tctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttg 166
           ||||   |||||| | ||| |||||||| || |||||||||||||| || || |||||||
Sbjct: 717 tctcggcccagaactcaggagtgaggaagccgtaggtcttcatcagacaatcaaaggttg 658

                                                                       
Query: 167 ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
           ||||||| ||||| || || ||||||||||| ||||| || || || |||||||  ||||
Sbjct: 657 ccttgacgaagttaccgagtgtcttggtggagccacgggacgaggtaaagacatcctcaa 598

                                
Query: 227 taccagcgaactggagcacct 247
           | || ||||||||||| ||||
Sbjct: 597 tgccggcgaactggaggacct 577

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                            
Query: 167      ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
                ||||||| ||||||||||||||||||||||||||||| || || ||||||||||  ||||
Sbjct: 33465835 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 33465776

                                     
Query: 227      taccagcgaactggagcacct 247
                | || |||||||| |||||||
Sbjct: 33465775 tgccggcgaactgcagcacct 33465755



 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                            
Query: 46       gccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtc 105
                ||||| ||||| || ||||||| ||||| | |||||||| | |||| ||||  |||  | 
Sbjct: 33466749 gccttagtcggcttggccaagaggtcggtgtactcctggaatggagacttgacgaacttg 33466690

                                                                            
Query: 106      gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
                || ||||||||||||| ||| || ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 33466689 gtgtccctccagaagtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtg 33466630

                    
Query: 166      gcct 169
                ||||
Sbjct: 33466629 gcct 33466626

---

>gb|AC135958.2| Oryza sativa chromosome 3 BAC OSJNBa0059E14 genomic sequence, complete
             sequence
          Length = 154555

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||||||||||||||||||||||||||| || || ||||||||||  ||||
Sbjct: 32276 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 32335

                                  
Query: 227   taccagcgaactggagcacct 247
             | || |||||||| |||||||
Sbjct: 32336 tgccggcgaactgcagcacct 32356



 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 103/124 (83%)
 Strand = Plus / Plus

                                                                         
Query: 46    gccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtc 105
             ||||| ||||| || ||||||| ||||| | |||||||| | |||| ||||  |||  | 
Sbjct: 31362 gccttagtcggcttggccaagaggtcggtgtactcctggaatggagacttgacgaacttg 31421

                                                                         
Query: 106   gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
             || ||||||||||||| ||| || ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 31422 gtgtccctccagaagtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtg 31481

                 
Query: 166   gcct 169
             ||||
Sbjct: 31482 gcct 31485

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                            
Query: 167      ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
                ||||||| ||||||||||||||||||||||||||||| || || ||||||||||  ||||
Sbjct: 33556345 ccttgacgaagttgccaagggtcttggtggatccacgggacgaggtgaagacatcctcaa 33556286

                                     
Query: 227      taccagcgaactggagcacct 247
                | || |||||||| |||||||
Sbjct: 33556285 tgccggcgaactgcagcacct 33556265



 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                            
Query: 46       gccttggtcggtttcgccaagatgtcggngaactcctggtacggagtcttggtgaaggtc 105
                ||||| ||||| || ||||||| ||||| | |||||||| | |||| ||||  |||  | 
Sbjct: 33557259 gccttagtcggcttggccaagaggtcggtgtactcctggaatggagacttgacgaacttg 33557200

                                                                            
Query: 106      gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
                || ||||||||||||| ||| || ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 33557199 gtgtccctccagaagtcaggagtaaggaatccataagtcttcatcaggcagtcaaaggtg 33557140

                    
Query: 166      gcct 169
                ||||
Sbjct: 33557139 gcct 33557136

---

>ref|NM_129748.2| Arabidopsis thaliana structural constituent of ribosome AT2G41840
           mRNA, complete cds
          Length = 1214

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 106 gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
           |||||| ||||||| |  ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 899 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 840

                                                                       
Query: 166 gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
           |||||||| ||||| ||||| || ||||||||||| |  ||||||||||| |||| ||||
Sbjct: 839 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 780

                      
Query: 226 ataccagcgaa 236
           || ||||||||
Sbjct: 779 attccagcgaa 769

---

>gb|AY133561.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, complete cds
          Length = 858

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 106 gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
           |||||| ||||||| |  ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 758 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 699

                                                                       
Query: 166 gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
           |||||||| ||||| ||||| || ||||||||||| |  ||||||||||| |||| ||||
Sbjct: 698 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 639

                      
Query: 226 ataccagcgaa 236
           || ||||||||
Sbjct: 638 attccagcgaa 628

---

>gb|AY048250.1| Arabidopsis thaliana At2g41840/T11A7.6 mRNA, complete cds
          Length = 1079

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 106 gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
           |||||| ||||||| |  ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 822 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 763

                                                                       
Query: 166 gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
           |||||||| ||||| ||||| || ||||||||||| |  ||||||||||| |||| ||||
Sbjct: 762 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 703

                      
Query: 226 ataccagcgaa 236
           || ||||||||
Sbjct: 702 attccagcgaa 692

---

>gb|AY085726.1| Arabidopsis thaliana clone 17415 mRNA, complete sequence
          Length = 1190

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 106 gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
           |||||| ||||||| |  ||||| |||||||| || ||||||   ||||| ||||| || 
Sbjct: 899 gtctccttccagaactctggggtaaggaatccgtaagtcttctgaaggcaatcgaatgta 840

                                                                       
Query: 166 gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
           |||||||| ||||| ||||| || ||||||||||| |  ||||||||||| |||| ||||
Sbjct: 839 gccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatca 780

                      
Query: 226 ataccagcgaa 236
           || ||||||||
Sbjct: 779 attccagcgaa 769

---

>dbj|AP006685.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45M12, TM0378b,
             complete sequence
          Length = 86433

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                         
Query: 106   gtctccctccagaagtnaggggtgaggaatccataggtcttcatcaggcagtcgaaggtt 165
             |||||| ||||||| | ||| || ||||| |  ||||| |||| ||  ||||| || |||
Sbjct: 17933 gtctccttccagaattcaggtgtcaggaaactgtaggttttcagcaaacagtcaaaagtt 17874

                                                                         
Query: 166   gccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatca 225
             |||||||| || ||||| || |||||||||||||| |  || ||||||||||||| ||||
Sbjct: 17873 gccttgacgaaattgccgagtgtcttggtggatcctctggaagaagtgaagacatcatca 17814

                           
Query: 226   ataccagcgaactg 239
             || |||||||||||
Sbjct: 17813 atcccagcgaactg 17800

---

>gb|AY486481.1| Capsicum annuum 40S ribosomal protein S2 mRNA, partial sequence
          Length = 737

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                       
Query: 171 gacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaatacc 230
           ||| |||||||||||||| |||||||||||||| || || ||||||||||  ||||||||
Sbjct: 737 gacgaagttgccaagggttttggtggatccacgagaagaggtgaagacatcttcaatacc 678

                    
Query: 231 agcgaactg 239
           ||| |||||
Sbjct: 677 agcaaactg 669

---

>ref|NM_148602.2| Arabidopsis thaliana structural constituent of ribosome AT1G58684
           mRNA, complete cds
          Length = 1004

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 704 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 645

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 644 acatcatcaataccagcgaactg 622

---

>ref|NM_104632.3| Arabidopsis thaliana structural constituent of ribosome AT1G58983
           mRNA, complete cds
          Length = 1126

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 716 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 657

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 656 acatcatcaataccagcgaactg 634

---

>ref|NM_104640.3| Arabidopsis thaliana structural constituent of ribosome AT1G59359
           mRNA, complete cds
          Length = 1004

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 704 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 645

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 644 acatcatcaataccagcgaactg 622

---

>gb|AY133659.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, complete cds
          Length = 855

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 704 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 645

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 644 acatcatcaataccagcgaactg 622

---

>gb|AY065030.1| Arabidopsis thaliana At1g59359/T4M14_3 mRNA, complete cds
          Length = 1073

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 716 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 657

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 656 acatcatcaataccagcgaactg 634

---

>dbj|AK220575.1| Arabidopsis thaliana mRNA for ribosomal protein S2, complete cds,
           clone: RAFL14-92-C03
          Length = 1058

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 716 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 657

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 656 acatcatcaataccagcgaactg 634

---

>emb|BX814292.1|CNS0ABYL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 702 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 643

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 642 acatcatcaataccagcgaactg 620

---

>emb|BX815169.1|CNS0ABBY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZB03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 989

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 698 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 639

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 638 acatcatcaataccagcgaactg 616

---

>emb|BX817373.1|CNS0AAYC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL19ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1002

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 698 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 639

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 638 acatcatcaataccagcgaactg 616

---

>dbj|AB008017.1| Arabidopsis thaliana RF12 mRNA, partial cds
          Length = 1052

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| ||||| |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 700 tcgaatgtagccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaag 641

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 640 acatcatcaataccagcgaactg 618

---

>gb|AC140104.22| Medicago truncatula clone mth2-10g22, complete sequence
          Length = 127043

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| || || |||||||| ||||||||||| |  ||||||||||| |||| |||||
Sbjct: 97512 ccttgacgaaatttccaagggttttggtggatcccctagaggaagtgaaaacatcatcaa 97571

                          
Query: 227   taccagcgaactg 239
             ||||||| |||||
Sbjct: 97572 taccagcaaactg 97584

---

>gb|AC142395.41| Medicago truncatula clone mth2-18g1, complete sequence
          Length = 110556

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| || || |||||||| ||||||||||| |  ||||||||||| |||| |||||
Sbjct: 57040 ccttgacgaaatttccaagggttttggtggatcccctagaggaagtgaaaacatcatcaa 57099

                          
Query: 227   taccagcgaactg 239
             ||||||| |||||
Sbjct: 57100 taccagcaaactg 57112

---

>gb|AC027036.12|AC027036 Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete
             sequence
          Length = 89737

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| ||||||| |||||
Sbjct: 48999 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 49058

                          
Query: 227   taccagcgaactg 239
             |||||||||||||
Sbjct: 49059 taccagcgaactg 49071



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| ||||||| |||||
Sbjct: 12741 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 12800

                          
Query: 227   taccagcgaactg 239
             |||||||||||||
Sbjct: 12801 taccagcgaactg 12813

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                           
Query: 167     ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
               ||||||| |||||||| |||||||||||||| || ||||| || |||||||| |  || |
Sbjct: 5820039 ccttgacgaagttgccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcga 5819980

                                    
Query: 227     taccagcgaactggagcacct 247
               | || ||||||||||||||||
Sbjct: 5819979 tgccggcgaactggagcacct 5819959



 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 89/109 (81%)
 Strand = Plus / Minus

                                                                           
Query: 61      gccaagatgtcggngaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 120
               ||||||| ||| | | |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 5820953 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 5820894

                                                                
Query: 121     tnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 169
               | ||| || ||||| |||||||||||||| || || |||||||| ||||
Sbjct: 5820893 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggcct 5820845



 Score = 50.1 bits (25), Expect = 0.003
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                    
Query: 167      ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagac 218
                ||||||| |||||||  |||||||||||||| ||||| || || ||||||||
Sbjct: 13387865 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagac 13387814

---

>dbj|AP003943.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1119_B04
          Length = 151721

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                          
Query: 167    ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
              ||||||| |||||||| |||||||||||||| || ||||| || |||||||| |  || |
Sbjct: 127067 ccttgacgaagttgccgagggtcttggtggagccgcgcgacgaggtgaagacgtcctcga 127008

                                   
Query: 227    taccagcgaactggagcacct 247
              | || ||||||||||||||||
Sbjct: 127007 tgccggcgaactggagcacct 126987



 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 89/109 (81%)
 Strand = Plus / Minus

                                                                          
Query: 61     gccaagatgtcggngaactcctggtacggagtcttggtgaaggtcgtctccctccagaag 120
              ||||||| ||| | | |||||||| |||| |||||| | ||  | ||||| |||||||||
Sbjct: 127981 gccaagaggtccgtgtactcctggaacggcgtcttgataaacctggtctctctccagaag 127922

                                                               
Query: 121    tnaggggtgaggaatccataggtcttcatcaggcagtcgaaggttgcct 169
              | ||| || ||||| |||||||||||||| || || |||||||| ||||
Sbjct: 127921 tcaggagtcaggaacccataggtcttcatgagacaatcgaaggtggcct 127873

---

>dbj|AB078516.1| Arabidopsis thaliana genomic DNA, chromosome 1, P1 clone:R18I, complete
             sequence
          Length = 83408

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| ||||||| |||||
Sbjct: 71310 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 71369

                          
Query: 227   taccagcgaactg 239
             |||||||||||||
Sbjct: 71370 taccagcgaactg 71382



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| |||||||| ||||| ||||| |  || ||||| ||||||| |||||
Sbjct: 35052 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 35111

                          
Query: 227   taccagcgaactg 239
             |||||||||||||
Sbjct: 35112 taccagcgaactg 35124

---

>dbj|AB076984.1| Arabidopsis thaliana DNA, chromosome 1, clone:P1-C15J, partial
            sequence
          Length = 24538

 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 167  ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
            ||||||| ||||| |||||||| ||||| ||||| |  || ||||| ||||||| |||||
Sbjct: 1845 ccttgacaaagtttccaagggttttggtagatcctcttgaagaagtaaagacatcatcaa 1904

                         
Query: 227  taccagcgaactg 239
            |||||||||||||
Sbjct: 1905 taccagcgaactg 1917

---

>ref|NM_115609.2| Arabidopsis thaliana structural constituent of ribosome AT3G57490
           mRNA, complete cds
          Length = 1050

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 130 aggaatccataggtcttcatcaggcagtcgaaggttgccttgacnaagttgccaagggtc 189
           |||||||| || ||||||  ||| || || || ||||||||||| ||||| ||||| || 
Sbjct: 768 aggaatccgtatgtcttctgcagacaatcaaatgttgccttgacgaagtttccaagagtt 709

                                                          
Query: 190 ttggtggatccacgcgaggaagtgaagacatnatcaataccagcgaa 236
           ||||||||||| |  || ||||| ||||||| |||||| ||||||||
Sbjct: 708 ttggtggatcctctagaagaagtaaagacatcatcaattccagcgaa 662

---

>gb|AY120723.1| Arabidopsis thaliana ribosomal protein S2, putative (At1g59359)
           mRNA, complete cds
          Length = 1038

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || |||||||| || || |||||||| ||||| ||||| |  || ||||| |||
Sbjct: 711 tcgaatgtagccttgacaaactttccaagggttttggtagatcctcttgaagaagtaaag 652

                                  
Query: 217 acatnatcaataccagcgaactg 239
           |||| ||||||||||||||||||
Sbjct: 651 acatcatcaataccagcgaactg 629

---

>gb|BT006200.1| Arabidopsis thaliana At3g57490 mRNA, complete cds
          Length = 831

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 130 aggaatccataggtcttcatcaggcagtcgaaggttgccttgacnaagttgccaagggtc 189
           |||||||| || ||||||  ||| || || || ||||||||||| ||||| ||||| || 
Sbjct: 707 aggaatccgtatgtcttctgcagacaatcaaatgttgccttgacgaagtttccaagagtt 648

                                                          
Query: 190 ttggtggatccacgcgaggaagtgaagacatnatcaataccagcgaa 236
           ||||||||||| |  || ||||| ||||||| |||||| ||||||||
Sbjct: 647 ttggtggatcctctagaagaagtaaagacatcatcaattccagcgaa 601

---

>gb|AY084252.1| Arabidopsis thaliana clone 101250 mRNA, complete sequence
          Length = 1048

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 88/107 (82%)
 Strand = Plus / Minus

                                                                       
Query: 130 aggaatccataggtcttcatcaggcagtcgaaggttgccttgacnaagttgccaagggtc 189
           |||||||| || ||||||  ||| || || || ||||||||||| ||||| ||||| || 
Sbjct: 768 aggaatccgtatgtcttctgcagacaatcaaatgttgccttgacgaagtttccaagagtt 709

                                                          
Query: 190 ttggtggatccacgcgaggaagtgaagacatnatcaataccagcgaa 236
           ||||||||||| |  || ||||| ||||||| |||||| ||||||||
Sbjct: 708 ttggtggatcctctagaagaagtaaagacatcatcaattccagcgaa 662

---

>gb|AC002339.3| Arabidopsis thaliana chromosome 2 clone T11A7 map CIC11C08, complete
             sequence
          Length = 91071

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| ||||| || ||||||||||| |  ||||||||||| |||| |||||
Sbjct: 19834 ccttgacgaagtttccaagagttttggtggatcccctggaggaagtgaaaacatcatcaa 19775

                       
Query: 227   taccagcgaa 236
             | ||||||||
Sbjct: 19774 ttccagcgaa 19765

---

>dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT13O11, TM0069,
             complete sequence
          Length = 103659

 Score = 61.9 bits (31), Expect = 9e-07
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| || || |||||||| |||||||| || |  ||||||||||| |||| |||||
Sbjct: 75702 ccttgacgaaatttccaagggttttggtggaacccctggaggaagtgaaaacatcatcaa 75761

                          
Query: 227   taccagcgaactg 239
             | |||||||||||
Sbjct: 75762 tcccagcgaactg 75774

---

>ref|NM_104618.2| Arabidopsis thaliana XW6; structural constituent of ribosome
           AT1G58380 (XW6) mRNA, complete cds
          Length = 1109

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcagtcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagt 212
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 791 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 732

                                      
Query: 213 gaagacatnatcaataccagcgaactg 239
            ||||||| ||||||||||||||||||
Sbjct: 731 aaagacatcatcaataccagcgaactg 705

---

>gb|AY072528.1| Arabidopsis thaliana ribosomal protein S2, putative (At1g58380;
           F9K23.9) mRNA, complete cds
          Length = 971

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcagtcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagt 212
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 708 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 649

                                      
Query: 213 gaagacatnatcaataccagcgaactg 239
            ||||||| ||||||||||||||||||
Sbjct: 648 aaagacatcatcaataccagcgaactg 622

---

>gb|AF386958.1|AF386958 Arabidopsis thaliana ribosomal protein S2, putative (F9K23.9) mRNA,
           complete cds
          Length = 1071

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcagtcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagt 212
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 759 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 700

                                      
Query: 213 gaagacatnatcaataccagcgaactg 239
            ||||||| ||||||||||||||||||
Sbjct: 699 aaagacatcatcaataccagcgaactg 673

---

>emb|BX816200.1|CNS0ABME Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH33ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1014

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 157 tcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaag 216
           ||||| || ||||| || ||||| || ||||| ||||| ||||| |  || |||||||||
Sbjct: 705 tcgaatgtcgccttcacaaagtttccgagggttttggtagatcctcttgaagaagtgaag 646

                                  
Query: 217 acatnatcaataccagcgaactg 239
           | || ||||||||||||||||||
Sbjct: 645 agatcatcaataccagcgaactg 623

---

>gb|AY088743.1| Arabidopsis thaliana clone 93867 mRNA, complete sequence
          Length = 1106

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcagtcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagt 212
           |||||| || || |||||||| ||||| || || || ||||| ||||| |  || |||||
Sbjct: 792 gcagtcaaatgtcgccttgacaaagtttccgagtgttttggtagatcctctagaagaagt 733

                                      
Query: 213 gaagacatnatcaataccagcgaactg 239
            ||||||| ||||||||||||||||||
Sbjct: 732 aaagacatcatcaataccagcgaactg 706

---

>dbj|AB008016.1| Arabidopsis thaliana XW6 mRNA, complete cds
          Length = 1075

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 153 gcagtcgaaggttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagt 212
           |||||| || || |||||||| ||||| ||||| || || || ||||| |  || |||||
Sbjct: 758 gcagtcaaacgtcgccttgacaaagtttccaagagttttagtagatcctctggaagaagt 699

                                      
Query: 213 gaagacatnatcaataccagcgaactg 239
            ||||||| ||||||||||||||||||
Sbjct: 698 aaagacatcatcaataccagcgaactg 672

---

>emb|AL133248.1|ATT8H10 Arabidopsis thaliana DNA chromosome 3, BAC clone T8H10
          Length = 87503

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| ||||| || ||||||||||| |  || ||||| ||||||| |||||
Sbjct: 34054 ccttgacgaagtttccaagagttttggtggatcctctagaagaagtaaagacatcatcaa 34113

                       
Query: 227   taccagcgaa 236
             | ||||||||
Sbjct: 34114 ttccagcgaa 34123

---

>emb|AJ132531.1|PAB132531 Picea abies mRNA for 40S ribosomal protein S2
          Length = 1090

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 163 gttgccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacat 220
           ||||||||||| || || ||||| |||||||| || || |||||||| ||||||||||
Sbjct: 722 gttgccttgacaaaatttccaagagtcttggtcgaccctcgcgaggaggtgaagacat 665

---

>gb|AC082643.6|AC082643 Arabidopsis thaliana chromosome 1 BAC F9K23 genomic sequence, complete
             sequence
          Length = 48891

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| ||||| || || || ||||| |  || ||||| ||||||| |||||
Sbjct: 42960 ccttgacaaagtttccaagagttttagtagatcctctggaagaagtaaagacatcatcaa 43019

                          
Query: 227   taccagcgaactg 239
             |||||||||||||
Sbjct: 43020 taccagcgaactg 43032

---

>gb|AC008051.3|F19C14 Sequence of BAC F19C14 from Arabidopsis thaliana chromosome 1,
           complete sequence
          Length = 86014

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                       
Query: 167 ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
           ||||||| ||||| ||||| || || || ||||| |  || ||||| ||||||| |||||
Sbjct: 66  ccttgacaaagtttccaagagttttagtagatcctctggaagaagtaaagacatcatcaa 125

                        
Query: 227 taccagcgaactg 239
           |||||||||||||
Sbjct: 126 taccagcgaactg 138

---

>dbj|AB077822.1| Arabidopsis thaliana genomic DNA, chromosome 1, P1 clone:X7J, complete
             sequence
          Length = 77636

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 61/73 (83%)
 Strand = Plus / Minus

                                                                         
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagacatnatcaa 226
             ||||||| ||||| ||||| || || || ||||| |  || ||||| ||||||| |||||
Sbjct: 18364 ccttgacaaagtttccaagagttttagtagatcctctggaagaagtaaagacatcatcaa 18305

                          
Query: 227   taccagcgaactg 239
             |||||||||||||
Sbjct: 18304 taccagcgaactg 18292

---

>dbj|AP003745.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1123_B01
          Length = 105736

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                  
Query: 167    ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagac 218
              ||||||| |||||||  |||||||||||||| ||||| || || ||||||||
Sbjct: 102303 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagac 102252

---

>dbj|AP004349.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0684A03
          Length = 64705

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 167   ccttgacnaagttgccaagggtcttggtggatccacgcgaggaagtgaagac 218
             ||||||| |||||||  |||||||||||||| ||||| || || ||||||||
Sbjct: 13624 ccttgacgaagttgctgagggtcttggtggagccacgtgacgaggtgaagac 13573

---

>emb|BX053311.1|CNS09DAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 91  gtcggcgaactcctggtacggggtcttg 118

---

>emb|BX053310.1|CNS09DAQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 813 gtcggcgaactcctggtacggggtcttg 786

---

>emb|BX018548.1|CNS08MH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 208 gtcggcgaactcctggtacggggtcttg 235

---

>emb|BX071943.1|CNS09ROB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 198 gtcggcgaactcctggtacggggtcttg 225

---

>emb|BX071942.1|CNS09ROA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 826 gtcggcgaactcctggtacggggtcttg 799

---

>emb|BX071917.1|CNS09RNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 198 gtcggcgaactcctggtacggggtcttg 225

---

>emb|BX071916.1|CNS09RNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 820 gtcggcgaactcctggtacggggtcttg 793

---

>emb|BX071881.1|CNS09RML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 723 gtcggcgaactcctggtacggggtcttg 696

---

>emb|BX071859.1|CNS09RLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 157 gtcggcgaactcctggtacggggtcttg 184

---

>emb|BX071858.1|CNS09RLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 802 gtcggcgaactcctggtacggggtcttg 775

---

>emb|BX071840.1|CNS09RLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 174 gtcggcgaactcctggtacggggtcttg 201

---

>emb|BX071839.1|CNS09RLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 813 gtcggcgaactcctggtacggggtcttg 786

---

>emb|BX071831.1|CNS09RL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 199 gtcggcgaactcctggtacggggtcttg 226

---

>emb|BX071830.1|CNS09RL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 823 gtcggcgaactcctggtacggggtcttg 796

---

>emb|BX071825.1|CNS09RL1 Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 3-PRIME end
          of clone FK0AAC9CA12 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 284

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 69 gtcggngaactcctggtacggagtcttg 96
          ||||| ||||||||||||||| ||||||
Sbjct: 22 gtcggcgaactcctggtacggggtcttg 49

---

>emb|BX071824.1|CNS09RL0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 740 gtcggcgaactcctggtacggggtcttg 713

---

>emb|BX071803.1|CNS09RKF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 199 gtcggcgaactcctggtacggggtcttg 226

---

>emb|BX071637.1|CNS09RFT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 724

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 182 gtcggcgaactcctggtacggggtcttg 209

---

>emb|BX071158.1|CNS09R2I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 573

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 185 gtcggcgaactcctggtacggggtcttg 212

---

>emb|BX071130.1|CNS09R1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 154 gtcggcgaactcctggtacggggtcttg 181

---

>emb|BX071129.1|CNS09R1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX071127.1|CNS09R1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 190 gtcggcgaactcctggtacggggtcttg 217

---

>emb|BX071126.1|CNS09R1M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 827 gtcggcgaactcctggtacggggtcttg 800

---

>emb|BX071354.1|CNS09R7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 165 gtcggcgaactcctggtacggggtcttg 192

---

>emb|BX071353.1|CNS09R7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 791 gtcggcgaactcctggtacggggtcttg 764

---

>emb|BX070994.1|CNS09QXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 187 gtcggcgaactcctggtacggggtcttg 214

---

>emb|BX070993.1|CNS09QXX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 799 gtcggcgaactcctggtacggggtcttg 772

---

>emb|BX070950.1|CNS09QWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 111 gtcggcgaactcctggtacggggtcttg 138

---

>emb|BX070846.1|CNS09QTU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 112 gtcggcgaactcctggtacggggtcttg 139

---

>emb|BX070845.1|CNS09QTT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 724 gtcggcgaactcctggtacggggtcttg 697

---

>emb|BX070740.1|CNS09QQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 807 gtcggcgaactcctggtacggggtcttg 780

---

>emb|BX070706.1|CNS09QPY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 159 gtcggcgaactcctggtacggggtcttg 186

---

>emb|BX070705.1|CNS09QPX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 807 gtcggcgaactcctggtacggggtcttg 780

---

>emb|BX070571.1|CNS09QM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX070283.1|CNS09QE7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 180 gtcggcgaactcctggtacggggtcttg 207

---

>emb|BX070282.1|CNS09QE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 812 gtcggcgaactcctggtacggggtcttg 785

---

>emb|BX070250.1|CNS09QDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 174 gtcggcgaactcctggtacggggtcttg 201

---

>emb|BX070249.1|CNS09QD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 674 gtcggcgaactcctggtacggggtcttg 647

---

>emb|BX070108.1|CNS09Q9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 172 gtcggcgaactcctggtacggggtcttg 199

---

>emb|BX069976.1|CNS09Q5O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 190 gtcggcgaactcctggtacggggtcttg 217

---

>emb|BX069935.1|CNS09Q4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 172 gtcggcgaactcctggtacggggtcttg 199

---

>emb|BX069934.1|CNS09Q4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 830 gtcggcgaactcctggtacggggtcttg 803

---

>emb|BX069931.1|CNS09Q4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 171 gtcggcgaactcctggtacggggtcttg 198

---

>emb|BX069930.1|CNS09Q4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 809 gtcggcgaactcctggtacggggtcttg 782

---

>emb|BX069899.1|CNS09Q3J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 174 gtcggcgaactcctggtacggggtcttg 201

---

>emb|BX069898.1|CNS09Q3I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 787 gtcggcgaactcctggtacggggtcttg 760

---

>emb|BX069635.1|CNS09PW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 748 gtcggcgaactcctggtacggggtcttg 721

---

>emb|BX061069.1|CNS09JA9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 204 gtcggcgaactcctggtacggggtcttg 231

---

>emb|BX061068.1|CNS09JA8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 819 gtcggcgaactcctggtacggggtcttg 792

---

>emb|BX061021.1|CNS09J8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 179 gtcggcgaactcctggtacggggtcttg 206

---

>emb|BX061020.1|CNS09J8W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 814 gtcggcgaactcctggtacggggtcttg 787

---

>emb|BX061001.1|CNS09J8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 159 gtcggcgaactcctggtacggggtcttg 186

---

>emb|BX061000.1|CNS09J8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 798 gtcggcgaactcctggtacggggtcttg 771

---

>emb|BX069525.1|CNS09PT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 375

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 162 gtcggcgaactcctggtacggggtcttg 189

---

>emb|BX069438.1|CNS09PQQ Single read from an extremity of a full-length cDNA clone made
          from Anopheles gambiae total adult females. 3-PRIME end
          of clone FK0AAC6AD10 of strain 6-9 of Anopheles gambiae
          (African malaria mosquito)
          Length = 585

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 69 gtcggngaactcctggtacggagtcttg 96
          ||||| ||||||||||||||| ||||||
Sbjct: 15 gtcggcgaactcctggtacggggtcttg 42

---

>emb|BX069321.1|CNS09PNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 438

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 207 gtcggcgaactcctggtacggggtcttg 234

---

>emb|BX069320.1|CNS09PNG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 755 gtcggcgaactcctggtacggggtcttg 728

---

>emb|BX069159.1|CNS09PIZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 183 gtcggcgaactcctggtacggggtcttg 210

---

>emb|BX069158.1|CNS09PIY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX069055.1|CNS09PG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 176 gtcggcgaactcctggtacggggtcttg 203

---

>emb|BX069054.1|CNS09PG2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 813 gtcggcgaactcctggtacggggtcttg 786

---

>emb|BX068864.1|CNS09PAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 198 gtcggcgaactcctggtacggggtcttg 225

---

>emb|BX068863.1|CNS09PAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 833 gtcggcgaactcctggtacggggtcttg 806

---

>emb|BX068807.1|CNS09P97 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 733 gtcggcgaactcctggtacggggtcttg 706

---

>emb|BX068766.1|CNS09P82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 722 gtcggcgaactcctggtacggggtcttg 695

---

>emb|BX068578.1|CNS09P2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 168 gtcggcgaactcctggtacggggtcttg 195

---

>emb|BX068577.1|CNS09P2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 805 gtcggcgaactcctggtacggggtcttg 778

---

>emb|BX068555.1|CNS09P27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 179 gtcggcgaactcctggtacggggtcttg 206

---

>emb|BX068552.1|CNS09P24 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 528

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 142 gtcggcgaactcctggtacggggtcttg 169

---

>emb|BX068466.1|CNS09OZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 181 gtcggcgaactcctggtacggggtcttg 208

---

>emb|BX068465.1|CNS09OZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 805 gtcggcgaactcctggtacggggtcttg 778

---

>emb|BX068411.1|CNS09OY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 822 gtcggcgaactcctggtacggggtcttg 795

---

>emb|BX068251.1|CNS09OTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 180 gtcggcgaactcctggtacggggtcttg 207

---

>emb|BX068250.1|CNS09OTQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX068238.1|CNS09OTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 207 gtcggcgaactcctggtacggggtcttg 234

---

>emb|BX068237.1|CNS09OTD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1067

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 828 gtcggcgaactcctggtacggggtcttg 801

---

>emb|BX068218.1|CNS09OSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 403

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX068122.1|CNS09OQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 199 gtcggcgaactcctggtacggggtcttg 226

---

>emb|BX068121.1|CNS09OQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 824 gtcggcgaactcctggtacggggtcttg 797

---

>emb|BX068087.1|CNS09OP7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 200 gtcggcgaactcctggtacggggtcttg 227

---

>emb|BX068086.1|CNS09OP6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX067992.1|CNS09OMK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 182 gtcggcgaactcctggtacggggtcttg 209

---

>emb|BX067991.1|CNS09OMJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 825 gtcggcgaactcctggtacggggtcttg 798

---

>emb|BX067780.1|CNS09OGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX067716.1|CNS09OEW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 177 gtcggcgaactcctggtacggggtcttg 204

---

>emb|BX067715.1|CNS09OEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 808 gtcggcgaactcctggtacggggtcttg 781

---

>emb|BX067694.1|CNS09OEA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 184 gtcggcgaactcctggtacggggtcttg 211

---

>emb|BX067693.1|CNS09OE9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 810 gtcggcgaactcctggtacggggtcttg 783

---

>emb|BX067671.1|CNS09ODN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 623

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 173 gtcggcgaactcctggtacggggtcttg 200

---

>emb|BX067652.1|CNS09OD4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 109 gtcggcgaactcctggtacggggtcttg 136

---

>emb|BX067651.1|CNS09OD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 767 gtcggcgaactcctggtacggggtcttg 740

---

>emb|BX067510.1|CNS09O96 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 166 gtcggcgaactcctggtacggggtcttg 193

---

>emb|BX067509.1|CNS09O95 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 814 gtcggcgaactcctggtacggggtcttg 787

---

>emb|BX067320.1|CNS09O3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 185 gtcggcgaactcctggtacggggtcttg 212

---

>emb|BX067319.1|CNS09O3V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX067058.1|CNS09NWM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 523

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 119 gtcggcgaactcctggtacggggtcttg 146

---

>emb|BX067057.1|CNS09NWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 806 gtcggcgaactcctggtacggggtcttg 779

---

>emb|BX067005.1|CNS09NV5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 192 gtcggcgaactcctggtacggggtcttg 219

---

>emb|BX067004.1|CNS09NV4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 829 gtcggcgaactcctggtacggggtcttg 802

---

>emb|BX066997.1|CNS09NUX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 154 gtcggcgaactcctggtacggggtcttg 181

---

>emb|BX066996.1|CNS09NUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 681 gtcggcgaactcctggtacggggtcttg 654

---

>emb|BX066975.1|CNS09NUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 531

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 114 gtcggcgaactcctggtacggggtcttg 141

---

>emb|BX066965.1|CNS09NU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX066964.1|CNS09NU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX066801.1|CNS09NPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 148 gtcggcgaactcctggtacggggtcttg 175

---

>emb|BX066800.1|CNS09NPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 823 gtcggcgaactcctggtacggggtcttg 796

---

>emb|BX066799.1|CNS09NPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 208 gtcggcgaactcctggtacggggtcttg 235

---

>emb|BX066798.1|CNS09NPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 827 gtcggcgaactcctggtacggggtcttg 800

---

>emb|BX066700.1|CNS09NMO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 355

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 180 gtcggcgaactcctggtacggggtcttg 207

---

>emb|BX066616.1|CNS09NKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 207 gtcggcgaactcctggtacggggtcttg 234

---

>emb|BX066615.1|CNS09NKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 821 gtcggcgaactcctggtacggggtcttg 794

---

>emb|BX066524.1|CNS09NHS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 160 gtcggcgaactcctggtacggggtcttg 187

---

>emb|BX066523.1|CNS09NHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 811 gtcggcgaactcctggtacggggtcttg 784

---

>emb|BX066334.1|CNS09NCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 820 gtcggcgaactcctggtacggggtcttg 793

---

>emb|BX066328.1|CNS09NCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX066327.1|CNS09NCB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 658 gtcggcgaactcctggtacggggtcttg 631

---

>emb|BX066316.1|CNS09NC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 197 gtcggcgaactcctggtacggggtcttg 224

---

>emb|BX066315.1|CNS09NBZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 811 gtcggcgaactcctggtacggggtcttg 784

---

>emb|BX066258.1|CNS09NAE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 433

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 182 gtcggcgaactcctggtacggggtcttg 209

---

>emb|BX066159.1|CNS09N7N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 201 gtcggcgaactcctggtacggggtcttg 228

---

>emb|BX066158.1|CNS09N7M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 818 gtcggcgaactcctggtacggggtcttg 791

---

>emb|BX065928.1|CNS09N18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 396

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 88  gtcggcgaactcctggtacggggtcttg 115

---

>emb|BX065829.1|CNS09MYH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 177 gtcggcgaactcctggtacggggtcttg 204

---

>emb|BX065425.1|CNS09MN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 169 gtcggcgaactcctggtacggggtcttg 196

---

>emb|BX065378.1|CNS09MLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 175 gtcggcgaactcctggtacggggtcttg 202

---

>emb|BX065377.1|CNS09MLX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 794 gtcggcgaactcctggtacggggtcttg 767

---

>emb|BX065216.1|CNS09MHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 553

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 87  gtcggcgaactcctggtacggggtcttg 114

---

>emb|BX065215.1|CNS09MHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 481 gtcggcgaactcctggtacggggtcttg 454

---

>emb|BX065114.1|CNS09MEM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 456

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 179 gtcggcgaactcctggtacggggtcttg 206

---

>emb|BX065102.1|CNS09MEA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 197 gtcggcgaactcctggtacggggtcttg 224

---

>emb|BX065101.1|CNS09ME9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 826 gtcggcgaactcctggtacggggtcttg 799

---

>emb|BX065094.1|CNS09ME2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX065093.1|CNS09ME1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 812 gtcggcgaactcctggtacggggtcttg 785

---

>emb|BX064907.1|CNS09M8V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 805 gtcggcgaactcctggtacggggtcttg 778

---

>emb|BX064904.1|CNS09M8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 271

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 166 gtcggcgaactcctggtacggggtcttg 193

---

>emb|BX064850.1|CNS09M7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 193 gtcggcgaactcctggtacggggtcttg 220

---

>emb|BX064849.1|CNS09M79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 802 gtcggcgaactcctggtacggggtcttg 775

---

>emb|BX064749.1|CNS09M4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 638

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 174 gtcggcgaactcctggtacggggtcttg 201

---

>emb|BX064686.1|CNS09M2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 815 gtcggcgaactcctggtacggggtcttg 788

---

>emb|BX064669.1|CNS09M29 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 817 gtcggcgaactcctggtacggggtcttg 790

---

>emb|BX064424.1|CNS09LVG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 214 gtcggcgaactcctggtacggggtcttg 241

---

>emb|BX064400.1|CNS09LUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 830 gtcggcgaactcctggtacggggtcttg 803

---

>emb|BX064371.1|CNS09LTZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 174 gtcggcgaactcctggtacggggtcttg 201

---

>emb|BX064370.1|CNS09LTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 807 gtcggcgaactcctggtacggggtcttg 780

---

>emb|BX064322.1|CNS09LSM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 173 gtcggcgaactcctggtacggggtcttg 200

---

>emb|BX064321.1|CNS09LSL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 809 gtcggcgaactcctggtacggggtcttg 782

---

>emb|BX064305.1|CNS09LS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 208 gtcggcgaactcctggtacggggtcttg 235

---

>emb|BX064304.1|CNS09LS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 828 gtcggcgaactcctggtacggggtcttg 801

---

>emb|BX064281.1|CNS09LRH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 196 gtcggcgaactcctggtacggggtcttg 223

---

>emb|BX064280.1|CNS09LRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 830 gtcggcgaactcctggtacggggtcttg 803

---

>emb|BX064099.1|CNS09LMF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 187 gtcggcgaactcctggtacggggtcttg 214

---

>emb|BX064073.1|CNS09LLP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 177 gtcggcgaactcctggtacggggtcttg 204

---

>emb|BX063980.1|CNS09LJ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 191 gtcggcgaactcctggtacggggtcttg 218

---

>emb|BX063911.1|CNS09LH7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 180 gtcggcgaactcctggtacggggtcttg 207

---

>emb|BX063910.1|CNS09LH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 811 gtcggcgaactcctggtacggggtcttg 784

---

>emb|BX063899.1|CNS09LGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 193 gtcggcgaactcctggtacggggtcttg 220

---

>emb|BX063898.1|CNS09LGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 822 gtcggcgaactcctggtacggggtcttg 795

---

>emb|BX063789.1|CNS09LDT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 522

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 200 gtcggcgaactcctggtacggggtcttg 227

---

>emb|BX063788.1|CNS09LDS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 874 gtcggcgaactcctggtacggggtcttg 847

---

>emb|BX063668.1|CNS09LAG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 413

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 181 gtcggcgaactcctggtacggggtcttg 208

---

>emb|BX063445.1|CNS09L49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 171 gtcggcgaactcctggtacggggtcttg 198

---

>emb|BX063444.1|CNS09L48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 808 gtcggcgaactcctggtacggggtcttg 781

---

>emb|BX063405.1|CNS09L35 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 164 gtcggcgaactcctggtacggggtcttg 191

---

>emb|BX063404.1|CNS09L34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 789 gtcggcgaactcctggtacggggtcttg 762

---

>emb|BX063337.1|CNS09L19 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 156 gtcggcgaactcctggtacggggtcttg 183

---

>emb|BX063336.1|CNS09L18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 789 gtcggcgaactcctggtacggggtcttg 762

---

>emb|BX063242.1|CNS09KYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 190 gtcggcgaactcctggtacggggtcttg 217

---

>emb|BX063241.1|CNS09KYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 819 gtcggcgaactcctggtacggggtcttg 792

---

>emb|BX063113.1|CNS09KV1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 134 gtcggcgaactcctggtacggggtcttg 161

---

>emb|BX063086.1|CNS09KUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 182 gtcggcgaactcctggtacggggtcttg 209

---

>emb|BX063085.1|CNS09KU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 808 gtcggcgaactcctggtacggggtcttg 781

---

>emb|BX063054.1|CNS09KTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 182 gtcggcgaactcctggtacggggtcttg 209

---

>emb|BX063034.1|CNS09KSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 399

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 127 gtcggcgaactcctggtacggggtcttg 154

---

>emb|BX062964.1|CNS09KQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 589

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 218 gtcggcgaactcctggtacggggtcttg 245

---

>emb|BX062963.1|CNS09KQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 827 gtcggcgaactcctggtacggggtcttg 800

---

>emb|BX062808.1|CNS09KMK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 255

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 182 gtcggcgaactcctggtacggggtcttg 209

---

>emb|BX062697.1|CNS09KJH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 146

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 95  gtcggcgaactcctggtacggggtcttg 122

---

>emb|BX062603.1|CNS09KGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 185 gtcggcgaactcctggtacggggtcttg 212

---

>emb|BX062602.1|CNS09KGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 727 gtcggcgaactcctggtacggggtcttg 700

---

>emb|BX062565.1|CNS09KFT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 380

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 184 gtcggcgaactcctggtacggggtcttg 211

---

>emb|BX062564.1|CNS09KFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 803 gtcggcgaactcctggtacggggtcttg 776

---

>emb|BX062379.1|CNS09KAN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 171 gtcggcgaactcctggtacggggtcttg 198

---

>emb|BX062378.1|CNS09KAM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 805 gtcggcgaactcctggtacggggtcttg 778

---

>emb|BX062182.1|CNS09K56 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 158 gtcggcgaactcctggtacggggtcttg 185

---

>emb|BX062181.1|CNS09K55 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 815 gtcggcgaactcctggtacggggtcttg 788

---

>emb|BX062144.1|CNS09K44 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 439

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 179 gtcggcgaactcctggtacggggtcttg 206

---

>emb|BX061931.1|CNS09JY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 186 gtcggcgaactcctggtacggggtcttg 213

---

>emb|BX061930.1|CNS09JY6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 829 gtcggcgaactcctggtacggggtcttg 802

---

>emb|BX061919.1|CNS09JXV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 673

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 186 gtcggcgaactcctggtacggggtcttg 213

---

>emb|BX061918.1|CNS09JXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 810 gtcggcgaactcctggtacggggtcttg 783

---

>emb|BX061843.1|CNS09JVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 201 gtcggcgaactcctggtacggggtcttg 228

---

>emb|BX061842.1|CNS09JVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 822 gtcggcgaactcctggtacggggtcttg 795

---

>emb|BX061792.1|CNS09JUC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 176 gtcggcgaactcctggtacggggtcttg 203

---

>emb|BX061791.1|CNS09JUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 823 gtcggcgaactcctggtacggggtcttg 796

---

>emb|BX061702.1|CNS09JRU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 805 gtcggcgaactcctggtacggggtcttg 778

---

>emb|BX061681.1|CNS09JR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 600

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 178 gtcggcgaactcctggtacggggtcttg 205

---

>emb|BX061680.1|CNS09JR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 824 gtcggcgaactcctggtacggggtcttg 797

---

>emb|BX061669.1|CNS09JQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 69  gtcggngaactcctggtacggagtcttg 96
           ||||| ||||||||||||||| ||||||
Sbjct: 201 gtcggcgaactcctggtacggggtcttg 228


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,249,596
Number of Sequences: 3902068
Number of extensions: 1249596
Number of successful extensions: 17933
Number of sequences better than 10.0: 865
Number of HSP's better than 10.0 without gapping: 866
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17049
Number of HSP's gapped (non-prelim): 884
length of query: 248
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 226
effective length of database: 17,147,199,772
effective search space: 3875267148472
effective search space used: 3875267148472
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---