ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags7e13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds 581 e-163
2gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome... 531 e-148
3gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome... 531 e-148
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 531 e-148
5dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clon... 531 e-148
6ref|XM_475383.1| Oryza sativa (japonica cultivar-group), predic... 527 e-146
7emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4,... 527 e-146
8dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 527 e-146
9dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clon... 527 e-146
10gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome... 523 e-145
11gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome... 523 e-145
12dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clon... 523 e-145
13gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence 521 e-145
14dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 521 e-145
15dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic D... 521 e-145
16dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic D... 521 e-145
17ref|XM_475394.1| Oryza sativa (japonica cultivar-group), predic... 519 e-144
18ref|XM_473659.1| Oryza sativa (japonica cultivar-group), predic... 515 e-143
19gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), c... 513 e-142
20ref|XM_467181.1| Oryza sativa (japonica cultivar-group), mRNA 511 e-142
21dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 500 e-138
22dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 500 e-138
23dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic D... 500 e-138
24dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic D... 500 e-138
25emb|X00043.1|TAHI01 Wheat histone H4 gene 500 e-138
26dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clon... 500 e-138
27ref|NM_190485.1| Oryza sativa (japonica cultivar-group), predic... 496 e-137
28gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full i... 494 e-136
29ref|NM_185758.1| Oryza sativa (japonica cultivar-group), mRNA 492 e-136
30gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence 486 e-134
31emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene 476 e-131
32gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome... 474 e-130
33dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 474 e-130
34dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic D... 474 e-130
35dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic D... 474 e-130
36dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clon... 474 e-130
37ref|NM_187563.1| Oryza sativa (japonica cultivar-group), predic... 472 e-130
38gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 472 e-130
39dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
40gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome... 472 e-130
41dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clon... 472 e-130
42ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone ... 456 e-125
43gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 geno... 456 e-125
44gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 geno... 456 e-125
45dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 456 e-125
46dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 456 e-125
47dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clon... 456 e-125
48gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 456 e-125
49emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4 448 e-123
50gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), com... 432 e-118
51gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds 432 e-118
52gb|AY105603.1| Zea mays PCO094685 mRNA sequence 426 e-116
53ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal... 400 e-108
54ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal... 400 e-108
55ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal... 400 e-108
56ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal... 400 e-108
57ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal... 391 e-105
58ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal... 387 e-104
59ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal... 383 e-103
60gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence 379 e-102
61ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal... 377 e-101
62gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence 371 2e-99
63ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal... 371 2e-99
64gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H... 363 4e-97
65ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC4... 363 4e-97
66ref|NM_001037843.1| Gallus gallus similar to germinal histone H4... 363 4e-97
67gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds 363 4e-97
68ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal hi... 357 2e-95
69ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 357 2e-95
70emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 357 2e-95
71ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA 355 9e-95
72ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal hi... 355 9e-95
73emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 355 9e-95
74emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 355 9e-95
75gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 355 9e-95
76ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p... 355 9e-95
77gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, compl... 355 9e-95
78gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds 355 9e-95
79ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal... 351 1e-93
80ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 347 2e-92
81emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 347 2e-92
82dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-... 341 1e-90
83gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complet... 341 1e-90
84gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 ... 339 5e-90
85gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 339 5e-90
86gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 339 5e-90
87ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal... 337 2e-89
88ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA 333 3e-88
89gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA... 333 3e-88
90gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA... 333 3e-88
91gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 333 3e-88
92emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 333 3e-88
93gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC... 333 3e-88
94dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKE... 333 3e-88
95gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, compl... 333 3e-88
96ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA 327 2e-86
97gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, compl... 327 2e-86
98emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12) 325 8e-86
99ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA 323 3e-85
100emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 323 3e-85
101ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA 323 3e-85
102gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, compl... 323 3e-85
103gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, compl... 323 3e-85
104gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 323 3e-85
105emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 317 2e-83
106dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 317 2e-83
107gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 317 2e-83
108ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA 317 2e-83
109ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA 317 2e-83
110gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, compl... 317 2e-83
111gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, compl... 317 2e-83
112gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, compl... 317 2e-83
113ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA 317 2e-83
114gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8 317 2e-83
115gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA ... 315 8e-83
116ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (His... 315 8e-83
117gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA,... 315 8e-83
118gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 315 8e-83
119gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC... 309 5e-81
120emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 309 5e-81
121gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC... 309 5e-81
122ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA 309 5e-81
123dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-... 309 5e-81
124gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, compl... 309 5e-81
125gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds 305 8e-80
126ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA 303 3e-79
127gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, compl... 303 3e-79
128gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 301 1e-78
129dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIK... 301 1e-78
130emb|X13236.1|MMHIS453 Mouse histone H4 gene 299 5e-78
131ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histo... 297 2e-77
132gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:818... 297 2e-77
133gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds 297 2e-77
134ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (pr... 295 7e-77
135ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histo... 289 4e-75
136gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408 287 2e-74
137ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 287 2e-74
138ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA 287 2e-74
139ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA 287 2e-74
140ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal his... 287 2e-74
141gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, comp... 287 2e-74
142gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, comp... 287 2e-74
143gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 287 2e-74
144emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA 287 2e-74
145emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 287 2e-74
146emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone 287 2e-74
147emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone 287 2e-74
148gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, ... 287 2e-74
149gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, comple... 287 2e-74
150gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 287 2e-74
151gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA cl... 287 2e-74
152ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA 287 2e-74
153gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence 283 3e-73
154emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA 281 1e-72
155emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA 281 1e-72
156gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, c... 280 4e-72
157emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.... 278 2e-71
158dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 274 3e-70
159gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA... 272 1e-69
160emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4 272 1e-69
161ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA 272 1e-69
162gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, comple... 272 1e-69
163gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 272 1e-69
164gb|AY104535.1| Zea mays PCO094675 mRNA sequence 272 1e-69
165gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 272 1e-69
166gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG... 272 1e-69
167gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 268 2e-68
168gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 268 2e-68
169ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H... 264 3e-67
170emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA 264 3e-67
171dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-1932... 262 1e-66
172gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 260 4e-66
173gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, comp... 260 4e-66
174gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 260 4e-66
175emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o... 260 4e-66
176emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblas... 260 4e-66
177gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete... 260 4e-66
178gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 260 4e-66
179ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA 260 4e-66
180gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC... 260 4e-66
181ref|NG_000827.2| Homo sapiens genomic histone family microcluste... 260 4e-66
182ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA 260 4e-66
183gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histon... 260 4e-66
184dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds 260 4e-66
185gb|AY389612.1| Hyacinthus orientalis unknown mRNA 258 2e-65
186emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes ... 256 6e-65
187ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (pre... 244 2e-61
188ref|NM_001016869.2| Xenopus tropicalis hypothetical protein LOC5... 242 9e-61
189emb|CR848633.2| Xenopus tropicalis finished cDNA, clone TGas006m08 242 9e-61
190dbj|AB197150.1| Fragaria x ananassa mRNA for histone H4, partial... 240 4e-60
191emb|X00091.1|HSHISH4 Human histone H4 gene 240 4e-60
192ref|NG_001335.1| Homo sapiens genomic large histone family clust... 238 1e-59
193ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA 238 1e-59
194gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, comp... 238 1e-59
195gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 238 1e-59
196gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 238 1e-59
197gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 238 1e-59
198gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 238 1e-59
199gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC... 238 1e-59
200ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal... 232 9e-58
201ref|XM_595302.1| PREDICTED: Bos taurus similar to germinal histo... 230 4e-57
202emb|X00224.1|XLHIS4 Xenopus laevis H4 histone gene and flanking ... 230 4e-57
203emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone 230 4e-57
204emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes 226 6e-56
205emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 224 2e-55
206gb|BC078038.1| Xenopus laevis histone 1, H4l, mRNA (cDNA clone M... 222 9e-55
207ref|XM_604220.1| PREDICTED: Bos taurus similar to germinal histo... 222 9e-55
208gb|AC150544.3| Bos taurus BAC CH240-75C8 (Children's Hospital O... 222 9e-55
209emb|X13554.1|RNH4G Rat H4 gene for somatic histone H4 220 3e-54
210ref|XM_578415.1| PREDICTED: Rattus norvegicus similar to germina... 220 3e-54
211ref|XM_602616.1| PREDICTED: Bos taurus similar to germinal histo... 214 2e-52
212gb|J00987.1|XELHIS4LB x.laevis histone gene h4 and flanks 214 2e-52
213ref|XM_950909.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)... 212 8e-52
214ref|XM_328072.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)... 212 8e-52
215emb|CR542172.1| Homo sapiens full open reading frame cDNA clone ... 212 8e-52
216ref|NM_003546.2| Homo sapiens histone 1, H4l (HIST1H4L), mRNA 210 3e-51
217gb|AY128665.1| Homo sapiens clone HIST1H4L histone H4 gene, comp... 210 3e-51
218emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o... 210 3e-51
219emb|X83548.1|HSHISTN4 H.sapiens gene for histone H4 210 3e-51
220emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 210 3e-51
221gb|BC069392.1| Homo sapiens histone 1, H4l, mRNA (cDNA clone MGC... 210 3e-51
222ref|XM_575704.1| PREDICTED: Rattus norvegicus similar to germina... 210 3e-51
223gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140 206 5e-50
224ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA 206 5e-50
225ref|XM_513765.1| PREDICTED: Pan troglodytes LOC457262 (LOC457262... 206 5e-50
226ref|NM_001034077.3| Homo sapiens histone H4/o (H4/o), mRNA 206 5e-50
227gb|AF525682.1| Homo sapiens histone H4 (HIST2H4) gene, complete cds 206 5e-50
228gb|BC112193.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1... 206 5e-50
229emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 206 5e-50
230emb|BX061454.1|CNS09JKY Single read from an extremity of a full-... 206 5e-50
231emb|BX057867.1|CNS09GTB Single read from an extremity of a full-... 206 5e-50
232emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-... 206 5e-50
233emb|BX048034.1|CNS09986 Single read from an extremity of a full-... 206 5e-50
234emb|BX037780.1|CNS091BC Single read from an extremity of a full-... 206 5e-50
235emb|BX037779.1|CNS091BB Single read from an extremity of a full-... 206 5e-50
236emb|BX020583.1|CNS08O1N Single read from an extremity of a full-... 206 5e-50
237emb|BX009114.1|CNS08F72 Single read from an extremity of a full-... 206 5e-50
238ref|XM_942850.1| PREDICTED: Homo sapiens similar to germinal his... 206 5e-50
239ref|XM_942844.1| PREDICTED: Homo sapiens similar to germinal his... 206 5e-50
240ref|XM_942841.1| PREDICTED: Homo sapiens similar to germinal his... 206 5e-50
241ref|XM_936503.1| PREDICTED: Homo sapiens similar to germinal his... 206 5e-50
242gb|BC093969.1| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:... 206 5e-50
243ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125 ... 206 5e-50
244gb|BC108260.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1... 206 5e-50
245ref|XM_601250.2| PREDICTED: Bos taurus similar to germinal histo... 204 2e-49
246ref|NM_173880.2| Bos taurus histone H4 (H4), mRNA 204 2e-49
247gb|AY890621.1| Synthetic construct Homo sapiens clone FLH141160.... 204 2e-49
248gb|AF001288.1|AF001288 Bos taurus histone H4.1 mRNA, complete cds 204 2e-49
249ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal ... 202 8e-49
250ref|XM_540284.1| PREDICTED: Canis familiaris similar to germinal... 202 8e-49
251ref|XM_527285.1| PREDICTED: Pan troglodytes similar to HIST1H3I ... 200 3e-48
252emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones 200 3e-48
253dbj|AK133404.1| Mus musculus adult male testis cDNA, RIKEN full-... 200 3e-48
254dbj|AK016178.1| Mus musculus adult male testis cDNA, RIKEN full-... 200 3e-48
255gb|AY893103.1| Synthetic construct Homo sapiens clone FLH141156.... 200 3e-48
256emb|X04652.1|MMHISH4S Mouse histone H4 gene 3' region with signa... 200 3e-48
257emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-... 198 1e-47
258emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-... 198 1e-47
259emb|BX039313.1|CNS092HX Single read from an extremity of a full-... 198 1e-47
260emb|BX032921.1|CNS08XKD Single read from an extremity of a full-... 198 1e-47
261ref|XM_315129.2| Anopheles gambiae str. PEST ENSANGP00000015255 ... 198 1e-47
262ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626 ... 198 1e-47
263gb|AY450353.1| Bos grunniens histone H4.1 mRNA, partial cds 194 2e-46
264emb|BX047203.1|CNS098L3 Single read from an extremity of a full-... 194 2e-46
265gb|AY389648.1| Hyacinthus orientalis histone H4 mRNA, complete cds 192 8e-46
266ref|XM_870205.1| PREDICTED: Bos taurus similar to germinal histo... 192 8e-46
267emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-... 192 8e-46
268emb|BX052400.1|CNS09CLG Single read from an extremity of a full-... 192 8e-46
269emb|BX043671.1|CNS095UZ Single read from an extremity of a full-... 192 8e-46
270gb|J00986.1|XELHIS4L xenopus laevis h4 histone mrna 192 8e-46
271gb|AY648850.1| Homo sapiens histone H4/o gene, complete cds 190 3e-45
272ref|XM_608100.2| PREDICTED: Bos taurus similar to germinal histo... 190 3e-45
273gb|AY128653.1| Homo sapiens clone HIST4H4 histone H4 gene, compl... 190 3e-45
274emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-... 190 3e-45
275emb|BX053099.1|CNS09D4V Single read from an extremity of a full-... 190 3e-45
276emb|BX054530.1|CNS09E8M Single read from an extremity of a full-... 190 3e-45
277emb|BX047092.1|CNS098I0 Single read from an extremity of a full-... 190 3e-45
278emb|BX036322.1|CNS0906U Single read from an extremity of a full-... 190 3e-45
279gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose... 190 3e-45
280ref|NM_175054.2| Homo sapiens histone 4, H4 (HIST4H4), mRNA 190 3e-45
281gb|DQ066258.1| Ixodes scapularis isolate ISN-L-157 hist1h4i prot... 190 3e-45
282gb|BC020884.1| Homo sapiens histone 4, H4, mRNA (cDNA clone MGC:... 190 3e-45
283gb|AF007904.1|CVHIST2 Chaetopterus variopedatus histone H4 and h... 190 3e-45
284ref|XM_322297.1| Neurospora crassa OR74A hypothetical protein ( ... 184 2e-43
285ref|XM_951504.1| Neurospora crassa OR74A hypothetical protein ( ... 184 2e-43
286emb|BX053377.1|CNS09DCL Single read from an extremity of a full-... 184 2e-43
287emb|X77806.1|PSHISTH4 P.salina histone H4 gene 184 2e-43
288emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 184 2e-43
289gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 184 2e-43
290emb|BX061530.1|CNS09JN2 Single read from an extremity of a full-... 182 8e-43
291emb|BX061455.1|CNS09JKZ Single read from an extremity of a full-... 182 8e-43
292emb|BX041120.1|CNS093W4 Single read from an extremity of a full-... 182 8e-43
293ref|XM_307600.2| Anopheles gambiae str. PEST ENSANGP00000016197 ... 182 8e-43
294gb|M16707.1|HUMHIS4 Human histone H4 gene, complete cds, clone F... 182 8e-43
295ref|XM_597168.2| PREDICTED: Bos taurus similar to germinal histo... 176 5e-41
296ref|XM_869215.1| PREDICTED: Bos taurus similar to germinal histo... 176 5e-41
297emb|AJ626748.1| Oikopleura dioica mRNA for histone H4.2 176 5e-41
298gb|J00985.1|XELHIS4B Xenopus borealis h4 histone mRNA 176 5e-41
299emb|X00038.1|HSHIH4 Human H4 histone gene 176 5e-41
300ref|XM_605779.2| PREDICTED: Bos taurus similar to germinal histo... 174 2e-40
301ref|XM_595652.2| PREDICTED: Bos taurus similar to germinal histo... 174 2e-40
302gb|AY559151.1| Truncatellina cylindrica histone H3 and histone H... 174 2e-40
303emb|BX057868.1|CNS09GTC Single read from an extremity of a full-... 174 2e-40
304emb|BX057964.1|CNS09GW0 Single read from an extremity of a full-... 170 3e-39
305emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi... 170 3e-39
306gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene... 170 3e-39
307emb|Z61847.1|HS59H5F H.sapiens CpG island DNA genomic Mse1 fragm... 168 1e-38
308gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 168 1e-38
309emb|BX032922.1|CNS08XKE Single read from an extremity of a full-... 167 4e-38
310emb|Z46226.1|HTHISH4 H.tubulosa gene encoding histone H4 167 4e-38
311emb|X01611.1|NCHISH4 Neurospora crassa DNA for histone H4 165 2e-37
312emb|AL670001.1|NCB14H13 Neurospora crassa DNA linkage group II B... 165 2e-37
313emb|AL670543.1|NCB7K22 Neurospora crassa DNA linkage group II BA... 165 2e-37
314gb|AY062173.1| Neurospora crassa histone H3 (hh3) and histone H4... 165 2e-37
315gb|AY062172.1| Neurospora crassa histone H4 (hh4-2) gene, comple... 165 2e-37
316emb|BX054531.1|CNS09E8N Single read from an extremity of a full-... 163 7e-37
317ref|XM_369778.1| Magnaporthe grisea 70-15 hypothetical protein (... 161 3e-36
318ref|XM_568101.1| Cryptococcus neoformans var. neoformans JEC21 h... 161 3e-36
319ref|XM_569504.1| Cryptococcus neoformans var. neoformans JEC21 h... 161 3e-36
320emb|AJ626751.1| Oikopleura dioica mRNA for histone H4.5 161 3e-36
321emb|AJ626750.1| Oikopleura dioica mRNA for histone H4.4 161 3e-36
322emb|AJ494855.1|ODI494855 Oikopleura dioica partial mRNA for hist... 161 3e-36
323ref|XM_871414.1| PREDICTED: Bos taurus similar to germinal histo... 159 1e-35
324ref|XM_865919.1| PREDICTED: Bos taurus similar to germinal histo... 159 1e-35
325ref|XM_594900.2| PREDICTED: Bos taurus similar to germinal histo... 159 1e-35
326emb|BX055407.1|CNS09EWZ Single read from an extremity of a full-... 159 1e-35
327emb|X52393.1|TCH3H4 Tigriopus californicus DNA for histone H3 an... 159 1e-35
328gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co... 159 1e-35
329ref|XM_653246.1| Aspergillus nidulans FGSC A4 histone H4 (AN0734... 157 4e-35
330emb|BX045468.1|CNS0978W Single read from an extremity of a full-... 157 4e-35
331emb|AJ626749.1| Oikopleura dioica mRNA for histone H4.3 157 4e-35
332dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 157 4e-35
333gb|AY559154.1| Columella edentula isolate 15 histone H3 and hist... 155 2e-34
334ref|NM_214550.1| Strongylocentrotus purpuratus late histone gene... 155 2e-34
335emb|X06641.1|SPH4L2 Strongylocentrotus purpuratus late histone g... 155 2e-34
336gb|BT015217.1| Drosophila melanogaster RE42129 full insert cDNA 153 7e-34
337ref|XM_385667.1| Gibberella zeae PH-1 chromosome 3 H4_NEUCR Hist... 153 7e-34
338gb|AF517877.1| Griffithsia japonica isolate Gj458 histone H4 pro... 153 7e-34
339emb|X97438.1|DMHISH4 D.melanogaster mRNA for histone H4 153 7e-34
340ref|NM_169593.1| Drosophila melanogaster Histone H4 replacement ... 153 7e-34
341ref|NM_169592.1| Drosophila melanogaster Histone H4 replacement ... 153 7e-34
342ref|NM_079628.2| Drosophila melanogaster Histone H4 replacement ... 153 7e-34
343gb|BT001842.1| Drosophila melanogaster RH52884 full insert cDNA 153 7e-34
344gb|AY936210.1| Rattus norvegicus pro-histogranin mRNA, complete cds 151 3e-33
345ref|XM_609250.2| PREDICTED: Bos taurus similar to germinal histo... 149 1e-32
346ref|XM_750626.1| Aspergillus fumigatus Af293 histone H4 (Afu2g13... 149 1e-32
347gb|AF361948.1| Eimeria tenella histone 4 (H4) gene, complete cds 149 1e-32
348gb|AF297469.1|AF297469 Schistosoma mansoni strain LE histone H4 ... 149 1e-32
349ref|XM_527602.1| PREDICTED: Pan troglodytes similar to germinal ... 147 4e-32
350ref|NM_003540.3| Homo sapiens histone 1, H4f (HIST1H4F), mRNA 147 4e-32
351gb|AY559153.1| Columella edentula isolate 48 histone H3 and hist... 147 4e-32
352gb|AY128659.1| Homo sapiens clone HIST1H4F histone H4 gene, comp... 147 4e-32
353emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o... 147 4e-32
354emb|X15142.1|PPHISH41 Physarum polycephalum H41 gene for histone... 147 4e-32
355emb|X00449.1|PPHI01 Physarum polycephalum histone H4 gene 147 4e-32
356ref|XM_687122.1| PREDICTED: Danio rerio similar to germinal hist... 147 4e-32
357gb|BC093765.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC... 147 4e-32
358gb|BC093763.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC... 147 4e-32
359gb|AC084653.1|CBRG45O14 Caenorhabditis briggsae cosmid G45O14, c... 147 4e-32
360ref|NM_214551.1| Strongylocentrotus purpuratus late histone gene... 147 4e-32
361gb|M60749.1|HUMHISAD Human histone H4 (H4) gene, complete cds 147 4e-32
362gb|BC069288.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC... 147 4e-32
363emb|X06639.1|SPH4L1 Strongylocentrotus purpuratus late histone g... 147 4e-32
364gb|AY675265.1| Canis familiaris histone H4 gene, partial cds 145 2e-31
365emb|AJ314735.1|CSP314735 Colletotrichum sp. partial H4 gene, exo... 145 2e-31
366emb|AJ314731.1|CAC314731 Colletotrichum acutatum partial H4 gene... 145 2e-31
367dbj|AB050889.1| Citrus jambhiri mRNA for histone H4, partial cds 145 2e-31
368ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ... 143 6e-31
369ref|XM_654938.1| Aspergillus nidulans FGSC A4 histone H4.2 (AN24... 143 6e-31
370ref|NM_003544.2| Homo sapiens histone 1, H4b (HIST1H4B), mRNA 143 6e-31
371gb|AY128655.1| Homo sapiens clone HIST1H4B histone H4 gene, comp... 143 6e-31
372emb|BX060420.1|CNS09IS8 Single read from an extremity of a full-... 143 6e-31
373emb|BX036319.1|CNS0906R Single read from an extremity of a full-... 143 6e-31
374gb|DQ445629.1| Giardia intestinalis strain WP clone 1267 histone... 143 6e-31
375emb|X67081.1|HSH4HIST H.sapiens histone H4 gene 143 6e-31
376gb|BC069467.1| Homo sapiens histone 1, H4b, mRNA (cDNA clone MGC... 143 6e-31
377gb|BC056868.1| Homo sapiens cDNA clone IMAGE:5194861 141 3e-30
378gb|BC012587.1| Homo sapiens histone 1, H4e, mRNA (cDNA clone MGC... 141 3e-30
379ref|XM_600437.2| PREDICTED: Bos taurus similar to germinal histo... 141 3e-30
380ref|NM_003545.3| Homo sapiens histone 1, H4e (HIST1H4E), mRNA 141 3e-30
381gb|AY128658.1| Homo sapiens clone HIST1H4E histone H4 gene, comp... 141 3e-30
382gb|AY128657.1| Homo sapiens clone HIST1H4D histone H4 gene, comp... 141 3e-30
383emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro... 141 3e-30
384emb|Z80787.1|HSH4J H.sapiens H4/j gene 141 3e-30
385emb|X60482.1|HSH4BHIS H.sapiens H4/b gene for H4 histone 141 3e-30
386emb|CR542180.1| Homo sapiens full open reading frame cDNA clone ... 141 3e-30
387ref|XM_703205.1| PREDICTED: Danio rerio similar to germinal hist... 141 3e-30
388ref|XM_681121.1| PREDICTED: Danio rerio similar to germinal hist... 141 3e-30
389gb|BC050615.1| Homo sapiens histone 1, H4e, mRNA (cDNA clone MGC... 141 3e-30
390ref|NM_003539.3| Homo sapiens histone 1, H4d (HIST1H4D), mRNA 139 1e-29
391emb|BX047204.1|CNS098L4 Single read from an extremity of a full-... 139 1e-29
392emb|X54078.1|TNHISTH4 T.nilotica gene for histone H4 139 1e-29
393emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ... 139 1e-29
394ref|XM_688078.1| PREDICTED: Danio rerio similar to germinal hist... 139 1e-29
395ref|NM_214548.1| Strongylocentrotus purpuratus late embryonic hi... 139 1e-29
396gb|AY675260.1| Gallus gallus histone H4 gene, partial cds 139 1e-29
397ref|XM_871249.1| PREDICTED: Bos taurus similar to germinal histo... 137 4e-29
398emb|X55549.1|ANH4GENE A.nidulans gene for core histone H4.1 137 4e-29
399emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 137 4e-29
400ref|XM_578442.1| PREDICTED: Rattus norvegicus similar to germina... 137 4e-29
401emb|Y18575.1|FTR18575 Flaveria trinervia mRNA for histone H4, cl... 137 4e-29
402gb|AY675263.1| Felis catus histone H4 gene, partial cds 137 4e-29
403emb|AJ314734.1|CSP314734 Colletotrichum sp. partial H4 gene, exo... 137 4e-29
404emb|AJ314733.1|CSP314733 Colletotrichum sp. partial H4 gene, exo... 137 4e-29
405emb|AJ314727.1|CSP314727 Colletotrichum sp. partial H4 gene, exo... 137 4e-29
406emb|AJ314724.1|CSP314724 Colletotrichum sp. partial H4 gene, exo... 137 4e-29
407emb|AJ314723.1|CAC314723 Colletotrichum acutatum partial H4 gene... 137 4e-29
408gb|U12630.1|ENU12630 Emericella nidulans R153 core histone H3 (H... 137 4e-29
409ref|XM_684085.1| PREDICTED: Danio rerio similar to germinal hist... 135 2e-28
410emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 135 2e-28
411emb|Y16588.1|PLY16588 Paracentrotus lividus histone H4 gene, ear... 135 2e-28
412emb|Y16587.1|PLY16587 Paracentrotus lividus histone H4 gene, par... 135 2e-28
413ref|XM_753764.1| Ustilago maydis 521 histone H4 (UM02710.1) part... 133 6e-28
414emb|X55550.1|ANH4GE A.nidulans gene for core histone H4.2 133 6e-28
415emb|X54115.1|SSH4H3 S.stimpsoni histone genes H4 and H3 133 6e-28
416gb|U12631.1|ENU12631 Emericella nidulans R153 core histone H4.2 ... 133 6e-28
417gb|AY559152.1| Columella edentula isolate 1 histone H3 and histo... 131 2e-27
418emb|BX039314.1|CNS092HY Single read from an extremity of a full-... 131 2e-27
419dbj|AB226260.1| Aspergillus oryzae cDNA, contig sequence: AoEST3119 131 2e-27
420ref|XM_684447.1| PREDICTED: Danio rerio similar to germinal hist... 131 2e-27
421ref|XM_682981.1| PREDICTED: Danio rerio similar to germinal hist... 131 2e-27
422ref|XM_701706.1| PREDICTED: Danio rerio similar to germinal hist... 131 2e-27
423ref|XM_677902.1| PREDICTED: Danio rerio similar to germinal hist... 131 2e-27
424emb|X97437.1|DMH4R D.melanogaster H4r gene 129 1e-26
425gb|AC007809.8|AC007809 Drosophila melanogaster, chromosome 3R, r... 129 1e-26
426gb|AY675264.1| Vulpes zerda histone H4 gene, partial cds 129 1e-26
427emb|AJ314730.1|CAC314730 Colletotrichum acutatum partial H4 gene... 129 1e-26
428emb|AJ314729.1|CAC314729 Colletotrichum acutatum partial H4 gene... 129 1e-26
429emb|AJ314725.1|CSP314725 Colletotrichum sp. partial H4 gene, exo... 129 1e-26
430gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43... 129 1e-26
431dbj|AB033943.1| Aspergillus oryzae mRNA for histone H4, complete... 129 1e-26
432ref|XM_518290.1| PREDICTED: Pan troglodytes similar to germinal ... 127 4e-26
433emb|BX047093.1|CNS098I1 Single read from an extremity of a full-... 127 4e-26
434ref|XM_702708.1| PREDICTED: Danio rerio similar to germinal hist... 125 2e-25
435ref|XM_680087.1| PREDICTED: Danio rerio similar to germinal hist... 125 2e-25
436gb|AY675279.1| Suricata suricatta histone H4 gene, partial cds 125 2e-25
437emb|BX052401.1|CNS09CLH Single read from an extremity of a full-... 123 6e-25
438emb|Z61848.1|HS59H5R H.sapiens CpG island DNA genomic Mse1 fragm... 123 6e-25
439gb|AY675269.1| Marmota monax histone H4 gene, partial cds 123 6e-25
440ref|XM_601239.2| PREDICTED: Bos taurus similar to germinal histo... 121 2e-24
441emb|BX069194.1|CNS09PJY Single read from an extremity of a full-... 121 2e-24
442emb|CR542189.1| Homo sapiens full open reading frame cDNA clone ... 121 2e-24
443dbj|D10397.1|RICT127 Oryza sativa mRNA for histone H4 (T127 gene... 121 2e-24
444gb|AY675272.1| Mus musculus histone H4 gene, partial cds 121 2e-24
445gb|J00189.1|HUMHIS4A2 human histone gene h4a segment 2 121 2e-24
446emb|Z73102.1|CEB0035 Caenorhabditis elegans Cosmid B0035, comple... 119 9e-24
447emb|Z82271.1|CEF54E12 Caenorhabditis elegans Cosmid F54E12, comp... 119 9e-24
448emb|CR542187.1| Homo sapiens full open reading frame cDNA clone ... 119 9e-24
449emb|AJ494848.1|ODI494848 Oikopleura dioica H3.1 gene, H4.1 gene,... 119 9e-24
450ref|NM_069738.1| Caenorhabditis elegans HIStone family member (h... 119 9e-24
451ref|NM_069732.1| Caenorhabditis elegans HIStone family member (h... 119 9e-24
452gb|M36923.1|PALH49A P.lividus H4 histone, clone h19 119 9e-24
453gb|M32426.1|SUSH4AA S.purpuratus H4 histone mRNA, complete cds 119 9e-24
454gb|AY559155.1| Pupilla muscorum histone H3 and histone H4 genes,... 117 4e-23
455gb|AY559147.1| Trichia villosa histone H3 and histone H4 genes, ... 117 4e-23
456emb|BX054266.1|CNS09E1A Single read from an extremity of a full-... 117 4e-23
457gb|BC010926.1| Homo sapiens histone 1, H4h, mRNA (cDNA clone MGC... 115 1e-22
458ref|XM_607251.2| PREDICTED: Bos taurus similar to germinal histo... 115 1e-22
459ref|NM_003543.3| Homo sapiens histone 1, H4h (HIST1H4H), mRNA 115 1e-22
460gb|AY128661.1| Homo sapiens clone HIST1H4H histone H4 gene, comp... 115 1e-22
461emb|AL021917.4|HS45P21 Human DNA sequence from clone RP1-45P21 o... 115 1e-22
462ref|XM_775791.1| PREDICTED: Strongylocentrotus purpuratus simila... 115 1e-22
463emb|BX066857.1|CNS09NR1 Single read from an extremity of a full-... 115 1e-22
464emb|X60487.1|HSH4HHIS H.sapiens H4/h gene for H4 histone 115 1e-22
465emb|CR542169.1| Homo sapiens full open reading frame cDNA clone ... 115 1e-22
466gb|AY064471.1| Aplysia californica histone H4 (His.H4) gene, com... 115 1e-22
467emb|AJ132597.1|DME132597 Drosophila melanogaster H4r gene,3'-fla... 115 1e-22
468ref|XM_384465.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 113 6e-22
469emb|X97436.1|DHHISH4 D.hydei mRNA for histone H4 113 6e-22
470emb|Z60156.1|HS191A4R H.sapiens CpG island DNA genomic Mse1 frag... 113 6e-22
471gb|AY675261.1| Coturnix japonica histone H4 gene, partial cds 113 6e-22
472emb|Z68336.1|CEF22B3 Caenorhabditis elegans Cosmid F22B3, comple... 111 2e-21
473emb|CR858191.1| Pongo pygmaeus mRNA; cDNA DKFZp469B0137 (from cl... 111 2e-21
474ref|XM_702905.1| PREDICTED: Danio rerio similar to germinal hist... 111 2e-21
475ref|XM_680378.1| PREDICTED: Danio rerio similar to germinal hist... 111 2e-21
476ref|NM_069753.2| Caenorhabditis elegans HIStone family member (h... 111 2e-21
477emb|Z63591.1|HS87F10F H.sapiens CpG island DNA genomic Mse1 frag... 111 2e-21
478emb|AJ314736.1|CSP314736 Colletotrichum sp. partial H4 gene, exo... 111 2e-21
479ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a... 109 9e-21
480ref|XM_871144.1| PREDICTED: Bos taurus similar to germinal histo... 109 9e-21
481dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 109 9e-21
482dbj|AB183301.1| Lactuca sativa LetH4 mRNA for histone H4, partia... 109 9e-21
483emb|X95689.1|ACHISTOH4 A.cepa mRNA for histone H4 109 9e-21
484emb|X01343.1|PMHISH4 Psammechinus miliaris gene for histone H4 (... 109 9e-21
485gb|M10556.1|SUPHISB1 P.miliaris histone H4 gene, clone h19, comp... 109 9e-21
486ref|NM_100639.1| Arabidopsis thaliana DNA binding AT1G07660 mRNA... 107 4e-20
487emb|BX041955.1|CNS094JB Single read from an extremity of a full-... 107 4e-20
488ref|XM_776703.1| PREDICTED: Strongylocentrotus purpuratus simila... 107 4e-20
489ref|XM_683785.1| PREDICTED: Danio rerio similar to germinal hist... 107 4e-20
490ref|XM_683555.1| PREDICTED: Danio rerio similar to germinal hist... 107 4e-20
491gb|AF334729.1| Arabidopsis thaliana clone C00146 (f) putative hi... 107 4e-20
492gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 107 4e-20
493dbj|AK176147.1| Arabidopsis thaliana mRNA for histone H4, comple... 107 4e-20
494dbj|AK175843.1| Arabidopsis thaliana mRNA for histone H4, comple... 107 4e-20
495dbj|AK175513.1| Arabidopsis thaliana mRNA for histone H4, comple... 107 4e-20
496gb|AY675291.1| Bufo bufo histone H4 gene, partial cds 107 4e-20
497emb|Z15134.1|PCHISH41 P.chrysosporium gene for histone H4.1 107 4e-20
498gb|M17133.1|ATHH4GB A.thaliana histone H4 gene, complete cds 107 4e-20
499ref|NM_125361.2| Arabidopsis thaliana DNA binding AT5G59690 mRNA... 105 1e-19
500ref|NM_125390.3| Arabidopsis thaliana DNA binding AT5G59970 mRNA... 105 1e-19

>gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds
          Length = 727

 Score =  581 bits (293), Expect = e-163
 Identities = 314/321 (97%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 564 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 505

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 504 ggcggtgacggttttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 445

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 385

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
           ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 384 cacgccgcccctcctggccagcctccggatcgccggcttggtgatgccctggatgttgtc 325

                                                                       
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 324 gcggaggaccttccggtgccgcttggcgccgcccttgcccagccccttgccgcccttgtc 265

                                
Query: 448 gcgcccagacatcgccgctcc 468
           |||||||||||| ||||||||
Sbjct: 264 gcgcccagacatggccgctcc 244



to top

>gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1280_A04,
            complete sequence
          Length = 88553

 Score =  531 bits (268), Expect = e-148
 Identities = 304/316 (96%)
 Strand = Plus / Plus

                                                                        
Query: 150  agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4260 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 4319

                                                                        
Query: 210  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 4379

                                                                        
Query: 270  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
            |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 4380 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 4439

                                                                        
Query: 330  caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
            | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 4440 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 4499

                                                                        
Query: 390  ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
            |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 4500 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 4559

                            
Query: 450  gcccagacatcgccgc 465
            |||| ||||| |||||
Sbjct: 4560 gccccgacatggccgc 4575



 Score =  127 bits (64), Expect = 4e-26
 Identities = 190/232 (81%)
 Strand = Plus / Plus

                                                                         
Query: 152   ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
             ||||||||| | |||| ||||||||||||  |||||||||| || ||||| |||||||| 
Sbjct: 11286 ccgccgaagtcatagatggtgcggccctgaagcttgagcgcatatacgacatccatggcc 11345

                                                                         
Query: 212   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
              |||| ||||||||| | || |||||||||||||| | ||| |||| |||||| |||| |
Sbjct: 11346 atgacagtcttgcggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttg 11405

                                                                         
Query: 272   aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
             |||||||||| ||| ||||| || ||||| | |||||| |  || |||||||||||||| 
Sbjct: 11406 aggaagatctcgagcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacg 11465

                                                                 
Query: 332   ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgt 383
             || ||| |||| || || |  |||||  ||||||||| |||||| |||||||
Sbjct: 11466 ccacccttccttgcaaggcgtcggatcaccggcttggcgatgccttggatgt 11517



to top

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
             complete sequence
          Length = 93826

 Score =  531 bits (268), Expect = e-148
 Identities = 304/316 (96%)
 Strand = Plus / Plus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86772 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 86831

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86832 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 86891

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 86892 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 86951

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 86952 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 87011

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 87012 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 87071

                             
Query: 450   gcccagacatcgccgc 465
             |||| ||||| |||||
Sbjct: 87072 gccccgacatggccgc 87087



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  531 bits (268), Expect = e-148
 Identities = 304/316 (96%)
 Strand = Plus / Plus

                                                                            
Query: 150      agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591722 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 22591781

                                                                            
Query: 210      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591782 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 22591841

                                                                            
Query: 270      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
                |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22591842 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 22591901

                                                                            
Query: 330      caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
                | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 22591902 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 22591961

                                                                            
Query: 390      ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
                |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 22591962 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 22592021

                                
Query: 450      gcccagacatcgccgc 465
                |||| ||||| |||||
Sbjct: 22592022 gccccgacatggccgc 22592037



 Score =  523 bits (264), Expect = e-145
 Identities = 303/316 (95%)
 Strand = Plus / Minus

                                                                            
Query: 150      agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758369 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 22758310

                                                                            
Query: 210      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758309 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 22758250

                                                                            
Query: 270      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
                |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 22758249 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 22758190

                                                                            
Query: 330      caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
                | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 22758189 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 22758130

                                                                            
Query: 390      ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
                |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 22758129 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 22758070

                                
Query: 450      gcccagacatcgccgc 465
                |||| ||||| |||||
Sbjct: 22758069 gccccgacatggccgc 22758054



 Score =  127 bits (64), Expect = 4e-26
 Identities = 190/232 (81%)
 Strand = Plus / Plus

                                                                            
Query: 152      ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
                ||||||||| | |||| ||||||||||||  |||||||||| || ||||| |||||||| 
Sbjct: 22598748 ccgccgaagtcatagatggtgcggccctgaagcttgagcgcatatacgacatccatggcc 22598807

                                                                            
Query: 212      gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
                 |||| ||||||||| | || |||||||||||||| | ||| |||| |||||| |||| |
Sbjct: 22598808 atgacagtcttgcggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttg 22598867

                                                                            
Query: 272      aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
                |||||||||| ||| ||||| || ||||| | |||||| |  || |||||||||||||| 
Sbjct: 22598868 aggaagatctcgagcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacg 22598927

                                                                    
Query: 332      ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgt 383
                || ||| |||| || || |  |||||  ||||||||| |||||| |||||||
Sbjct: 22598928 ccacccttccttgcaaggcgtcggatcaccggcttggcgatgccttggatgt 22598979



to top

>dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C11, full
           insert sequence
          Length = 588

 Score =  531 bits (268), Expect = e-148
 Identities = 304/316 (96%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 414 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 355

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 354 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 295

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 294 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 235

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 234 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 175

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 174 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 115

                           
Query: 450 gcccagacatcgccgc 465
           |||| ||||| |||||
Sbjct: 114 gccccgacatggccgc 99



to top

>ref|XM_475383.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  527 bits (266), Expect = e-146
 Identities = 299/310 (96%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 70  ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 11

                     
Query: 450 gcccagacat 459
           |||| |||||
Sbjct: 10  gccccgacat 1



to top

>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01,
              complete sequence
          Length = 186325

 Score =  527 bits (266), Expect = e-146
 Identities = 305/318 (95%)
 Strand = Plus / Plus

                                                                          
Query: 148    ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135379 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 135438

                                                                          
Query: 208    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135439 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 135498

                                                                          
Query: 268    ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
              |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 135499 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 135558

                                                                          
Query: 328    cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
               || ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 135559 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 135618

                                                                          
Query: 388    gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
              |||||| ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 135619 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 135678

                                
Query: 448    gcgcccagacatcgccgc 465
              |||||| |||||||||||
Sbjct: 135679 gcgccccgacatcgccgc 135696



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  527 bits (266), Expect = e-146
 Identities = 305/318 (95%)
 Strand = Plus / Plus

                                                                            
Query: 148      ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
                |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29462363 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 29462422

                                                                            
Query: 208      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29462423 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 29462482

                                                                            
Query: 268      ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
                |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 29462483 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 29462542

                                                                            
Query: 328      cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
                 || ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 29462543 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 29462602

                                                                            
Query: 388      gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
                |||||| ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 29462603 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 29462662

                                  
Query: 448      gcgcccagacatcgccgc 465
                |||||| |||||||||||
Sbjct: 29462663 gcgccccgacatcgccgc 29462680



to top

>dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-B02, full
           insert sequence
          Length = 594

 Score =  527 bits (266), Expect = e-146
 Identities = 305/318 (95%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 329

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 269

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 268 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 209

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 208 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 149

                                                                       
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           |||||| ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 148 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 89

                             
Query: 448 gcgcccagacatcgccgc 465
           |||||| |||||||||||
Sbjct: 88  gcgccccgacatcgccgc 71



to top

>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009E21,
              complete sequence
          Length = 153214

 Score =  523 bits (264), Expect = e-145
 Identities = 303/316 (95%)
 Strand = Plus / Minus

                                                                          
Query: 150    agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113568 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 113509

                                                                          
Query: 210    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113508 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 113449

                                                                          
Query: 270    cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
              |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 113448 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 113389

                                                                          
Query: 330    caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
              | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 113388 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 113329

                                                                          
Query: 390    ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
              |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 113328 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 113269

                              
Query: 450    gcccagacatcgccgc 465
              |||| ||||| |||||
Sbjct: 113268 gccccgacatggccgc 113253



to top

>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08,
             complete sequence
          Length = 141535

 Score =  523 bits (264), Expect = e-145
 Identities = 303/316 (95%)
 Strand = Plus / Minus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67819 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 67760

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67759 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 67700

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 67699 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 67640

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 67639 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 67580

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 67579 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 67520

                             
Query: 450   gcccagacatcgccgc 465
             |||| ||||| |||||
Sbjct: 67519 gccccgacatggccgc 67504



to top

>dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-A04, full
           insert sequence
          Length = 672

 Score =  523 bits (264), Expect = e-145
 Identities = 303/316 (95%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 341

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 281

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 280 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 221

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 220 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 161

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 160 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 101

                           
Query: 450 gcccagacatcgccgc 465
           |||| ||||| |||||
Sbjct: 100 gccccgacatggccgc 85



to top

>gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence
          Length = 622

 Score =  521 bits (263), Expect = e-145
 Identities = 305/319 (95%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 383 cctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 324

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 323 tggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgt 264

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           ||||||| ||||||||||| |||||||||||||||||||||||||| || ||||||||||
Sbjct: 263 tctcgagaaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 204

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           |||| || |||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 203 tcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttgt 144

                                                                       
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
           ||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 143 cgcggagcaccttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttgc 84

                              
Query: 447 cgcgcccagacatcgccgc 465
           |||||||||||||||||||
Sbjct: 83  cgcgcccagacatcgccgc 65



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  521 bits (263), Expect = e-145
 Identities = 302/315 (95%)
 Strand = Plus / Plus

                                                                            
Query: 150      agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28012831 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 28012890

                                                                            
Query: 210      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 28012891 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 28012950

                                                                            
Query: 270      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
                |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 28012951 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 28013010

                                                                            
Query: 330      caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
                | || |||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 28013011 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 28013070

                                                                            
Query: 390      ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
                |||| ||||| ||||||||||| || ||||||||||||||||||||||| ||||||||||
Sbjct: 28013071 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 28013130

                               
Query: 450      gcccagacatcgccg 464
                |||||||||||||||
Sbjct: 28013131 gcccagacatcgccg 28013145



to top

>dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1212_A08
          Length = 119304

 Score =  521 bits (263), Expect = e-145
 Identities = 302/315 (95%)
 Strand = Plus / Plus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56493 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 56552

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 56553 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 56612

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 56613 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 56672

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | || |||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 56673 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 56732

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||| ||||| ||||||||||| || ||||||||||||||||||||||| ||||||||||
Sbjct: 56733 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 56792

                            
Query: 450   gcccagacatcgccg 464
             |||||||||||||||
Sbjct: 56793 gcccagacatcgccg 56807



to top

>dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1717_A09
          Length = 203132

 Score =  521 bits (263), Expect = e-145
 Identities = 302/315 (95%)
 Strand = Plus / Plus

                                                                        
Query: 150  agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2478 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 2537

                                                                        
Query: 210  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2538 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 2597

                                                                        
Query: 270  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
            |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 2598 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 2657

                                                                        
Query: 330  caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
            | || |||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 2658 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 2717

                                                                        
Query: 390  ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
            |||| ||||| ||||||||||| || ||||||||||||||||||||||| ||||||||||
Sbjct: 2718 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 2777

                           
Query: 450  gcccagacatcgccg 464
            |||||||||||||||
Sbjct: 2778 gcccagacatcgccg 2792



to top

>ref|XM_475394.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  519 bits (262), Expect = e-144
 Identities = 298/310 (96%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 70  ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 11

                     
Query: 450 gcccagacat 459
           |||| |||||
Sbjct: 10  gccccgacat 1



to top

>ref|XM_473659.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  515 bits (260), Expect = e-143
 Identities = 299/312 (95%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || ||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 132 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 73

                                                                       
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           |||||| ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 72  gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 13

                       
Query: 448 gcgcccagacat 459
           |||||| |||||
Sbjct: 12  gcgccccgacat 1



to top

>gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), complete cds
          Length = 1135

 Score =  513 bits (259), Expect = e-142
 Identities = 298/311 (95%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 776 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtc 717

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 716 acggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaga 657

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           ||||||||||| |||||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 656 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgcca 597

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| 
Sbjct: 596 cccctcctagccagcctccggatcgccggcttggtgatgccctggatgttgtcgcggagc 537

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 536 accttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttgccgcgccca 477

                      
Query: 455 gacatcgccgc 465
           |||||||||||
Sbjct: 476 gacatcgccgc 466



to top

>ref|XM_467181.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  511 bits (258), Expect = e-142
 Identities = 297/310 (95%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || |||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 130 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||| ||||||||||| || ||||||||||||||||||||||| ||||||||||
Sbjct: 70  ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 11

                     
Query: 450 gcccagacat 459
           ||||||||||
Sbjct: 10  gcccagacat 1



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  500 bits (252), Expect = e-138
 Identities = 303/320 (94%)
 Strand = Plus / Minus

                                                                            
Query: 141      ggggaacctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacga 200
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21774028 ggggagcctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacga 21773969

                                                                            
Query: 201      cgtccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcgga 260
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21773968 cgtccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcgga 21773909

                                                                            
Query: 261      tgacgttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggaga 320
                ||||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||
Sbjct: 21773908 tgacgttctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgaga 21773849

                                                                            
Query: 321      tgcgcttcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctgga 380
                |||||||||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||
Sbjct: 21773848 tgcgcttcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctgga 21773789

                                                                            
Query: 381      tgttgtcgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgc 440
                ||||||||||||| ||||||||||||||||| ||||| ||||||||||| ||||| || |
Sbjct: 21773788 tgttgtcgcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctc 21773729

                                    
Query: 441      ccttgccgcgcccagacatc 460
                |||| |||||||||||||||
Sbjct: 21773728 ccttcccgcgcccagacatc 21773709



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  500 bits (252), Expect = e-138
 Identities = 300/316 (94%)
 Strand = Plus / Minus

                                                                            
Query: 150      agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35834191 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 35834132

                                                                            
Query: 210      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 35834131 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 35834072

                                                                            
Query: 270      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
                |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 35834071 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 35834012

                                                                            
Query: 330      caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
                | ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 35834011 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 35833952

                                                                            
Query: 390      ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
                |||| ||||| || || | ||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 35833951 ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 35833892

                                
Query: 450      gcccagacatcgccgc 465
                |||| ||||| |||||
Sbjct: 35833891 gccccgacatggccgc 35833876



to top

>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0534A03
          Length = 153170

 Score =  500 bits (252), Expect = e-138
 Identities = 303/320 (94%)
 Strand = Plus / Minus

                                                                         
Query: 141   ggggaacctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacga 200
             ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91211 ggggagcctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacga 91152

                                                                         
Query: 201   cgtccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcgga 260
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91151 cgtccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcgga 91092

                                                                         
Query: 261   tgacgttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggaga 320
             ||||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||
Sbjct: 91091 tgacgttctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgaga 91032

                                                                         
Query: 321   tgcgcttcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctgga 380
             |||||||||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||
Sbjct: 91031 tgcgcttcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctgga 90972

                                                                         
Query: 381   tgttgtcgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgc 440
             ||||||||||||| ||||||||||||||||| ||||| ||||||||||| ||||| || |
Sbjct: 90971 tgttgtcgcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctc 90912

                                 
Query: 441   ccttgccgcgcccagacatc 460
             |||| |||||||||||||||
Sbjct: 90911 ccttcccgcgcccagacatc 90892



to top

>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506B12
          Length = 170759

 Score =  500 bits (252), Expect = e-138
 Identities = 300/316 (94%)
 Strand = Plus / Minus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98649 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 98590

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 98589 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 98530

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 98529 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 98470

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 98469 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 98410

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||| ||||| || || | ||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 98409 ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 98350

                             
Query: 450   gcccagacatcgccgc 465
             |||| ||||| |||||
Sbjct: 98349 gccccgacatggccgc 98334



to top

>emb|X00043.1|TAHI01 Wheat histone H4 gene
          Length = 1200

 Score =  500 bits (252), Expect = e-138
 Identities = 300/316 (94%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1046 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 987

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 986  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcatcgcggatgacgttc 927

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            ||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||
Sbjct: 926  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 867

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || ||||||| ||  ||||||| |||||| |||||||||||||||||||||||||| |||
Sbjct: 866  acgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttatcg 807

                                                                        
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
            |||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||
Sbjct: 806  cggaggaccttccggtggcgcttggcgccgcccttgcctaggcccttgcctcccttgccg 747

                            
Query: 449  cgcccagacatcgccg 464
            ||||| ||||| ||||
Sbjct: 746  cgcccggacatggccg 731



to top

>dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-F07, full
            insert sequence
          Length = 1449

 Score =  500 bits (252), Expect = e-138
 Identities = 300/316 (94%)
 Strand = Plus / Minus

                                                                        
Query: 150  agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1156 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1097

                                                                        
Query: 210  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1096 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1037

                                                                        
Query: 270  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
            |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 1036 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 977

                                                                        
Query: 330  caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
            | ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 976  cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 917

                                                                        
Query: 390  ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
            |||| ||||| || || | ||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 916  ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 857

                            
Query: 450  gcccagacatcgccgc 465
            |||| ||||| |||||
Sbjct: 856  gccccgacatggccgc 841



to top

>ref|NM_190485.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  496 bits (250), Expect = e-137
 Identities = 295/310 (95%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||| || || | ||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 70  ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 11

                     
Query: 450 gcccagacat 459
           |||| |||||
Sbjct: 10  gccccgacat 1



to top

>gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full insert mRNA sequence
          Length = 1768

 Score =  494 bits (249), Expect = e-136
 Identities = 297/313 (94%)
 Strand = Plus / Minus

                                                                        
Query: 147  cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1601 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 1542

                                                                        
Query: 207  tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1541 tggccgtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 1482

                                                                        
Query: 267  tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
            ||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||
Sbjct: 1481 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 1422

                                                                        
Query: 327  tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
            |||| ||||||| ||  ||||||| |||||| ||||||||||||||||||||||||||||
Sbjct: 1421 tcacgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttgt 1362

                                                                        
Query: 387  cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
            |||| || |||||||||||||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 1361 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 1302

                         
Query: 447  cgcgcccagacat 459
            |||| || |||||
Sbjct: 1301 cgcggccggacat 1289



to top

>ref|NM_185758.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  492 bits (248), Expect = e-136
 Identities = 296/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           |||||||||||||||||| || ||||||||||||||||||||||| || |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgctt 133

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
           ||| ||||||||||| |||||||||||||| |||||||| ||||| ||||||||||||||
Sbjct: 132 caccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtc 73

                                                                       
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           |||||| ||||||||||||||||| ||||| ||||||||||| ||||| || ||||| ||
Sbjct: 72  gcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttccc 13

                       
Query: 448 gcgcccagacat 459
           ||||||||||||
Sbjct: 12  gcgcccagacat 1



to top

>gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence
          Length = 594

 Score =  486 bits (245), Expect = e-134
 Identities = 299/317 (94%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 354 tagccgccgaacccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatg 295

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           ||||||||||| || || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 294 gcggtgacggtttttcgacgggcgtgctcagtgtaggtgacggcgtcgcggatgacgttc 235

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 234 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttc 175

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||||||||| || ||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 174 acgccgcccctcctcgcaagcctccggatcgccggcttcgtgatcccttggatgttgtcg 115

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 114 cggagcaccttgcggtgccgcttggcgccgcccttgcccagccccttgccgcccttgccg 55

                            
Query: 449 cgcccagacatcgccgc 465
           |||||||||||||||||
Sbjct: 54  cgcccagacatcgccgc 38



to top

>emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene
          Length = 1029

 Score =  476 bits (240), Expect = e-131
 Identities = 302/320 (94%), Gaps = 2/320 (0%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 647 cctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 588

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 587 tggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgt 528

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           ||||||| ||||||||| | |||||||||||||||||||||||||| || ||||||||||
Sbjct: 527 tctcgagaaagatcttgcgcacgccgcgggtctcctcgtagatgagccccgagatgcgct 468

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           |||| || |||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 467 tcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttgt 408

                                                                       
Query: 387 cgcggaggaccttccggtggcgctt-ggcgccgcccttgcccagccccttgccgcccttg 445
           ||||||| |||||||||||||||||  ||| ||||||| ||||| |||||||||||||||
Sbjct: 407 cgcggagcaccttccggtggcgcttccgcg-cgccctttcccagacccttgccgcccttg 349

                               
Query: 446 ccgcgcccagacatcgccgc 465
           ||||||||||||||||||||
Sbjct: 348 ccgcgcccagacatcgccgc 329



to top

>gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0031H05, complete sequence
          Length = 141200

 Score =  474 bits (239), Expect = e-130
 Identities = 299/319 (93%)
 Strand = Plus / Plus

                                                                         
Query: 147   cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67512 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 67571

                                                                         
Query: 207   tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 67572 tggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgt 67631

                                                                         
Query: 267   tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
             ||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||
Sbjct: 67632 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 67691

                                                                         
Query: 327   tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
             |||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 67692 tcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 67751

                                                                         
Query: 387   cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
             |||| || ||||||| ||| | ||| ||||||||||| || |||||||||||||||||||
Sbjct: 67752 cgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttgc 67811

                                
Query: 447   cgcgcccagacatcgccgc 465
             | | |||||||||||||||
Sbjct: 67812 ctctcccagacatcgccgc 67830



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  474 bits (239), Expect = e-130
 Identities = 299/319 (93%)
 Strand = Plus / Plus

                                                                            
Query: 147      cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
                ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21610886 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 21610945

                                                                            
Query: 207      tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
                ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 21610946 tggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgt 21611005

                                                                            
Query: 267      tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
                ||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||
Sbjct: 21611006 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 21611065

                                                                            
Query: 327      tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
                |||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 21611066 tcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 21611125

                                                                            
Query: 387      cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
                |||| || ||||||| ||| | ||| ||||||||||| || |||||||||||||||||||
Sbjct: 21611126 cgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttgc 21611185

                                   
Query: 447      cgcgcccagacatcgccgc 465
                | | |||||||||||||||
Sbjct: 21611186 ctctcccagacatcgccgc 21611204



 Score =  474 bits (239), Expect = e-130
 Identities = 296/315 (93%)
 Strand = Plus / Minus

                                                                            
Query: 147      cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 15861722 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 15861663

                                                                            
Query: 207      tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15861662 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 15861603

                                                                            
Query: 267      tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
                ||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||||
Sbjct: 15861602 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 15861543

                                                                            
Query: 327      tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
                |||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 15861542 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 15861483

                                                                            
Query: 387      cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
                ||||||| ||||||||||| ||||| || ||||||||||| || ||||| || |||||||
Sbjct: 15861482 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 15861423

                               
Query: 447      cgcgcccagacatcg 461
                ||||||| |||||||
Sbjct: 15861422 cgcgccccgacatcg 15861408



to top

>dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1081_G10
          Length = 107955

 Score =  474 bits (239), Expect = e-130
 Identities = 296/315 (93%)
 Strand = Plus / Minus

                                                                         
Query: 147   cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 24848 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 24789

                                                                         
Query: 207   tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24788 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 24729

                                                                         
Query: 267   tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
             ||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||||
Sbjct: 24728 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 24669

                                                                         
Query: 327   tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
             |||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 24668 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 24609

                                                                         
Query: 387   cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
             ||||||| ||||||||||| ||||| || ||||||||||| || ||||| || |||||||
Sbjct: 24608 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 24549

                            
Query: 447   cgcgcccagacatcg 461
             ||||||| |||||||
Sbjct: 24548 cgcgccccgacatcg 24534



to top

>dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1228_C03, complete sequence
          Length = 31468

 Score =  474 bits (239), Expect = e-130
 Identities = 299/319 (93%)
 Strand = Plus / Plus

                                                                         
Query: 147   cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19210 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 19269

                                                                         
Query: 207   tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 19270 tggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgt 19329

                                                                         
Query: 267   tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
             ||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||
Sbjct: 19330 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 19389

                                                                         
Query: 327   tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
             |||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 19390 tcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 19449

                                                                         
Query: 387   cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
             |||| || ||||||| ||| | ||| ||||||||||| || |||||||||||||||||||
Sbjct: 19450 cgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttgc 19509

                                
Query: 447   cgcgcccagacatcgccgc 465
             | | |||||||||||||||
Sbjct: 19510 ctctcccagacatcgccgc 19528



to top

>dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-A10, full
           insert sequence
          Length = 469

 Score =  474 bits (239), Expect = e-130
 Identities = 296/315 (93%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 363 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 304

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 244

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           ||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||||
Sbjct: 243 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 184

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           |||| ||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 183 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 124

                                                                       
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgc 446
           ||||||| ||||||||||| ||||| || ||||||||||| || ||||| || |||||||
Sbjct: 123 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 64

                          
Query: 447 cgcgcccagacatcg 461
           ||||||| |||||||
Sbjct: 63  cgcgccccgacatcg 49



to top

>ref|NM_187563.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||||| ||| ||||| |||||||||||||| || |||||||| ||||||||||
Sbjct: 70  gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 11

                     
Query: 450 gcccagacat 459
           | || |||||
Sbjct: 10  ggcccgacat 1



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                           
Query: 150     agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060862 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1060803

                                                                           
Query: 210     cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1060802 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1060743

                                                                           
Query: 270     cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
               |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 1060742 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 1060683

                                                                           
Query: 330     caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
               | ||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 1060682 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1060623

                                                                           
Query: 390     ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
               | || ||||||| ||| ||||| |||||||||||||| || |||||||| ||||||||||
Sbjct: 1060622 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 1060563

                         
Query: 450     gcccagacat 459
               | || |||||
Sbjct: 1060562 ggcccgacat 1060553



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/96 (85%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 232      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgcc 291
                |||||||||||||||||| | ||||  | ||||||||| ||||||||||||||  |||||
Sbjct: 25649298 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25649239

                                                    
Query: 292      gcgggtctcctcgtagatgaggccggagatgcgctt 327
                 |  || |||||||||||||| | ||||||||||||
Sbjct: 25649238 acatgt-tcctcgtagatgagcctggagatgcgctt 25649204



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                           
Query: 150     agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060860 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1060801

                                                                           
Query: 210     cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1060800 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1060741

                                                                           
Query: 270     cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
               |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 1060740 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 1060681

                                                                           
Query: 330     caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
               | ||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 1060680 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1060621

                                                                           
Query: 390     ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
               | || ||||||| ||| ||||| |||||||||||||| || |||||||| ||||||||||
Sbjct: 1060620 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 1060561

                         
Query: 450     gcccagacat 459
               | || |||||
Sbjct: 1060560 ggcccgacat 1060551



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 82/96 (85%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 232      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgcc 291
                |||||||||||||||||| | ||||  | ||||||||| ||||||||||||||  |||||
Sbjct: 25740607 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25740548

                                                    
Query: 292      gcgggtctcctcgtagatgaggccggagatgcgctt 327
                 |  || |||||||||||||| | ||||||||||||
Sbjct: 25740547 acatgt-tcctcgtagatgagcctggagatgcgctt 25740513



to top

>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11,
             complete sequence
          Length = 126827

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 81077 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 81018

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 81017 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 80958

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 80957 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 80898

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | ||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 80897 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 80838

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             | || ||||||| ||| ||||| |||||||||||||| || |||||||| ||||||||||
Sbjct: 80837 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 80778

                       
Query: 450   gcccagacat 459
             | || |||||
Sbjct: 80777 ggcccgacat 80768



to top

>dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G08, full
           insert sequence
          Length = 526

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 318

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 317 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 258

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 257 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 198

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||
Sbjct: 197 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 138

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||||| ||| ||||| |||||||||||||| || |||||||| ||||||||||
Sbjct: 137 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 78

                     
Query: 450 gcccagacat 459
           | || |||||
Sbjct: 77  ggcccgacat 68



to top

>ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone H4
           (OSJNBb0064P21.1), mRNA
          Length = 372

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 311

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 251

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 250 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 191

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 190 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 131

                                                                     
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 130 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 73



to top

>gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 genomic sequence,
            complete sequence
          Length = 14849

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Minus

                                                                        
Query: 150  agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4262 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 4203

                                                                        
Query: 210  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4202 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 4143

                                                                        
Query: 270  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
            |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 4142 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 4083

                                                                        
Query: 330  caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
            | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 4082 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 4023

                                                                      
Query: 390  ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 4022 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 3965



to top

>gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 genomic sequence,
            complete sequence
          Length = 142114

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Plus

                                                                        
Query: 150  agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5636 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 5695

                                                                        
Query: 210  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5696 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 5755

                                                                        
Query: 270  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
            |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 5756 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 5815

                                                                        
Query: 330  caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
            | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 5816 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 5875

                                                                      
Query: 390  ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 5876 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 5933



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Plus

                                                                            
Query: 150      agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20500346 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 20500405

                                                                            
Query: 210      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20500406 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 20500465

                                                                            
Query: 270      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
                |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 20500466 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 20500525

                                                                            
Query: 330      caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
                | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 20500526 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 20500585

                                                                          
Query: 390      ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
                | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 20500586 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 20500643



to top

>dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-D04, full
           insert sequence
          Length = 544

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 325

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 265

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 264 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 205

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 204 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 145

                                                                     
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 144 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 87



to top

>dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-C07, full
           insert sequence
          Length = 531

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 321

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 261

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 260 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 201

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 200 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 141

                                                                     
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 140 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 83



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  456 bits (230), Expect = e-125
 Identities = 281/298 (94%)
 Strand = Plus / Plus

                                                                            
Query: 150      agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20511618 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 20511677

                                                                            
Query: 210      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20511678 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 20511737

                                                                            
Query: 270      cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
                |||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||
Sbjct: 20511738 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 20511797

                                                                            
Query: 330      caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
                | ||||||||||| |||||||||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 20511798 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 20511857

                                                                          
Query: 390      ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
                | || ||||||| ||| | ||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 20511858 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgcc 20511915



to top

>emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4
          Length = 616

 Score =  448 bits (226), Expect = e-123
 Identities = 290/312 (92%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           ||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 361 ctagccgccgaagccgtagagagtgcgaccctggcgcttgagcgcgtagactacgtccat 302

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 301 ggcggtgacggtcttgcggcsggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 242

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           |||||||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 241 ctcgaggaagatcttgagcacgccacgggtctcctcgtagatgagcccggagatgcgctt 182

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
           ||| ||||| |  |  ||||| |  |||||||||||||||||||||||||||||||||||
Sbjct: 181 cacgccgccgcggcgagccaggcggcggatggccggcttggtgatgccctggatgttgtc 122

                                                                       
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           |||||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||
Sbjct: 121 gcggaggaccttgcggtggcgcttggcgccgcccttgccgagcccctttcctcccttgcc 62

                       
Query: 448 gcgcccagacat 459
           ||| || |||||
Sbjct: 61  gcggcccgacat 50



to top

>gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), complete cds
          Length = 868

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 659 agccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccatgg 600

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| ||||
Sbjct: 599 cggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacattct 540

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 539 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 480

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | |||||||| || |||||||||||||| |||||||| || |||||||||||||||||||
Sbjct: 479 cgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtcgc 420

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||||||||| ||||| ||||| ||||||||||||||||||||||| |||||||| ||||
Sbjct: 419 ggaggaccttgcggtgacgcttcgcgccgcccttgcccagccccttcccgccctttccgc 360

                     
Query: 450 gcccagacat 459
           |||| |||||
Sbjct: 359 gccccgacat 350



to top

>gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds
          Length = 949

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 647 agccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccatgg 588

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||||||||
Sbjct: 587 cggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacgttct 528

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           |||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||
Sbjct: 527 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 468

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | |||||||| || |||||||||||||| |||||||| || |||||||||||||||||||
Sbjct: 467 cgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtcgc 408

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||||||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| ||||
Sbjct: 407 ggaggaccttgcggtgacgcttcgcgccgccctttcccagccccttcccgccctttccgc 348

                     
Query: 450 gcccagacat 459
           |||| |||||
Sbjct: 347 gccccgacat 338



to top

>gb|AY105603.1| Zea mays PCO094685 mRNA sequence
          Length = 731

 Score =  426 bits (215), Expect = e-116
 Identities = 287/311 (92%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| ||||| || |||||||||||||||||||| ||||| || || ||||||||||||
Sbjct: 385 ccgaacccgtacagagtgcggccctggcgcttgagggcgtacacaacatccatggcggtg 326

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 325 acggtcttgcggcgagcgtgctcggtgtaggtgaccgcgtcgcggatgacattctcgagg 266

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           ||||||||||| ||||||||||| ||||||||||| || |||||||| |||||||| |||
Sbjct: 265 aagatcttgagcacgccgcgggtttcctcgtagataagcccggagatacgcttcacgccg 206

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           |||||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 205 cccctcctcgccagcctccggattgccggcttcgtgataccctggatgttgtcgcggaga 146

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           ||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145 accttacggtggcgtttcgcgccgcccttgcccagccccttgccgcccttgccgcgccca 86

                      
Query: 455 gacatcgccgc 465
           |||||||||||
Sbjct: 85  gacatcgccgc 75



to top

>ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611513), mRNA
          Length = 450

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 448 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 389

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 388 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 329

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 328 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 269

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 268 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 209

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 208 gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 149

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 148 gaccagacat 139



to top

>ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611490), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 10  gaccagacat 1



to top

>ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611106), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 10  gaccagacat 1



to top

>ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488260), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 10  gaccagacat 1



to top

>ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488265), mRNA
          Length = 714

 Score =  391 bits (197), Expect = e-105
 Identities = 278/305 (91%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 707 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtg 648

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 647 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccagg 588

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | |||||| || |||||||||||||||||||||||||| ||||||||||| || |||
Sbjct: 587 aacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccg 528

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || | || |||||||| ||||||||| ||||||||||||||||||||||||||||| || 
Sbjct: 527 ccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagc 468

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||
Sbjct: 467 accttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgcgacca 408

                
Query: 455 gacat 459
           |||||
Sbjct: 407 gacat 403



to top

>ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611148), mRNA
          Length = 312

 Score =  387 bits (195), Expect = e-104
 Identities = 273/299 (91%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| ||||||
Sbjct: 251 gccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| 
Sbjct: 191 tccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttg 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | || |||||||| ||||||||| |||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13



to top

>ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611486), mRNA
          Length = 444

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 442 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 383

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 382 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 323

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 322 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 263

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 262 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 203

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 202 gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 143

            
Query: 450 g 450
           |
Sbjct: 142 g 142



to top

>gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence
          Length = 525

 Score =  379 bits (191), Expect = e-102
 Identities = 275/303 (90%)
 Strand = Plus / Minus

                                                                       
Query: 145 aacctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 204
           |||||||||||||||||| ||||| |||||||||||||| ||||| ||||| ||||||||
Sbjct: 369 aacctagccgccgaagccatagagagtgcggccctggcgtttgagggcgtacacgacgtc 310

                                                                       
Query: 205 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 264
           ||| ||||||||||| ||||| ||||||||||| |||||||| || ||||||||||||||
Sbjct: 309 catagcggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgac 250

                                                                       
Query: 265 gttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcg 324
            |||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 249 attctcgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcg 190

                                                                       
Query: 325 cttcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgtt 384
           |||||| || |||||||| |||||||||||||| |||||||| ||||| |||||||||||
Sbjct: 189 cttcacgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgtt 130

                                                                       
Query: 385 gtcgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           |||||| || ||||||||||| ||||| ||||||||||| || |||||||||||||||||
Sbjct: 129 gtcgcgcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgccctt 70

              
Query: 445 gcc 447
           |||
Sbjct: 69  gcc 67



to top

>ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
            (LOC611231), mRNA
          Length = 1428

 Score =  377 bits (190), Expect = e-101
 Identities = 280/310 (90%)
 Strand = Plus / Minus

                                                                        
Query: 150  agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
            ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 1426 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcatagaccacgtccatgg 1367

                                                                        
Query: 210  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 1366 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 1307

                                                                        
Query: 270  cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
            | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 1306 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 1247

                                                                        
Query: 330  caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
            | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 1246 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 1187

                                                                        
Query: 390  ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
            | || ||||| |||||||||||||||||||||||||| || ||||| |||||||||||||
Sbjct: 1186 gcagcaccttgcggtggcgcttggcgccgcccttgcctagtcccttcccgcccttgccgc 1127

                      
Query: 450  gcccagacat 459
            | ||||||||
Sbjct: 1126 gaccagacat 1117



to top

>gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence
          Length = 666

 Score =  371 bits (187), Expect = 2e-99
 Identities = 274/303 (90%)
 Strand = Plus / Minus

                                                                       
Query: 145 aacctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 204
           |||||||||||||||||| || || |||||||||||||| ||||| ||||| ||||||||
Sbjct: 389 aacctagccgccgaagccataaagagtgcggccctggcgtttgagggcgtacacgacgtc 330

                                                                       
Query: 205 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 264
           ||| ||||||||||| ||||| ||||||||||| |||||||| || ||||||||||||||
Sbjct: 329 catagcggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgac 270

                                                                       
Query: 265 gttctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcg 324
            |||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||
Sbjct: 269 attctcgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcg 210

                                                                       
Query: 325 cttcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgtt 384
           |||||| || |||||||| |||||||||||||| |||||||| ||||| |||||||||||
Sbjct: 209 cttcacgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgtt 150

                                                                       
Query: 385 gtcgcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           |||||| || ||||||||||| ||||| ||||||||||| || |||||||||||||||||
Sbjct: 149 gtcgcgcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgccctt 90

              
Query: 445 gcc 447
           |||
Sbjct: 89  gcc 87



to top

>ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611344), mRNA
          Length = 456

 Score =  371 bits (187), Expect = 2e-99
 Identities = 274/303 (90%)
 Strand = Plus / Minus

                                                                       
Query: 158 aagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacg 217
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| 
Sbjct: 446 aagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtgacc 387

                                                                       
Query: 218 gtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaag 277
           ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||| ||||| 
Sbjct: 386 gtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccaggaac 327

                                                                       
Query: 278 atcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccgccc 337
           | |||||| || |||||||||||||||||||||||||| ||||||||||| || ||||| 
Sbjct: 326 accttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccg 267

                                                                       
Query: 338 ctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggaggacc 397
           | || |||||||| ||||||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 266 cgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcacc 207

                                                                       
Query: 398 ttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgcccagac 457
           || ||||||||||||||||||||||||||||||||||| ||||||||||| || || |||
Sbjct: 206 ttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccacgacctgac 147

              
Query: 458 atc 460
           |||
Sbjct: 146 atc 144



to top

>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds
          Length = 2297

 Score =  363 bits (183), Expect = 4e-97
 Identities = 270/299 (90%)
 Strand = Plus / Plus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1689 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 1748

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1749 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 1808

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 1809 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 1868

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 1869 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 1928

                                                                       
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 1929 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 1987



 Score =  363 bits (183), Expect = 4e-97
 Identities = 270/299 (90%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 511 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 452

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 392

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 391 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 332

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 331 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 272

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 271 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 213



to top

>ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC417946), mRNA
          Length = 312

 Score =  363 bits (183), Expect = 4e-97
 Identities = 270/299 (90%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 191 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>ref|NM_001037843.1| Gallus gallus similar to germinal histone H4 gene (LOC417950), mRNA
          Length = 312

 Score =  363 bits (183), Expect = 4e-97
 Identities = 270/299 (90%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 191 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds
          Length = 661

 Score =  363 bits (183), Expect = 4e-97
 Identities = 270/299 (90%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 471 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 412

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 352

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 351 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 292

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 291 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 232

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 231 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 173



to top

>ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427889), mRNA
          Length = 312

 Score =  357 bits (180), Expect = 2e-95
 Identities = 267/296 (90%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | ||  ||||| |  |||||||||||||||||||||||||||||||||||||| 
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score =  357 bits (180), Expect = 2e-95
 Identities = 267/296 (90%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | ||  ||||| |  |||||||||||||||||||||||||||||||||||||| 
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  357 bits (180), Expect = 2e-95
 Identities = 267/296 (90%)
 Strand = Plus / Plus

                                                                        
Query: 152  ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
            ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 6357 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 6416

                                                                        
Query: 212  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 6417 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 6476

                                                                        
Query: 272  aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
            ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 6477 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 6536

                                                                        
Query: 332  ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
            ||||| | ||  ||||| |  |||||||||||||||||||||||||||||||||||||| 
Sbjct: 6537 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 6596

                                                                    
Query: 392  aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 6597 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 6652



 Score =  349 bits (176), Expect = 6e-93
 Identities = 266/296 (89%)
 Strand = Plus / Minus

                                                                        
Query: 152  ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
            ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 1095 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 1036

                                                                        
Query: 212  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1035 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 976

                                                                        
Query: 272  aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
            ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 975  aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 916

                                                                        
Query: 332  ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
            ||||| | ||  ||||| |  ||||||||||||||||||||||||||||| |||||||| 
Sbjct: 915  ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatattgtcgcgc 856

                                                                    
Query: 392  aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 855  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 800



to top

>ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA
          Length = 312

 Score =  355 bits (179), Expect = 9e-95
 Identities = 278/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           ||||| ||||| ||||||||||| |||||||| |||||||| || || || |||||||||
Sbjct: 71  cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 12

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 11  cgacccgacat 1



to top

>ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427884), mRNA
          Length = 516

 Score =  355 bits (179), Expect = 9e-95
 Identities = 269/299 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 515 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 456

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 455 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggataacgttc 396

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 395 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 336

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 335 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 276

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 275 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 217



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  355 bits (179), Expect = 9e-95
 Identities = 278/311 (89%)
 Strand = Plus / Plus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1030 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1089

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 1090 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 1149

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1150 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 1209

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 1210 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 1269

                                                                        
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
            ||||| ||||| ||||||||||| |||||||| |||||||| || || || |||||||||
Sbjct: 1270 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 1329

                       
Query: 449  cgcccagacat 459
            || || |||||
Sbjct: 1330 cgacccgacat 1340



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  355 bits (179), Expect = 9e-95
 Identities = 278/311 (89%)
 Strand = Plus / Minus

                                                                          
Query: 149    tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
              ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 127531 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 127472

                                                                          
Query: 209    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 127471 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 127412

                                                                          
Query: 269    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
              || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 127411 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 127352

                                                                          
Query: 329    acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
              || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 127351 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 127292

                                                                          
Query: 389    cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
              ||||| ||||| ||||||||||| |||||||| |||||||| || || || |||||||||
Sbjct: 127291 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 127232

                         
Query: 449    cgcccagacat 459
              || || |||||
Sbjct: 127231 cgacccgacat 127221



 Score =  327 bits (165), Expect = 2e-86
 Identities = 270/305 (88%)
 Strand = Plus / Plus

                                                                          
Query: 155    ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
              ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 131053 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 131112

                                                                          
Query: 215    acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
              |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 131113 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 131172

                                                                          
Query: 275    aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
              || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 131173 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 131232

                                                                          
Query: 335    cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
              || | || |||||| |  |||||||| ||||||||||||||||||||||||||||| || 
Sbjct: 131233 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 131292

                                                                          
Query: 395    accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
              || || || |||||||| ||||| || |||||||| || || || ||||||||||| |||
Sbjct: 131293 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 131352

                   
Query: 455    gacat 459
              |||||
Sbjct: 131353 gacat 131357



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
            complete cds
          Length = 2321

 Score =  355 bits (179), Expect = 9e-95
 Identities = 278/311 (89%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1858 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1799

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 1798 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 1739

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1738 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 1679

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 1678 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 1619

                                                                        
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
            ||||| ||||| ||||||||||| |||||||| |||||||| || || || |||||||||
Sbjct: 1618 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 1559

                       
Query: 449  cgcccagacat 459
            || || |||||
Sbjct: 1558 cgacccgacat 1548



to top

>ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (predicted)
            (Hist1h2bm_predicted), mRNA
          Length = 1023

 Score =  355 bits (179), Expect = 9e-95
 Identities = 278/311 (89%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||| |||||||| |||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 1013 tagccaccgaagccatagagggtacggccctggcgcttgagcgcgtagaccacgtccatg 954

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 953  gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttt 894

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 893  tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 834

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || || |||| || |||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 833  actcctccccgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 774

                                                                        
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
            || ||||| || ||||||||||| |||||||| |||||||| ||||| ||||||||||| 
Sbjct: 773  cgcaggactttgcggtggcgcttagcgccgcctttgcccagacccttcccgcccttgcct 714

                       
Query: 449  cgcccagacat 459
            || ||||||||
Sbjct: 713  cggccagacat 703



to top

>gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, complete cds
          Length = 1246

 Score =  355 bits (179), Expect = 9e-95
 Identities = 278/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 748 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 689

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 688 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 629

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 628 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 569

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 568 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 509

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           ||||| ||||| ||||||||||| |||||||| |||||||| || || || |||||||||
Sbjct: 508 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 449

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 448 cgacccgacat 438



to top

>gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds
          Length = 630

 Score =  355 bits (179), Expect = 9e-95
 Identities = 269/299 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||
Sbjct: 454 tagccgccgaagccgtagagagtgcgtccctggcgcttgagcgcgtagaccacgtccatg 395

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 335

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 334 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 275

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 274 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 215

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 214 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 156



to top

>ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611192), mRNA
          Length = 405

 Score =  351 bits (177), Expect = 1e-93
 Identities = 252/277 (90%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 403 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 344

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 343 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 284

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || |||||||||||||||||||||||||| ||||||||||| |
Sbjct: 283 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 224

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| | || |||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 223 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 164

                                                
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | || ||||| ||||||||||||||||||||||||||
Sbjct: 163 gcagcaccttgcggtggcgcttggcgccgcccttgcc 127



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC417953), mRNA
          Length = 2271

 Score =  347 bits (175), Expect = 2e-92
 Identities = 265/295 (89%)
 Strand = Plus / Minus

                                                                       
Query: 153 cgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcgg 212
           |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
Sbjct: 640 cgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggccg 581

                                                                       
Query: 213 tgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcga 272
           |||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 580 tgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcca 521

                                                                       
Query: 273 ggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacac 332
           |||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| || |
Sbjct: 520 ggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacgc 461

                                                                       
Query: 333 cgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgga 392
           |||| | ||  ||||| |  |||||||||||||||||||||||||||||||||||||| |
Sbjct: 460 cgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgca 401

                                                                  
Query: 393 ggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           | ||||| ||||||||||||||||||||||| || |||||||| |||||||||||
Sbjct: 400 gcaccttgcggtggcgcttggcgccgcccttaccgagccccttcccgcccttgcc 346



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  347 bits (175), Expect = 2e-92
 Identities = 268/299 (89%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 429 tagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatg 370

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||||||   ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 369 gccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttc 310

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 309 tccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 250

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| | |||||||||||||||||||||||||||||||||||||
Sbjct: 249 acgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcg 190

                                                                      
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || || ||||| ||||| ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 189 cgcagcaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcc 131



 Score =  339 bits (171), Expect = 5e-90
 Identities = 267/299 (89%)
 Strand = Plus / Plus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            |||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 4289 tagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatg 4348

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            || ||||| ||||||||   ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 4349 gccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttc 4408

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || ||||| | |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 4409 tccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 4468

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || ||||| | ||  ||||| | |||||||||||||||||||||||||||||||||||||
Sbjct: 4469 acgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcg 4528

                                                                       
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            || |  ||||| ||||| ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 4529 cgcaacaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcc 4587



to top

>dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930578O05 product:histone 4 protein,
           full insert sequence
          Length = 541

 Score =  341 bits (172), Expect = 1e-90
 Identities = 278/312 (89%), Gaps = 1/312 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 385 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 326

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 325 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 266

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 265 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 206

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 205 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 146

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgc-ccttgcccagccccttgccgcccttgcc 447
           ||||| ||||| ||||||||||| ||||||| | |||||||| || || || ||||||||
Sbjct: 145 cggagaaccttacggtggcgcttagcgccgcgctttgcccaggccttttcctcccttgcc 86

                       
Query: 448 gcgcccagacat 459
           ||| || |||||
Sbjct: 85  gcgacccgacat 74



to top

>gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complete cds
          Length = 1481

 Score =  341 bits (172), Expect = 1e-90
 Identities = 265/296 (89%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||||||||||||||||||  |||||||||||||||||||||| ||||||||||| 
Sbjct: 671 ccgccgaagccgtagagggtgcgttcctggcgcttgagcgcgtagaccacgtccatggcc 612

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 611 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 552

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||||| |||||| |||||||| ||||||||||||||||| || || |||||||| || 
Sbjct: 551 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgaaatgcgcttgacg 492

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | ||  ||||| |  |||||||||||||||||||||||||||||||||||||| 
Sbjct: 491 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 432

                                                                   
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || ||||| |||||||||||||||||||||||||| |||||||| |||||||||||
Sbjct: 431 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 376



to top

>gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 H4h-like mRNA,
           complete sequence
          Length = 874

 Score =  339 bits (171), Expect = 5e-90
 Identities = 276/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 350 tagccgccgaagccgtagagggtgcgaccctggcgcttgagggcgtagaccacgtccatg 291

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||| |    ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 290 gccgtgaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 231

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 230 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 171

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  ||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 170 acgccgccgcgccgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 111

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 110 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccctttgccgcccttgccc 51

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 50  cggccagacat 40



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
            genes, complete cds
          Length = 1338

 Score =  339 bits (171), Expect = 5e-90
 Identities = 267/299 (89%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1204 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1145

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            ||||| |||||||| ||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 1144 gcggtcacggtctttcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttc 1085

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || |||||| ||||||| ||   |||||||||||||||||| ||||||  ||| ||||||
Sbjct: 1084 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttc 1025

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            |||||||| |  |  ||||| |  ||||| || |||||||||||||||||||||||||||
Sbjct: 1024 acaccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcg 965

                                                                       
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            ||||| ||||| || |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 964  cggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcc 906



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  339 bits (171), Expect = 5e-90
 Identities = 267/299 (89%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1466 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1407

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            ||||| |||||||||||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 1406 gcggtcacggtcttgcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttc 1347

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || |||||| |||| || ||   |||||||||||||||||||||||||  ||| ||||||
Sbjct: 1346 tccaggaaggtcttcagcaccgtgcgggtctcctcgtagatgaggccgctgatacgcttc 1287

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            |||||||| |  |  ||||| |  ||||| || ||||| |||||||||||||||||||||
Sbjct: 1286 acaccgccacggcgagccagacggcggatagcgggcttcgtgatgccctggatgttgtcg 1227

                                                                       
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            ||||| ||||| || |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1226 cggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcc 1168



to top

>ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC486670), mRNA
          Length = 561

 Score =  337 bits (170), Expect = 2e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 559 agccgccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 500

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||| ||||||||   ||||||||| |||||||| || ||||||||||| |||||||
Sbjct: 499 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcaccgcgtcgcggatcacgttct 440

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| || ||||||||||||||||||||||| || || ||||||||||
Sbjct: 439 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgagcccagaaatgcgcttca 380

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| |  | ||| ||||  |||||||| ||||| |||||||||||||||||||| |
Sbjct: 379 ccccgcctcggcgggcaagccggcggatggcgggcttcgtgatgccctggatgttgtccc 320

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | |||||||||||||||||||||||||| |||||||||||||| |||||||| || ||||
Sbjct: 319 gcaggaccttccggtggcgcttggcgcctcccttgcccagccctttgccgcctttcccgc 260

                     
Query: 450 gcccagacat 459
           |||| |||||
Sbjct: 259 gcccggacat 250



to top

>ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA
          Length = 472

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 75  ccagacat 68



to top

>gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:6817839),
           partial cds
          Length = 457

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 316 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 257

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 256 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 197

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 196 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 137

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 77

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 76  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 17

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 16  ccagacat 9



to top

>gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:1398106),
           partial cds
          Length = 439

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 140 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 81

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 21

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 20  ccagacat 13



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Plus

                                                                          
Query: 152    ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
              |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 103956 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 104015

                                                                          
Query: 212    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 104016 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 104075

                                                                          
Query: 272    aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
              ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 104076 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 104135

                                                                          
Query: 332    ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
              || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 104136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 104195

                                                                          
Query: 392    aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
              || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 104196 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 104255

                      
Query: 452    ccagacat 459
              ||||||||
Sbjct: 104256 ccagacat 104263



 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Plus

                                                                         
Query: 149   tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
             ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 53466 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 53525

                                                                         
Query: 209   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
             |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 53526 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 53585

                                                                         
Query: 269   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
             || ||||| | ||| || || || ||||||||||||||||||||||||||||||||||||
Sbjct: 53586 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 53645

                                                                         
Query: 329   acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
             || || || | || |||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 53646 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 53705

                                                                         
Query: 389   cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
             || || || || ||||||||||| || || ||||| || || ||||||||||| || |||
Sbjct: 53706 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 53765

                        
Query: 449   cgcccagacat 459
             || ||||||||
Sbjct: 53766 cgtccagacat 53776



 Score =  317 bits (160), Expect = 2e-83
 Identities = 271/308 (87%)
 Strand = Plus / Minus

                                                                         
Query: 152   ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
             |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 84042 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 83983

                                                                         
Query: 212   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 83982 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 83923

                                                                         
Query: 272   aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
             ||||| | ||| || || |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 83922 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 83863

                                                                         
Query: 332   ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
             || || | || |||||| |  |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 83862 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 83803

                                                                         
Query: 392   aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
             || ||||| ||||||||||| |||||||| |||||||| || || || ||||| || || 
Sbjct: 83802 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 83743

                     
Query: 452   ccagacat 459
             ||||||||
Sbjct: 83742 ccagacat 83735



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                         
Query: 152   ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
             |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 12024 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 11965

                                                                         
Query: 212   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 11964 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 11905

                                                                         
Query: 272   aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
             ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 11904 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 11845

                                                                         
Query: 332   ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
             || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 11844 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 11785

                                                                         
Query: 392   aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
             || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 11784 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 11725

                     
Query: 452   ccagacat 459
             ||||||||
Sbjct: 11724 ccagacat 11717



 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                         
Query: 149   tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
             ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 62327 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 62268

                                                                         
Query: 209   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
             |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 62267 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 62208

                                                                         
Query: 269   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
             || ||||| | ||| || || || ||||||||||||||||||||||||||||||||||||
Sbjct: 62207 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 62148

                                                                         
Query: 329   acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
             || || || | || |||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 62147 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 62088

                                                                         
Query: 389   cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
             || || || || ||||||||||| || || ||||| || || ||||||||||| || |||
Sbjct: 62087 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 62028

                        
Query: 449   cgcccagacat 459
             || ||||||||
Sbjct: 62027 cgtccagacat 62017



 Score =  317 bits (160), Expect = 2e-83
 Identities = 271/308 (87%)
 Strand = Plus / Plus

                                                                         
Query: 152   ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
             |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 31942 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 32001

                                                                         
Query: 212   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 32002 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 32061

                                                                         
Query: 272   aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
             ||||| | ||| || || |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 32062 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 32121

                                                                         
Query: 332   ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
             || || | || |||||| |  |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 32122 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 32181

                                                                         
Query: 392   aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
             || ||||| ||||||||||| |||||||| |||||||| || || || ||||| || || 
Sbjct: 32182 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 32241

                     
Query: 452   ccagacat 459
             ||||||||
Sbjct: 32242 ccagacat 32249



 Score =  303 bits (153), Expect = 3e-79
 Identities = 240/269 (89%)
 Strand = Plus / Plus

                                                                          
Query: 152    ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
              |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 178557 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 178616

                                                                          
Query: 212    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 178617 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 178676

                                                                          
Query: 272    aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
              ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 178677 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 178736

                                                                          
Query: 332    ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
              || || | || |||||| |  |||||||| |||||||| |||||||||||||| || |||
Sbjct: 178737 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 178796

                                           
Query: 392    aggaccttccggtggcgcttggcgccgcc 420
              || ||||| ||||||||||| ||||||||
Sbjct: 178797 agaaccttacggtggcgcttagcgccgcc 178825



to top

>gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC:107599
           IMAGE:6787571), complete cds
          Length = 472

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 368 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 309

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 308 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 249

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 189

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 188 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 129

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 128 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 69

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 68  ccagacat 61



to top

>dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
           enriched library, clone:1810029H14 product:histone 4
           protein, full insert sequence
          Length = 472

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 75  ccagacat 68



to top

>gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, complete cds
          Length = 1470

 Score =  333 bits (168), Expect = 3e-88
 Identities = 273/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 873 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 814

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 813 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 754

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 753 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 694

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||| |||||||||||||||||||| || 
Sbjct: 693 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 634

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| ||||| || || || ||||||||||| || 
Sbjct: 633 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 574

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 573 ccagacat 566



to top

>ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA
          Length = 312

 Score =  327 bits (165), Expect = 2e-86
 Identities = 270/305 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 305 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 246

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 126

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || | || |||||| |  |||||||| ||||||||||||||||||||||||||||| || 
Sbjct: 125 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 66

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || || |||||||| ||||| || |||||||| || || || ||||||||||| |||
Sbjct: 65  actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 6

                
Query: 455 gacat 459
           |||||
Sbjct: 5   gacat 1



to top

>gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, complete cds
          Length = 1186

 Score =  327 bits (165), Expect = 2e-86
 Identities = 270/305 (88%)
 Strand = Plus / Plus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 505 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 564

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 565 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 624

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 625 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 684

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || | || |||||| |  |||||||| ||||||||||||||||||||||||||||| || 
Sbjct: 685 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 744

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || || |||||||| ||||| || |||||||| || || || ||||||||||| |||
Sbjct: 745 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 804

                
Query: 455 gacat 459
           |||||
Sbjct: 805 gacat 809



to top

>emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12)
          Length = 637

 Score =  325 bits (164), Expect = 8e-86
 Identities = 272/308 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 541 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 482

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 481 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 422

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 421 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 362

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||||||||||||||||||||| ||||||
Sbjct: 361 cccccgcgccgggccaggcggcggatggcaggcttggtgatgccctggatgttatcgcgg 302

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| || || || || || || |||||||| || 
Sbjct: 301 agaaccttacggtggcgcttagcgccgcctttcccaaggcctttaccacccttgccacgt 242

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 241 ccagacat 234



to top

>ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA
          Length = 312

 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||| ||||||||||||||||| |||
Sbjct: 131 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || || || |||||||||||||||||||| |||||||| || || || || ||||| 
Sbjct: 71  cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 12

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 11  cgaccagacat 1



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Plus

                                                                         
Query: 149   tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
             ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 32015 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 32074

                                                                         
Query: 209   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
             |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 32075 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 32134

                                                                         
Query: 269   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
             || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 32135 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 32194

                                                                         
Query: 329   acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
             || || || | || |||||| |  |||||||| ||||| ||||||||||||||||| |||
Sbjct: 32195 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 32254

                                                                         
Query: 389   cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
             || || || || |||||||||||||||||||| |||||||| || || || || ||||| 
Sbjct: 32255 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 32314

                        
Query: 449   cgcccagacat 459
             || ||||||||
Sbjct: 32315 cgaccagacat 32325



 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                         
Query: 149   tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
             ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 12261 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 12202

                                                                         
Query: 209   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
             |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 12201 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 12142

                                                                         
Query: 269   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
             || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 12141 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 12082

                                                                         
Query: 329   acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
             || || || | || |||||| |  |||||||| ||||| ||||||||||||||||| |||
Sbjct: 12081 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 12022

                                                                         
Query: 389   cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
             || || || || |||||||||||||||||||| |||||||| || || || || ||||| 
Sbjct: 12021 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 11962

                        
Query: 449   cgcccagacat 459
             || ||||||||
Sbjct: 11961 cgaccagacat 11951



to top

>ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA
          Length = 312

 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || || ||||||||||||||||||||||||||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 131 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || || || ||||||||||| || || ||||| || || ||||||||||| || |||
Sbjct: 71  cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 12

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 11  cgtccagacat 1



to top

>gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, complete cds
          Length = 1309

 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 811 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 752

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || || ||||||||||||||||||||||||||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 631 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 572

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || || || ||||||||||| || || ||||| || || ||||||||||| || |||
Sbjct: 571 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 512

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 511 cgtccagacat 501



to top

>gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, complete cds
          Length = 1309

 Score =  323 bits (163), Expect = 3e-85
 Identities = 274/311 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 811 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 752

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||| ||||||||||||||||| |||
Sbjct: 631 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 572

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || || || |||||||||||||||||||| |||||||| || || || || ||||| 
Sbjct: 571 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 512

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 511 cgaccagacat 501



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  323 bits (163), Expect = 3e-85
 Identities = 265/299 (88%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1271 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1212

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            ||||| |||||||||||||| |||||||||||||| ||||| | ||||||||||||||||
Sbjct: 1211 gcggtcacggtcttgcggcgagcgtgctcggtgtatgtgaccgagtcgcggatgacgttc 1152

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || |||||| ||||||| ||   |||||||||||||||||| ||||||  ||| ||||||
Sbjct: 1151 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttc 1092

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            |||||||| |  |  ||||| |  ||||| || |||||||||||||||||||||||||||
Sbjct: 1091 acaccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcg 1032

                                                                       
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            || || ||||| || ||||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 1031 cgaagcaccttgcgatggcgcttggcaccgcccttgcccaggcccttgccgcccttgcc 973



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Plus

                                                                          
Query: 149    tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
              ||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 171185 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 171244

                                                                          
Query: 209    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 171245 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 171304

                                                                          
Query: 269    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
              || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 171305 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 171364

                                                                          
Query: 329    acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
              || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 171365 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 171424

                                                                      
Query: 389    cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
              || || || || ||||||||||||||||| || || || ||||| || ||||||||
Sbjct: 171425 cgcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 171480



 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                          
Query: 149    tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
              ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 156396 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 156337

                                                                          
Query: 209    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 156336 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 156277

                                                                          
Query: 269    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
              || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 156276 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 156217

                                                                          
Query: 329    acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
              || || || | || |||||| |  |||||||| ||||| |||||||||||||||||||||
Sbjct: 156216 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 156157

                                                                      
Query: 389    cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
              || || || || ||||||||||| ||||| || || || ||||| || ||||||||
Sbjct: 156156 cgcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 156101



to top

>dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020002O07 product:histone 1, H4j, full insert
           sequence
          Length = 594

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 346 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 287

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 286 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 227

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 226 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 167

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 166 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 107

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||||||||| || || || ||||| || ||||||||
Sbjct: 106 cgcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 51



to top

>gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:30094179)
          Length = 3447

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 326 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 267

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 266 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 207

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 206 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 147

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 146 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 87

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||||||||| || || || ||||| || ||||||||
Sbjct: 86  cgcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 31



to top

>ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA
          Length = 312

 Score =  317 bits (160), Expect = 2e-83
 Identities = 271/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 128 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| |||||||| || || || ||||| || || 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA
          Length = 312

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||| |||||||||||||||||||||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 72

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||| ||||| || || || ||||| || ||||||||
Sbjct: 71  cgcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 16



to top

>gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, complete cds
          Length = 1309

 Score =  317 bits (160), Expect = 2e-83
 Identities = 271/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || |||||||| |||||||||||||| ||||||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 629

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 569

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| |||||||| || || || ||||| || || 
Sbjct: 568 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 509

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 508 ccagacat 501



to top

>gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, complete cds
          Length = 1309

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 811 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 752

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 631 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 572

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||||||||| || || || ||||| || ||||||||
Sbjct: 571 cgcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 516



to top

>gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, complete cds
          Length = 1776

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 845 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 786

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 785 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 726

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 725 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 666

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||| |||||||||||||||||||||
Sbjct: 665 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 606

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||| ||||| || || || ||||| || ||||||||
Sbjct: 605 cgcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 550



to top

>ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA
          Length = 312

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||||| ||||||||||||||||||||||| |||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 72

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||||||||| || || || ||||| || ||||||||
Sbjct: 71  cgcagcactttgcggtggcgcttggcgccacctttaccgagccctttcccgccctt 16



to top

>gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8
          Length = 675

 Score =  317 bits (160), Expect = 2e-83
 Identities = 262/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 578 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 519

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 518 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctca 459

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||||| |||||| |||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 458 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 399

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | ||  ||||| |  || |||||||||||||||||||||||||| |||||||| 
Sbjct: 398 ccgccgcgccgcgccaggcggcgaatggccggcttggtgatgccctggatattgtcgcgc 339

                                                                   
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||||||
Sbjct: 338 agcaccttgcggtggcgcttggcaccccctttgccgagccccttcccgcccttgcc 283



to top

>gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA (cDNA clone
           MGC:124607 IMAGE:7938313), complete cds
          Length = 1326

 Score =  315 bits (159), Expect = 8e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| |||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 334 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 275

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 274 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 215

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 214 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 155

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  || ||||| |||||||||||||||||||||||||||
Sbjct: 154 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 95

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || ||||| || ||||||||||| |||||||| |||||||  || || ||||| ||||| 
Sbjct: 94  cgcaggactttgcggtggcgcttagcgccgcctttgcccaagcctttcccgcctttgcct 35

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 34  cggccagacat 24



to top

>ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (Hist1h4b), mRNA
          Length = 1296

 Score =  315 bits (159), Expect = 8e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| |||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 330 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 271

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 270 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 211

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 210 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 151

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  || ||||| |||||||||||||||||||||||||||
Sbjct: 150 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 91

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || ||||| || ||||||||||| |||||||| |||||||  || || ||||| ||||| 
Sbjct: 90  cgcaggactttgcggtggcgcttagcgccgcctttgcccaagcctttcccgcctttgcct 31

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 30  cggccagacat 20



to top

>gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA, complete cds
          Length = 1296

 Score =  315 bits (159), Expect = 8e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| |||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 330 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 271

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 270 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 211

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 210 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 151

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  || ||||| |||||||||||||||||||||||||||
Sbjct: 150 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 91

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || ||||| || ||||||||||| |||||||| |||||||  || || ||||| ||||| 
Sbjct: 90  cgcaggactttgcggtggcgcttagcgccgcctttgcccaagcctttcccgcctttgcct 31

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 30  cggccagacat 20



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  315 bits (159), Expect = 8e-83
 Identities = 264/299 (88%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            ||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1279 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1220

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            || || |||||||||||||| |||||||||||||||||||||| ||||||||||||||||
Sbjct: 1219 gcagtcacggtcttgcggcgagcgtgctcggtgtaggtgacggagtcgcggatgacgttc 1160

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || |||||| ||||||| ||   |||||||||||||||||| |||||   ||| ||||||
Sbjct: 1159 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccactgatacgcttc 1100

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            |||||||| |  |  ||||| |  ||||| || ||||||||||| ||||||||||| |||
Sbjct: 1099 acaccgccacggcgagccagacggcggatagcgggcttggtgatcccctggatgttatcg 1040

                                                                       
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
            || || ||||| || |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1039 cgaagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcc 981



to top

>gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:60536
           IMAGE:30017176), complete cds
          Length = 724

 Score =  309 bits (156), Expect = 5e-81
 Identities = 270/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 140 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 81

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 21

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 20  ccagacat 13



to top

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  309 bits (156), Expect = 5e-81
 Identities = 270/308 (87%)
 Strand = Plus / Plus

                                                                         
Query: 152   ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
             |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 58372 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 58431

                                                                         
Query: 212   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 58432 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 58491

                                                                         
Query: 272   aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
             ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 58492 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 58551

                                                                         
Query: 332   ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
             || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 58552 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 58611

                                                                         
Query: 392   aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
             || || || |||||||||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 58612 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 58671

                     
Query: 452   ccagacat 459
             ||||||||
Sbjct: 58672 ccagacat 58679



to top

>gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:106611
           IMAGE:30612926), complete cds
          Length = 562

 Score =  309 bits (156), Expect = 5e-81
 Identities = 270/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 37  ccagacat 30



to top

>ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA
          Length = 562

 Score =  309 bits (156), Expect = 5e-81
 Identities = 270/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 37  ccagacat 30



to top

>dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310067E17 product:histone 4 protein,
           full insert sequence
          Length = 778

 Score =  309 bits (156), Expect = 5e-81
 Identities = 261/296 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 347 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 288

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 287 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 228

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| || || |||||||||||||||||||||||||||||||||||||||
Sbjct: 227 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 168

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || | || |||||| |  |||||| | ||||| |||||||||||||||||||||
Sbjct: 167 actcccccgcgccgggccaggcggcggatgacgggcttcgtgatgccctggatgttgtcg 108

                                                                   
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           || || || || ||||||||||| ||||| || || || ||||| || ||||||||
Sbjct: 107 cgcagcactttgcggtggcgcttagcgccacctttaccgagccctttcccgccctt 52



to top

>gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, complete cds
          Length = 1309

 Score =  309 bits (156), Expect = 5e-81
 Identities = 270/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 569

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 568 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 509

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 508 ccagacat 501



to top

>gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds
          Length = 451

 Score =  305 bits (154), Expect = 8e-80
 Identities = 271/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||| || ||||| | |||||| | |||||||||||| |||||||||||||
Sbjct: 310 agccgccgaagccatacagggtcctgccctgcctcttgagcgcgtacacgacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||| || ||||| ||||| |||||||| |||||||| |||||||||||||| |||||||
Sbjct: 250 cggtcaccgtcttccggcgcgcgtgctccgtgtaggtcacggcgtcgcggatcacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||||||||| || ||||||||||||||||||||||| || |||  ||| |||||||
Sbjct: 190 ccaggaagatcttcagcacgccgcgggtctcctcgtagatcagcccgctgatccgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| |  | |||||||| |||||| |||||||| ||||||||||||||||||||||
Sbjct: 130 ccccgccacggcgggccagccgccggatcgccggcttcgtgatgccctggatgttgtcgc 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | |||||||| | ||| ||||| |||||||||||||| ||||||||||| ||||||||||
Sbjct: 70  gcaggacctttctgtgccgcttcgcgccgcccttgccaagccccttgcctcccttgccgc 11

                     
Query: 450 gcccagacat 459
           | || |||||
Sbjct: 10  ggcccgacat 1



to top

>ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA
          Length = 312

 Score =  303 bits (153), Expect = 3e-79
 Identities = 240/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||| |||||||||||||| || |||
Sbjct: 128 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 69

                                        
Query: 392 aggaccttccggtggcgcttggcgccgcc 420
           || ||||| ||||||||||| ||||||||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcc 40



to top

>gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, complete cds
          Length = 1309

 Score =  303 bits (153), Expect = 3e-79
 Identities = 240/269 (89%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||| |||||||||||||| || |||
Sbjct: 628 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 569

                                        
Query: 392 aggaccttccggtggcgcttggcgccgcc 420
           || ||||| ||||||||||| ||||||||
Sbjct: 568 agaaccttacggtggcgcttagcgccgcc 540



to top

>gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:4205460),
           partial cds
          Length = 733

 Score =  301 bits (152), Expect = 1e-78
 Identities = 269/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || ||||| |||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 97  agcactttgcggtgacgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 37  ccagacat 30



to top

>dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610027B07 product:histone 4
           protein, full insert sequence
          Length = 720

 Score =  301 bits (152), Expect = 1e-78
 Identities = 269/308 (87%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 348 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 289

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           |||||||||| |||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 288 gtgacggtctcgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 229

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||| || || ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 228 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 169

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || | || |||||| |  |||||||| |||||||||||||||||||||||||| || 
Sbjct: 168 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 109

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || || || |||||||||||||||||||| |||||||| || || || || ||||| || 
Sbjct: 108 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 49

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 48  ccagacat 41



to top

>emb|X13236.1|MMHIS453 Mouse histone H4 gene
          Length = 1678

 Score =  299 bits (151), Expect = 5e-78
 Identities = 266/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| ||||||||||||||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 964 ccgaatccgtagagggtgcggccctggcgyttgagccggtagaccacgtccatggcggtg 905

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 904 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 845

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 844 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 785

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || | || |||||| |  |||||||| ||||| ||||||||||||||||||||||| || 
Sbjct: 784 ccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgcgcagc 725

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || || |||||||| ||||| || |||||||| || || || ||||||||||| |||
Sbjct: 724 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 665

                
Query: 455 gacat 459
           |||||
Sbjct: 664 gacat 660



to top

>ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC527645), mRNA
          Length = 312

 Score =  297 bits (150), Expect = 2e-77
 Identities = 270/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| || || ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           |||| || |  |  ||||| | ||| || || |||||||| |||||||||||||| || |
Sbjct: 130 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | ||||| || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 70  gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 11

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 10  gaccagacat 1



to top

>gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:8186024)
          Length = 409

 Score =  297 bits (150), Expect = 2e-77
 Identities = 270/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 340 agccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 281

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 280 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 221

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| || || ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 220 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 161

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           |||| || |  |  ||||| | ||| || || |||||||| |||||||||||||| || |
Sbjct: 160 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 101

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | ||||| || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 100 gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 41

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 40  gaccagacat 31



to top

>gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds
          Length = 561

 Score =  297 bits (150), Expect = 2e-77
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 358 ccgaagccgtagagggtgcggccctggcgcttgagagcgtagacaacgtccatggcggtg 299

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||| ||||| |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 298 acggtcttccggcgagcgtgctccgtgtaggtgacggcgtcgcggataacgttctccagg 239

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           ||||||||||| ||||| |  ||||||||||||||||| |||  ||| |||||||| || 
Sbjct: 238 aagatcttgagcacgcctcttgtctcctcgtagatgagaccgctgatacgcttcacgcca 179

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || | ||  || || | ||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 178 ccacgccgtgcgagacgccggatggcgggcttggtgatgccctggatgttgtcccggagg 119

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           ||||| ||| ||||||| || || ||||| ||||  ||||| || |||||||| || || 
Sbjct: 118 accttgcgggggcgctttgcacctccctttcccaaacccttacctcccttgcctcgtccc 59

                 
Query: 455 gacatc 460
           ||||||
Sbjct: 58  gacatc 53



to top

>ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (predicted)
           (Hist1h4m_predicted), mRNA
          Length = 312

 Score =  295 bits (149), Expect = 7e-77
 Identities = 266/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           |||||||||||||| ||||||||||||||||| ||||| ||||| || |||||||| |||
Sbjct: 305 ccgaagccgtagagagtgcggccctggcgcttaagcgcatagacaacatccatggcagtg 246

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acagtcttgcgcttggcgtgctctgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 126

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           |||| ||  ||||  |  |||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 125 ccccgccgagccaagcggcggatggcgggcttagtgatgccctggatgttgtcgcgcagg 66

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| |||||||| ||||| |||||||| || || |||
Sbjct: 65  actttgcggtggcgcttagcgccgcctttgcccagacccttcccgcccttacctcggcca 6

                
Query: 455 gacat 459
           |||||
Sbjct: 5   gacat 1



to top

>ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC528329), mRNA
          Length = 312

 Score =  289 bits (146), Expect = 4e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||||||||| ||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagcgtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| || || ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           |||| || |  |  ||||| | ||| || || |||||||| |||||||||||||| || |
Sbjct: 130 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 71

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | ||||| || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 70  gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 11

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 10  gaccagacat 1



to top

>gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408
          Length = 392

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                
Query: 455 gacat 459
           |||||
Sbjct: 24  gacat 20



to top

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Plus

                                                                         
Query: 155   ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 70023 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 70082

                                                                         
Query: 215   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 70083 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 70142

                                                                         
Query: 275   aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
             || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 70143 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 70202

                                                                         
Query: 335   cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
             || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 70203 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 70262

                                                                         
Query: 395   accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
             || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 70263 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 70322

                  
Query: 455   gacat 459
             |||||
Sbjct: 70323 gacat 70327



 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                         
Query: 155   ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 63229 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 63170

                                                                         
Query: 215   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 63169 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 63110

                                                                         
Query: 275   aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
             || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 63109 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 63050

                                                                         
Query: 335   cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
             || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 63049 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 62990

                                                                         
Query: 395   accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
             || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 62989 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 62930

                  
Query: 455   gacat 459
             |||||
Sbjct: 62929 gacat 62925



 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Minus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||| ||||| || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 21251 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 21192

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 21191 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 21132

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             | |  || |  || || || ||||| ||||||||||| || ||||| ||||||||||| |
Sbjct: 21131 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 21072

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | || || | ||  ||||| |  |||||||| ||||||||||||||||| ||||||||||
Sbjct: 21071 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 21012

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             | || || || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 21011 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 20952

                       
Query: 450   gcccagacat 459
             ||||||||||
Sbjct: 20951 gcccagacat 20942



to top

>ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA
          Length = 356

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 455 gacat 459
           |||||
Sbjct: 5   gacat 1



to top

>ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA
          Length = 354

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 455 gacat 459
           |||||
Sbjct: 5   gacat 1



to top

>ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal histone H4 gene
           (LOC674678), mRNA
          Length = 2984

 Score =  287 bits (145), Expect = 2e-74
 Identities = 256/293 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||||||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 476 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 417

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || |||
Sbjct: 416 gccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattc 357

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 356 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 297

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  |||| || |||||| || |||||||| ||||||||||||||||||
Sbjct: 296 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 237

                                                                
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
           ||||| ||||| ||||| ||||||||||| || || ||||| |||||||||||
Sbjct: 236 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgccgcc 184



to top

>gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, complete cds
          Length = 930

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                
Query: 455 gacat 459
           |||||
Sbjct: 315 gacat 311



to top

>gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, complete cds
          Length = 930

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 616 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 557

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 556 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 497

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 496 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 437

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 436 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 377

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 376 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 317

                
Query: 455 gacat 459
           |||||
Sbjct: 316 gacat 312



to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score =  287 bits (145), Expect = 2e-74
 Identities = 256/293 (87%)
 Strand = Plus / Minus

                                                                          
Query: 149    tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
              ||||||||||||||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 113214 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 113155

                                                                          
Query: 209    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
              || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 113154 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 113095

                                                                          
Query: 269    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
              || ||||| | ||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 113094 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 113035

                                                                          
Query: 329    acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
              || ||||| | ||  |||| || |||||| || |||||||| ||||||||||||||||||
Sbjct: 113034 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 112975

                                                                   
Query: 389    cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
              ||||| ||||| ||||| ||||||||||| || || ||||| |||||||||||
Sbjct: 112974 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgccgcc 112922



to top

>emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA
          Length = 586

 Score =  287 bits (145), Expect = 2e-74
 Identities = 259/297 (87%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||||||||||||||| |||||||||||||| | ||| || ||||| || ||||||||
Sbjct: 319 ctagccgccgaagccgtacagggtgcggccctgcctcttcagggcgtacaccacgtccat 260

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||| || || ||||| |    ||||||||| ||||||||||||||||||||||| |||||
Sbjct: 259 ggccgtcaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgtt 200

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || |||||||||||||||||||| |||||||||||||||||
Sbjct: 199 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatcaggccggagatgcgctt 140

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
           ||| ||||| | ||  ||||| |  |||||||| ||||||||||||||||||||||||||
Sbjct: 139 cacgccgccgcgccgcgccaggcggcggatggcgggcttggtgatgccctggatgttgtc 80

                                                                    
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           |||||||||||| |||||||||||||||||||| |||||||| || ||||| |||||
Sbjct: 79  gcggaggaccttgcggtggcgcttggcgccgcctttgcccagacctttgcctccctt 23



to top

>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2
             Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs,
             STSs, GSSs and three CpG islands, complete sequence
          Length = 24706

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Plus

                                                                         
Query: 155   ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 19570 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 19629

                                                                         
Query: 215   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 19630 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 19689

                                                                         
Query: 275   aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
             || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 19690 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 19749

                                                                         
Query: 335   cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
             || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 19750 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 19809

                                                                         
Query: 395   accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
             || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 19810 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 19869

                  
Query: 455   gacat 459
             |||||
Sbjct: 19870 gacat 19874



 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                         
Query: 155   ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 12776 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 12717

                                                                         
Query: 215   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 12716 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 12657

                                                                         
Query: 275   aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
             || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 12656 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 12597

                                                                         
Query: 335   cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
             || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 12596 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 12537

                                                                         
Query: 395   accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
             || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 12536 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 12477

                  
Query: 455   gacat 459
             |||||
Sbjct: 12476 gacat 12472



to top

>emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone
          Length = 859

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                
Query: 455 gacat 459
           |||||
Sbjct: 315 gacat 311



to top

>emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone
          Length = 1528

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 916 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 857

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 856 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 797

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 796 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 737

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 736 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 677

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 676 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 617

                
Query: 455 gacat 459
           |||||
Sbjct: 616 gacat 612



to top

>gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, complete cds
          Length = 416

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                
Query: 455 gacat 459
           |||||
Sbjct: 24  gacat 20



to top

>gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, complete cds
          Length = 1200

 Score =  287 bits (145), Expect = 2e-74
 Identities = 256/293 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||||||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 702 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 643

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 642 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 583

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 582 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 523

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  |||| || |||||| || |||||||| ||||||||||||||||||
Sbjct: 522 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 463

                                                                
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
           ||||| ||||| ||||| ||||||||||| || || ||||| |||||||||||
Sbjct: 462 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgccgcc 410



to top

>gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:40040608),
           partial cds
          Length = 311

 Score =  287 bits (145), Expect = 2e-74
 Identities = 256/293 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||||||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 310 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 251

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || |||
Sbjct: 250 gccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattc 191

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 190 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 131

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  |||| || |||||| || |||||||| ||||||||||||||||||
Sbjct: 130 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 71

                                                                
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
           ||||| ||||| ||||| ||||||||||| || || ||||| |||||||||||
Sbjct: 70  cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgccgcc 18



to top

>gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA clone ZE16D01
          Length = 382

 Score =  287 bits (145), Expect = 2e-74
 Identities = 265/305 (86%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 322 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 263

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 262 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 203

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 202 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 143

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 142 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 83

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 82  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 23

                
Query: 455 gacat 459
           |||||
Sbjct: 22  gacat 18



to top

>ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA
          Length = 312

 Score =  287 bits (145), Expect = 2e-74
 Identities = 256/293 (87%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||||||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 311 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 251 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 191 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| | ||  |||| || |||||| || |||||||| ||||||||||||||||||
Sbjct: 131 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 72

                                                                
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
           ||||| ||||| ||||| ||||||||||| || || ||||| |||||||||||
Sbjct: 71  cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgccgcc 19



to top

>gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence
          Length = 248

 Score =  283 bits (143), Expect = 3e-73
 Identities = 158/163 (96%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 163 cctagccgccgaagccgtagagggtgcggccctggcgcttaagcgcgtagacgacgtcca 104

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 103 tggcggtgacggtcttacggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacgt 44

                                                      
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagat 309
           |||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 43  tctccaggaagatcttgagcacgccgcgggtctcctcgtagat 1



to top

>emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA
          Length = 522

 Score =  281 bits (142), Expect = 1e-72
 Identities = 262/302 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||| ||||||||||| |||||||| ||||| |||||||||||||| || || ||||||
Sbjct: 344 tagcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatg 285

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||| |    |||||||||||||||||||||||| || ||||| ||||||
Sbjct: 284 gcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttc 225

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | |||||| ||||||||||||||||||||||| ||||| ||||||||||| 
Sbjct: 224 tccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttg 165

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  ||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 164 acgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 105

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           ||||| ||||| ||||||||||||||||| || |||||||| || ||||| || ||||||
Sbjct: 104 cggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccg 45

             
Query: 449 cg 450
           ||
Sbjct: 44  cg 43



to top

>emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA
          Length = 625

 Score =  281 bits (142), Expect = 1e-72
 Identities = 262/302 (86%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||| ||||||||||| |||||||| ||||| |||||||||||||| || || ||||||
Sbjct: 444 tagcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatg 385

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||||||||| |    |||||||||||||||||||||||| || ||||| ||||||
Sbjct: 384 gcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttc 325

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | |||||| ||||||||||||||||||||||| ||||| ||||||||||| 
Sbjct: 324 tccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttg 265

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  ||||| |  |||||||| |||||||||||||||||||||||||||
Sbjct: 264 acgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 205

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           ||||| ||||| ||||||||||||||||| || |||||||| || ||||| || ||||||
Sbjct: 204 cggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccg 145

             
Query: 449 cg 450
           ||
Sbjct: 144 cg 143



to top

>gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, complete cds
          Length = 394

 Score =  280 bits (141), Expect = 4e-72
 Identities = 237/269 (88%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 326 tagccgccgaagccgtagagcgtgcggccctggcgcttgagcgcgtagacaacgtccatg 267

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || ||||| |||||||| | ||||||||| ||||| ||||| | ||||||||||||||||
Sbjct: 266 gccgtgaccgtcttgcgcctggcgtgctccgtgtacgtgaccgagtcgcggatgacgttc 207

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           |||||||||| |||||| |||||||| ||||||||||||||||| |||  ||||||||| 
Sbjct: 206 tcgaggaagaccttgagcacgccgcgcgtctcctcgtagatgagcccgctgatgcgcttg 147

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || || || |  |  ||||| |  ||||||||||||||||||||||||||||||||||||
Sbjct: 146 acgcccccgcggcgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 87

                                        
Query: 389 cggaggaccttccggtggcgcttggcgcc 417
           || || ||||| ||||| | |||||||||
Sbjct: 86  cgcagcaccttgcggtgcctcttggcgcc 58



to top

>emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.2 genes for histone H3 and for
            histone H4
          Length = 1860

 Score =  278 bits (140), Expect = 2e-71
 Identities = 266/308 (86%)
 Strand = Plus / Minus

                                                                        
Query: 152  ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
            |||||||| |||||||||||||| |||||||||||||| ||||||||||| || |  | |
Sbjct: 1596 ccgccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgag 1537

                                                                        
Query: 212  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
            ||||||||||||||   ||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1536 gtgacggtcttgcgcttggcgtgctcagtgtaggtgacggcgtcacggatgacgttctcg 1477

                                                                        
Query: 272  aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
            ||||||| ||||||||||  |||||||||||||||||||||||||||||| ||||| |||
Sbjct: 1476 aggaagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgaca 1417

                                                                        
Query: 332  ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
            || || |  | ||| || |  |||||||| ||||||||||| |||||||||||||| || 
Sbjct: 1416 ccaccacgacgggcgagacgacggatggcgggcttggtgattccctggatgttgtcacga 1357

                                                                        
Query: 392  aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
            || | ||| ||||| |||||||| |||||||| || || ||||| || ||||||||||| 
Sbjct: 1356 agaatcttgcggtgacgcttggcaccgccctttccgagaccctttcctcccttgccgcgg 1297

                    
Query: 452  ccagacat 459
            ||||||||
Sbjct: 1296 ccagacat 1289



to top

>dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130044J01 product:H4 HISTONE
           homolog [Homo sapiens], full insert sequence
          Length = 2875

 Score =  274 bits (138), Expect = 3e-70
 Identities = 256/294 (87%), Gaps = 1/294 (0%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||||||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 358 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 299

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 298 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 239

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||||||||| ||||| ||||||||||||||||| || ||||||||||||
Sbjct: 238 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 179

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgat-gccctggatgttgtc 387
           || ||||| | ||  |||| || |||||| || |||||||| || |||||||||||||||
Sbjct: 178 acgccgccacgccgagccaaccgccggatagcgggcttggtaatggccctggatgttgtc 119

                                                                 
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
           |||||| ||||| ||||| ||||||||||| || || ||||| |||||||||||
Sbjct: 118 gcggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgccgcc 65



to top

>gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:5359141), with
           apparent retained intron
          Length = 1631

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 319 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 260

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 259 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 200

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 199 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 140

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 139 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 80

                                                                    
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
            || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 79  acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 23



to top

>emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4
          Length = 968

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 569 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 510

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 509 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 450

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 449 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 390

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 389 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 330

                                                                    
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
            || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 329 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 273



to top

>ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA
          Length = 400

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 341 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 282

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 281 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 222

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 221 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 162

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 161 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 102

                                                                    
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
            || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 101 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 45



to top

>gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, complete cds
          Length = 1309

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 812 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 753

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 752 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 693

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 692 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 633

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 632 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 573

                                                                    
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
            || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 572 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 516



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Plus

                                                                         
Query: 148   ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
             |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 87632 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 87691

                                                                         
Query: 208   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
              |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 87692 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 87751

                                                                         
Query: 268   ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
             ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 87752 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 87811

                                                                         
Query: 328   cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
              || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 87812 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 87871

                                                                      
Query: 388   gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
              || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 87872 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 87928



to top

>gb|AY104535.1| Zea mays PCO094675 mRNA sequence
          Length = 995

 Score =  272 bits (137), Expect = 1e-69
 Identities = 183/197 (92%), Gaps = 1/197 (0%)
 Strand = Plus / Plus

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           |||||||||||||||||| |||||||||||||||||||||||||| || || ||||||||
Sbjct: 756 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccagaaatgcgctt 815

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || |||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 816 gacgccgcccctcctggccagcctacggatcgccggcttcgtgatgccctggatgttgtc 875

                                                                       
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           ||| | | |||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 876 gcgca-gcccttgcggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 934

                            
Query: 448 gcgcccagacatcgccg 464
           |||||| ||||||||||
Sbjct: 935 gcgccccgacatcgccg 951



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                         
Query: 148   ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
             |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 13061 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 13002

                                                                         
Query: 208   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
              |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 13001 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 12942

                                                                         
Query: 268   ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
             ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 12941 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 12882

                                                                         
Query: 328   cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
              || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 12881 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 12822

                                                                      
Query: 388   gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
              || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 12821 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 12765



to top

>gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:1446370)
          Length = 358

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 333 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 274

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 273 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 214

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || || |||||||||||||||||||||||||||||||||||
Sbjct: 213 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 154

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || || || | ||  ||||| |  |||||||| ||||||||||| ||||||||||||||
Sbjct: 153 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 94

                                                                    
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
            || | ||| || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 93  acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 37



to top

>gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79353
           IMAGE:7002105), complete cds
          Length = 365

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 11  cggccagacat 1



to top

>gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79354
           IMAGE:7002106), complete cds
          Length = 365

 Score =  268 bits (135), Expect = 2e-68
 Identities = 267/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 11  cggccagacat 1



to top

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score =  264 bits (133), Expect = 3e-67
 Identities = 262/305 (85%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 830 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 771

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 770 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 711

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 710 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 651

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || | |||||| ||||||||||||||||||||||| |||||||| |  
Sbjct: 650 ccgcggcgagcaaggcgccggatagccggcttggtgatgccctggatattgtcgcgcaat 591

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || || |||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 590 actttacgatggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 531

                
Query: 455 gacat 459
           |||||
Sbjct: 530 gacat 526



to top

>emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score =  264 bits (133), Expect = 3e-67
 Identities = 260/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||| ||||||||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 341 agcctccgaagccgtacagggtgcgcccctgccgcttgagcgcgtacaccacatccatgg 282

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||||||||| |    |||||||||||||||||||||||| || ||||| |||||||
Sbjct: 281 cggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttct 222

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | |||||| ||||||||||||||||||||||| ||||| ||||||||||| |
Sbjct: 221 ccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttga 162

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| |  |  ||||| |  |||||||| ||||||||||||||||||||||||||||
Sbjct: 161 cgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 102

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||  ||||| ||||||||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 101 gga-caccttgcggtggcgcttggcgccccctttgcccaggcctttgcctcctttgccgc 43

            
Query: 450 g 450
           |
Sbjct: 42  g 42



to top

>dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-19327, similar to human
           histone 1, H4j (HIST1H4J), mRNA, RefSeq: NM_021968.3
          Length = 2002

 Score =  262 bits (132), Expect = 1e-66
 Identities = 264/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           |||||||| |||||||||||||| ||||||||||| |||||||| || || |||||||||
Sbjct: 393 ccgccgaaaccgtagagggtgcgaccctggcgcttcagcgcgtaaaccacatccatggcg 334

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| |||||||| || ||||| ||||| |||||||| 
Sbjct: 333 gtgaccgtcttgcgcttggcgtgctccgtgtaggtcacagcgtcccggatcacgttctcc 274

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |||||||  || || || || |||||||||||||||||||| || |||||||||||||| 
Sbjct: 273 aggaagactttcagcaccccacgggtctcctcgtagatgagaccagagatgcgcttcacg 214

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| |  |  || || | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 213 ccgccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatgttgtcacgc 154

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| 
Sbjct: 153 agcaccttgcggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcgg 94

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 93  ccagacat 86



to top

>gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:24014
           IMAGE:4101102), complete cds
          Length = 1260

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 342 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 283

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 282 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 223

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 222 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 163

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 162 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 103

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 102 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 43

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 42  cgtcctgacat 32



to top

>gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, complete cds
          Length = 930

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 622 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 563

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 562 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 503

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 502 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 443

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 442 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 383

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 382 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 323

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 322 cgtcctgacat 312



to top

>gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:87855
           IMAGE:5225467), complete cds
          Length = 1418

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 323 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 264

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 263 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 204

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 203 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 144

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 143 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 84

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 83  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 24

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 23  cgtcctgacat 13



to top

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                         
Query: 149   tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
             |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 62924 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 62865

                                                                         
Query: 209   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
             |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 62864 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 62805

                                                                         
Query: 269   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
             || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 62804 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 62745

                                                                         
Query: 329   acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
             || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 62744 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 62685

                                                                         
Query: 389   cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
             || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 62684 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 62625

                        
Query: 449   cgcccagacat 459
             || || |||||
Sbjct: 62624 cgtcctgacat 62614



to top

>emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1321

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 326 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 267

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 266 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 207

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 206 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 147

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 146 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 87

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 86  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 27

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 26  cgtcctgacat 16



to top

>gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete cds
          Length = 594

 Score =  260 bits (131), Expect = 4e-66
 Identities = 230/263 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           |||||||||||||| |||||||||||||| || ||||||||||| ||||||||||| |||
Sbjct: 494 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 435

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 434 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 375

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 374 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 315

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || | || |||||| |  |||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 314 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcagg 255

                                  
Query: 395 accttccggtggcgcttggcgcc 417
           || || || || ||||| |||||
Sbjct: 254 actttgcgatgacgcttagcgcc 232



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score =  260 bits (131), Expect = 4e-66
 Identities = 254/295 (86%)
 Strand = Plus / Plus

                                                                          
Query: 150    agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
              |||||||||||||||| | ||||||||||||||||||||||||||| |||||||| |  |
Sbjct: 656515 agccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgagcg 656574

                                                                          
Query: 210    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
               |||||||||||||||   |||||||||||||||||||||||||||||||||||||  ||
Sbjct: 656575 aggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacggact 656634

                                                                          
Query: 270    cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
              | ||||    |||||| ||  ||||    |||||||| |||||||||||||||||||| |
Sbjct: 656635 ccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgcttga 656694

                                                                          
Query: 330    caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
              | ||||| |  | |||||| | | ||||||| ||||||||||||||||||||||||||||
Sbjct: 656695 cgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtcgc 656754

                                                                     
Query: 390    ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
              |||||| ||| ||||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 656755 ggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 656809



to top

>ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA
          Length = 312

 Score =  260 bits (131), Expect = 4e-66
 Identities = 254/295 (86%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||||||||||||||| | ||||||||||||||||||||||||||| |||||||| |  |
Sbjct: 310 agccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgagcg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
            |||||||||||||||   |||||||||||||||||||||||||||||||||||||  ||
Sbjct: 250 aggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacggact 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||    |||||| ||  ||||    |||||||| |||||||||||||||||||| |
Sbjct: 190 ccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgcttga 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | ||||| |  | |||||| | | ||||||| ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                  
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           |||||| ||| ||||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 70  ggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 16



to top

>gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79352
           IMAGE:7002103), complete cds
          Length = 364

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| ||||||||  ||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcgcggcgtcccggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 11  cggccagacat 1



to top

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6
          Length = 20621

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                         
Query: 149   tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
             |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 12125 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 12066

                                                                         
Query: 209   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
             |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 12065 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 12006

                                                                         
Query: 269   tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
             || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 12005 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 11946

                                                                         
Query: 329   acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
             || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 11945 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 11886

                                                                         
Query: 389   cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
             || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 11885 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 11826

                        
Query: 449   cgcccagacat 459
             || || |||||
Sbjct: 11825 cgtcctgacat 11815



to top

>ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA
          Length = 370

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 449 cgcccagacat 459
           || || |||||
Sbjct: 11  cgtcctgacat 1



to top

>gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histone H4t, complete cds
          Length = 6861

 Score =  260 bits (131), Expect = 4e-66
 Identities = 230/263 (87%)
 Strand = Plus / Plus

                                                                        
Query: 155  ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
            |||||||||||||| |||||||||||||| || ||||||||||| ||||||||||| |||
Sbjct: 4742 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 4801

                                                                        
Query: 215  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
            || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 4802 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 4861

                                                                        
Query: 275  aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
            || | ||| || || ||||||||||||||||||||||||||||||||||||||||| || 
Sbjct: 4862 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 4921

                                                                        
Query: 335  cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
            || | || |||||| |  |||||||| ||||| ||||||||||||||||||||||| |||
Sbjct: 4922 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcagg 4981

                                   
Query: 395  accttccggtggcgcttggcgcc 417
            || || || || ||||| |||||
Sbjct: 4982 actttgcgatgacgcttagcgcc 5004



to top

>dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds
          Length = 1293

 Score =  260 bits (131), Expect = 4e-66
 Identities = 266/311 (85%)
 Strand = Plus / Minus

                                                                        
Query: 149  tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
            |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1031 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 972

                                                                        
Query: 209  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
            |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 971  gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 912

                                                                        
Query: 269  tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
            || ||||| | ||| |  || |||||||||||||| ||||||||||| || |||||||||
Sbjct: 911  tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 852

                                                                        
Query: 329  acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
            || ||||| |  |  || || | ||| ||||| ||||||||||| |||||||||||||||
Sbjct: 851  acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 792

                                                                        
Query: 389  cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
            || || ||||| |||||||||||||| || || || ||||| ||||| || || ||||||
Sbjct: 791  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 732

                       
Query: 449  cgcccagacat 459
            || || |||||
Sbjct: 731  cgtcctgacat 721



to top

>gb|AY389612.1| Hyacinthus orientalis unknown mRNA
          Length = 436

 Score =  258 bits (130), Expect = 2e-65
 Identities = 233/266 (87%), Gaps = 1/266 (0%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 266 cctagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagacgacgtcca 207

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           | || || || ||||| ||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 206 tcgccgtcaccgtcttccggcgcgcgtgctcggtgtaggtgacggcgtcacggatgacgt 147

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||||||||||||||||||||| ||||| ||||||||||||||||| |||   || | ||
Sbjct: 146 tctcgaggaagatcttgaggaccccgcgcgtctcctcgtagatgagcccgcttatcctct 87

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           |||| || || |  |  ||||| |  ||||| |||||||| |||||||||||||||||||
Sbjct: 86  tcactcctccacggcgagccaggcggcggatcgccggcttcgtgatgccctggatgttgt 27

                                     
Query: 387 -cgcggaggaccttccggtggcgctt 411
            | ||||| |||| ||||||||||||
Sbjct: 26  ccccggagtacctgccggtggcgctt 1



to top

>emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes for histone H3 and histone H4
          Length = 1630

 Score =  256 bits (129), Expect = 6e-65
 Identities = 261/305 (85%)
 Strand = Plus / Minus

                                                                        
Query: 155  ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
            ||||| |||||||||||||| |||||||||||||| ||||||||||| || |  | ||||
Sbjct: 1394 ccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgaggtg 1335

                                                                        
Query: 215  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
            |||||||||||   ||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1334 acggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcgagg 1275

                                                                        
Query: 275  aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
            |||| ||||||||||  |||||||||||||||||||||||||||||| ||||| ||||| 
Sbjct: 1274 aagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgacacca 1215

                                                                        
Query: 335  cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
            || |  | ||| || |  ||||| || ||||||||||| |||||||||||||| || || 
Sbjct: 1214 ccacgacgggcgagacggcggatagcgggcttggtgattccctggatgttgtcacgaaga 1155

                                                                        
Query: 395  accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
            | ||| |||||||||||||| || ||||| || || ||||| || || || ||||| |||
Sbjct: 1154 atcttgcggtggcgcttggcaccaccctttccgagaccctttcctcctttaccgcggcca 1095

                 
Query: 455  gacat 459
            |||||
Sbjct: 1094 gacat 1090



to top

>ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (predicted)
           (Hist2h4_predicted), mRNA
          Length = 312

 Score =  244 bits (123), Expect = 2e-61
 Identities = 240/279 (86%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||| ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtacagggttcggccctggcgcttgagagcgtacaccacatccat 253

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||||||||||||||||||   ||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 252 ggcggtgacggtcttgcgcttggcgtgctcagtgtaggtgactgcgtcgcggatcacgtt 193

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || || ||||||||||| |||||||||||||||||||||||
Sbjct: 192 ctccaggaacaccttcagtacaccacgggtctcctcatagatgaggccggagatgcgctt 133

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            |||||||| | ||  || || |  |||||||| ||||||||||| ||||||||||| ||
Sbjct: 132 gacaccgccacgccgagctaggcgacggatggcgggcttggtgatcccctggatgttatc 73

                                                  
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcc 426
            || | |||||| ||||| ||||||||||| ||||||||
Sbjct: 72  ccgcaagaccttgcggtgacgcttggcgccacccttgcc 34



to top

>ref|NM_001016869.2| Xenopus tropicalis hypothetical protein LOC549623 (LOC549623), mRNA
          Length = 440

 Score =  242 bits (122), Expect = 9e-61
 Identities = 263/310 (84%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||| |||||||||||||| |||||||||||||||||||| ||||| || || |||||||
Sbjct: 326 agcccccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatgg 267

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||| |||||||| |    ||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 266 cggtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcccggatgacattct 207

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||||||||| || || |||||||| ||||||||||| ||||||||||| |
Sbjct: 206 ccaggaaaaccttgaggaccccccgagtctcctcatagatgaggccagagatgcgcttga 147

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || ||||  ||||| |  |||||||| ||||||||||||||||||||||| || |
Sbjct: 146 ctccccctctccgtgccaggcggcggatggcgggcttggtgatgccctggatgttatccc 87

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||||| ||| ||||||||||| || || ||||  ||||| ||||| || ||||
Sbjct: 86  gcagcaccttcctgtgccgcttggcgcctcctttccccaaacccttcccgcctttaccgc 27

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 26  gtccagacat 17



to top

>emb|CR848633.2| Xenopus tropicalis finished cDNA, clone TGas006m08
          Length = 440

 Score =  242 bits (122), Expect = 9e-61
 Identities = 263/310 (84%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||| |||||||||||||| |||||||||||||||||||| ||||| || || |||||||
Sbjct: 326 agcccccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatgg 267

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           |||| |||||||| |    ||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 266 cggtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcccggatgacattct 207

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||||||||| || || |||||||| ||||||||||| ||||||||||| |
Sbjct: 206 ccaggaaaaccttgaggaccccccgagtctcctcatagatgaggccagagatgcgcttga 147

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || ||||  ||||| |  |||||||| ||||||||||||||||||||||| || |
Sbjct: 146 ctccccctctccgtgccaggcggcggatggcgggcttggtgatgccctggatgttatccc 87

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||||| ||| ||||||||||| || || ||||  ||||| ||||| || ||||
Sbjct: 86  gcagcaccttcctgtgccgcttggcgcctcctttccccaaacccttcccgcctttaccgc 27

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 26  gtccagacat 17



to top

>dbj|AB197150.1| Fragaria x ananassa mRNA for histone H4, partial cds
          Length = 308

 Score =  240 bits (121), Expect = 4e-60
 Identities = 250/293 (85%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||| || |  ||||| | |||||| || |||||||| |||||||||
Sbjct: 308 ccgccgaagccgtagagtgtccttccctgcctcttgagagcatagacgacatccatggcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| |  ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 248 gtgacagtcttcctccgggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcg 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |||||||||||||||||||| | |||||| || |||||||| |||||||| ||||| || 
Sbjct: 188 aggaagatcttgaggacgcctctggtctcttcatagatgagaccggagatacgcttgacg 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || || |  ||||  |  |||||||| ||||||||||||||||||||||| || | |
Sbjct: 128 ccacctctgcgagccaaacggcggatggcgggcttggtgatgccctggatgttatccctg 69

                                                                
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgccctt 444
           |||||||||| ||| |||||||| || ||||| ||||  |||||||| |||||
Sbjct: 68  aggaccttcctgtgacgcttggctcctccctttcccaaacccttgcctccctt 16



to top

>emb|X00091.1|HSHISH4 Human histone H4 gene
          Length = 709

 Score =  240 bits (121), Expect = 4e-60
 Identities = 260/305 (85%), Gaps = 1/305 (0%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 424 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 365

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| | |
Sbjct: 364 accgtcttgcgcttggcgtgctctgtataggttacggcgtcccggattacgttctccaag 305

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||||||||||||||||||||||||||||||||| |||
Sbjct: 304 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 245

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  | ||| || |  || ||||| || ||||||||||| ||||| |||||||| || 
Sbjct: 244 ccgcggc-ggcaaggcgtcgaatggctggtttggtgatgccatggatattgtcgcgcagt 186

                                                                       
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgccca 454
           || || ||||||||||| |||||||| ||||| || ||||| ||||| |||||||| |||
Sbjct: 185 actttacggtggcgcttagcgccgcctttgccaaggcccttcccgcctttgccgcggcca 126

                
Query: 455 gacat 459
           |||||
Sbjct: 125 gacat 121



to top

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                        
Query: 152  ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
            ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 5928 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 5869

                                                                        
Query: 212  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
            ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 5868 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 5809

                                                                        
Query: 272  aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
            |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 5808 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 5749

                                                                        
Query: 332  ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
            ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 5748 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 5689

                                                                        
Query: 392  aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
            |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 5688 aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 5629

                    
Query: 452  ccagacat 459
            ||||||||
Sbjct: 5628 ccagacat 5621



 Score =  147 bits (74), Expect = 4e-32
 Identities = 218/266 (81%)
 Strand = Plus / Minus

                                                                          
Query: 158    aagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacg 217
              |||||||| || ||||| ||||||||||||||||||||||| || ||||| || ||||| 
Sbjct: 224727 aagccgtacagagtgcgtccctggcgcttgagcgcgtagacaacatccattgcagtgact 224668

                                                                          
Query: 218    gtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaag 277
              ||||| ||   ||||||||| |||||||| |||||||| || || || ||||| ||||| 
Sbjct: 224667 gtcttacgcttggcgtgctccgtgtaggttacggcgtcccgtatcacattctccaggaac 224608

                                                                          
Query: 278    atcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccgccc 337
              | ||| || || |||||||||||||| || |||||||| || ||||| ||||| ||||| 
Sbjct: 224607 accttaagaacaccgcgggtctcctcataaatgaggcccgaaatgcgtttcacgccgccg 224548

                                                                          
Query: 338    ctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggaggacc 397
              |  | |||||  |  |||||||| ||||| ||||||||||| |||||||| || || || 
Sbjct: 224547 cgtcgggccaagcgacggatggcgggcttcgtgatgccctgtatgttgtcacgcagcact 224488

                                        
Query: 398    ttccggtggcgcttggcgccgccctt 423
              || || |||||||||||||| |||||
Sbjct: 224487 ttgcgatggcgcttggcgcctccctt 224462



 Score =  143 bits (72), Expect = 6e-31
 Identities = 249/308 (80%)
 Strand = Plus / Plus

                                                                         
Query: 152   ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
             |||||||||||||| || ||||| || || |||||||||||||| || || |||||||| 
Sbjct: 10887 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 10946

                                                                         
Query: 212   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
             ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 10947 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 11006

                                                                         
Query: 272   aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
             || || | |||||| ||||| || |||||||| || || |  ||||| || ||||| || 
Sbjct: 11007 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 11066

                                                                         
Query: 332   ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
             || || | ||| || || | ||| |||||||| ||||||||||| |||||||| || || 
Sbjct: 11067 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 11126

                                                                         
Query: 392   aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
             || || || ||||| |||||||| || ||||| ||||  || || ||||| |||||||| 
Sbjct: 11127 agcacttttcggtgacgcttggcacctcccttacccaaacctttaccgcctttgccgcga 11186

                     
Query: 452   ccagacat 459
             ||||||||
Sbjct: 11187 ccagacat 11194



 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/311 (80%)
 Strand = Plus / Minus

                                                                          
Query: 149    tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
              ||||||||||||||||| || ||||| ||||| | ||| ||||||||||| || ||||| 
Sbjct: 188955 tagccgccgaagccgtaaagagtgcgtccctgtctcttcagcgcgtagaccacatccatc 188896

                                                                          
Query: 209    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
              || || || ||||||||   ||||||||| ||||| || || || || || || ||||| 
Sbjct: 188895 gctgtcactgtcttgcgtttggcgtgctccgtgtaagtcacagcatcacgaatcacgttt 188836

                                                                          
Query: 269    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
              || || || | ||| || || ||||| ||||||||||||||||| || || |||||||| 
Sbjct: 188835 tccagaaacaccttcagaaccccgcgagtctcctcgtagatgagaccagaaatgcgcttg 188776

                                                                          
Query: 329    acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
              ||||| || |  |  || || | ||||||||| |||||||| |||||||||||||| || 
Sbjct: 188775 acacccccgcgacgagcaaggcgccggatggcaggcttggtaatgccctggatgttatct 188716

                                                                          
Query: 389    cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
              || |||||||| ||||| ||||| ||||| || || ||||| ||||| ||||| ||||||
Sbjct: 188715 cgcaggaccttacggtgacgcttagcgcctcctttacccagtccctttccgcctttgccg 188656

                         
Query: 449    cgcccagacat 459
              || ||||||||
Sbjct: 188655 cgaccagacat 188645



 Score =  141 bits (71), Expect = 3e-30
 Identities = 251/311 (80%)
 Strand = Plus / Plus

                                                                          
Query: 150    agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
              ||||||||||||| || || ||||| |||||||||||||||||||| || ||||||||||
Sbjct: 172767 agccgccgaagccataaagagtgcgtccctggcgcttgagcgcgtacaccacgtccatgg 172826

                                                                          
Query: 210    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
              | ||||| ||||||||   |||||| || ||||||||||| || |||||||| || || |
Sbjct: 172827 ctgtgactgtcttgcgtttggcgtgttccgtgtaggtgacagcatcgcggattacatttt 172886

                                                                          
Query: 270    cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
              | ||||| |  || || || ||||| || ||||| || |||||||| || || ||||| |
Sbjct: 172887 ccaggaaaactttcagcactccgcgagtttcctcataaatgaggccagaaatacgcttga 172946

                                                                          
Query: 330    caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
              | ||||| |  |  ||||| |  ||||| || ||||||||||| || ||||| ||||| |
Sbjct: 172947 cgccgccgcggcgagccaggcggcggatagcgggcttggtgattccttggatattgtcac 173006

                                                                          
Query: 390    ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
              | |  ||||| ||||| ||||||||||| ||||| || || ||||| |||||||| ||||
Sbjct: 173007 gcaataccttacggtgacgcttggcgccacccttacctagaccctttccgcccttaccgc 173066

                         
Query: 450    gcccagacatc 460
              | |||||||||
Sbjct: 173067 ggccagacatc 173077



 Score =  115 bits (58), Expect = 1e-22
 Identities = 196/242 (80%)
 Strand = Plus / Plus

                                                                          
Query: 149    tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
              ||||| ||||||||||| || ||||| ||||| ||||| ||||||||||| || ||||| 
Sbjct: 269189 tagccaccgaagccgtaaagagtgcgtccctgtcgcttcagcgcgtagaccacatccatt 269248

                                                                          
Query: 209    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
              || || |||||||||||   ||||||||| ||||| ||||| ||||| || || ||||||
Sbjct: 269249 gctgtcacggtcttgcgtttggcgtgctctgtgtaagtgacagcgtcacgaatcacgttc 269308

                                                                          
Query: 269    tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
              || ||||| | ||| || || || || |||||||| ||||| ||||| || || ||||| 
Sbjct: 269309 tccaggaacaccttcagaacaccacgagtctcctcatagataaggccagaaattcgcttg 269368

                                                                          
Query: 329    acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
              |||||||| |  |  || || | |||||| || ||||| ||||||||||||||||| |||
Sbjct: 269369 acaccgccgcgacgagcaaggcgccggatagctggcttagtgatgccctggatgttatcg 269428

                
Query: 389    cg 390
              ||
Sbjct: 269429 cg 269430



 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 132/161 (81%)
 Strand = Plus / Plus

                                                                          
Query: 176    ccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcgtgc 235
              |||||||| |||||| ||||||| ||| ||||||||||||| ||||||||   |||||||
Sbjct: 230694 ccctggcgtttgagcacgtagaccacggccatggcggtgaccgtcttgcgcttggcgtgc 230753

                                                                          
Query: 236    tcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgaggacgccgcgg 295
              || |||| ||| |||||||  | ||| || || || ||||| | |||||  || | ||||
Sbjct: 230754 tccgtgttggtcacggcgtaccagatcacattttccaggaacaccttgaacacccggcgg 230813

                                                       
Query: 296    gtctcctcgtagatgaggccggagatgcgcttcacaccgcc 336
              |||||||| || ||||||||  |||||||||| ||||||||
Sbjct: 230814 gtctcctcataaatgaggcccaagatgcgcttgacaccgcc 230854



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 243/310 (78%)
 Strand = Plus / Minus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||| || || ||||| ||||| || || || || || || || |||||||
Sbjct: 88199 agccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccatgg 88140

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             | ||||| || |||||   ||||||||| || |||||||||||||| || || |||||||
Sbjct: 88139 ctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgttct 88080

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             | | ||| | ||| || || || || |||||||| ||||| || ||||| |||||||| |
Sbjct: 88079 ctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgcttga 88020

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | || || | ||  ||||  |  || || ||||| || || |||||||||||||| || |
Sbjct: 88019 cgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatccc 87960

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||| ||||| || |||||||| || || ||||| ||||  || || ||||| |||||||
Sbjct: 87959 ggagcaccttacgatggcgcttagcaccacccttccccaagccttttccgcctttgccgc 87900

                       
Query: 450   gcccagacat 459
             | ||||||||
Sbjct: 87899 gaccagacat 87890



to top

>ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA
          Length = 372

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 308 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 188 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 128 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 68  aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, complete cds
          Length = 930

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 619 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 560

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 559 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 500

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 499 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 440

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 439 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 380

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 379 aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 320

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 319 ccagacat 312



to top

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Plus

                                                                          
Query: 152    ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
              ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 119073 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 119132

                                                                          
Query: 212    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
              ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 119133 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 119192

                                                                          
Query: 272    aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
              |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 119193 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 119252

                                                                          
Query: 332    ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
              ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 119253 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 119312

                                                                          
Query: 392    aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
              |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 119313 aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 119372

                      
Query: 452    ccagacat 459
              ||||||||
Sbjct: 119373 ccagacat 119380



 Score =  143 bits (72), Expect = 6e-31
 Identities = 249/308 (80%)
 Strand = Plus / Minus

                                                                          
Query: 152    ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
              |||||||||||||| || ||||| || || |||||||||||||| || || |||||||| 
Sbjct: 114114 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 114055

                                                                          
Query: 212    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
              ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 114054 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 113995

                                                                          
Query: 272    aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
              || || | |||||| ||||| || |||||||| || || |  ||||| || ||||| || 
Sbjct: 113994 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 113935

                                                                          
Query: 332    ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
              || || | ||| || || | ||| |||||||| ||||||||||| |||||||| || || 
Sbjct: 113934 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 113875

                                                                          
Query: 392    aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
              || || || ||||| |||||||| || ||||| ||||  || || ||||| |||||||| 
Sbjct: 113874 agcacttttcggtgacgcttggcacctcccttacccaaacctttaccgcctttgccgcga 113815

                      
Query: 452    ccagacat 459
              ||||||||
Sbjct: 113814 ccagacat 113807



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 243/310 (78%)
 Strand = Plus / Plus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||||||||| || || ||||| ||||| || || || || || || || |||||||
Sbjct: 36802 agccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccatgg 36861

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             | ||||| || |||||   ||||||||| || |||||||||||||| || || |||||||
Sbjct: 36862 ctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgttct 36921

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             | | ||| | ||| || || || || |||||||| ||||| || ||||| |||||||| |
Sbjct: 36922 ctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgcttga 36981

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | || || | ||  ||||  |  || || ||||| || || |||||||||||||| || |
Sbjct: 36982 cgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatccc 37041

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||| ||||| || |||||||| || || ||||| ||||  || || ||||| |||||||
Sbjct: 37042 ggagcaccttacgatggcgcttagcaccacccttccccaagccttttccgcctttgccgc 37101

                       
Query: 450   gcccagacat 459
             | ||||||||
Sbjct: 37102 gaccagacat 37111



to top

>gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:97476
           IMAGE:7262752), complete cds
          Length = 365

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 308 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 188 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 128 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 68  aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79351
           IMAGE:7002090), complete cds
          Length = 349

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 308 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 188 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 128 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 68  aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79349
           IMAGE:7002088), complete cds
          Length = 349

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 308 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 188 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 128 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 68  aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79350
           IMAGE:7002089), complete cds
          Length = 349

 Score =  238 bits (120), Expect = 1e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 308 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 188 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | |||||||||||||||||||||||||||||||||||| || 
Sbjct: 128 ccgccacgccgggccagacgccggatggccggcttggtgatgccctggatgttgtcacgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 68  aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488274), mRNA
          Length = 366

 Score =  232 bits (117), Expect = 9e-58
 Identities = 156/169 (92%)
 Strand = Plus / Minus

                                                                       
Query: 290 ccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccgcccctcctggccagc 349
           |||||||||||||||||||||||||| ||||||||||| || ||||| | || |||||||
Sbjct: 233 ccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgccgggccagc 174

                                                                       
Query: 350 ctccggatggccggcttggtgatgccctggatgttgtcgcggaggaccttccggtggcgc 409
           | ||||||||| ||||||||||||||||||||||||||||| || ||||| |||||||||
Sbjct: 173 cgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttgcggtggcgc 114

                                                            
Query: 410 ttggcgccgcccttgcccagccccttgccgcccttgccgcgcccagaca 458
           |||||||||||||||||||||||||| |||||||||||||| |||||||
Sbjct: 113 ttggcgccgcccttgcccagccccttcccgcccttgccgcgaccagaca 65



to top

>ref|XM_595302.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC517138), mRNA
          Length = 312

 Score =  230 bits (116), Expect = 4e-57
 Identities = 260/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| ||   ||| ||||||||||||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgaccgtcttccgcttggcatgctcggtgtaggtgaccgcgtcccggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           || || |  || ||||| ||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 188 agaaacactttcaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || |  |  ||||| |  ||||| || || || ||||||||||||||||||||||| 
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| || ||||| || |||||||| |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>emb|X00224.1|XLHIS4 Xenopus laevis H4 histone gene and flanking regions
          Length = 815

 Score =  230 bits (116), Expect = 4e-57
 Identities = 260/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||| |||||||||||||||||||| ||||| || || |||||||||
Sbjct: 715 ccgccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatggcg 656

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           || |||||||| |    ||||||||||||||||||||| ||||| |||||||| ||||| 
Sbjct: 655 gtaacggtcttcctcttggcgtgctcggtgtaggtgacagcgtcccggatgacattctcc 596

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||||||||| || || || ||||| || |||||||| ||||||||||| || 
Sbjct: 595 aggaaaaccttgaggaccccacgagtttcctcataaatgaggccagagatgcgcttgact 536

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || ||||  ||||| |  |||||||| |||||||||||||||||||||||||| | |
Sbjct: 535 ccccctctccgtgccaggcggcggatggcaggcttggtgatgccctggatgttgtccctg 476

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||||| ||| ||||||||||| || || ||||| || || || || |||||||| 
Sbjct: 475 agcaccttcctgtgccgcttggcgcctcctttccccagtccttttcctcctttgccgcgt 416

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 415 ccagacat 408



to top

>emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone
          Length = 672

 Score =  230 bits (116), Expect = 4e-57
 Identities = 260/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||| || |||||||| ||||||||||| ||||||||||| ||||||||||| 
Sbjct: 488 ccgccaaagccataaagggtgcgtccctggcgcttaagcgcgtagaccacgtccatggca 429

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||||||   ||||||||| || |||||||| ||||| ||||| |||||||| 
Sbjct: 428 gtgactgtcttgcgcttggcgtgctccgtataggtgacagcgtcacggatcacgttctcc 369

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           |  || | |||||| || ||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 368 aaaaacaccttgagcaccccgcgagtctcctcgtagatcagaccagagatccgcttcaca 309

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           ||||| | || |||||| | ||||||||| |||||||||||||||||||||||||| || 
Sbjct: 308 ccgccacgccgggccagacgccggatggctggcttggtgatgccctggatgttgtcacgc 249

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           |  ||||| |||||||||||||| || ||||| ||||  ||||| |||||||| || || 
Sbjct: 248 aacaccttgcggtggcgcttggcaccccccttacccaaacccttcccgcccttaccacgt 189

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 188 ccagacat 181



to top

>emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes
          Length = 2930

 Score =  226 bits (114), Expect = 6e-56
 Identities = 246/290 (84%)
 Strand = Plus / Minus

                                                                        
Query: 152  ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
            |||||||| ||||| |||||||| |||||||| || || |||||||| ||||||||||| 
Sbjct: 1145 ccgccgaaaccgtacagggtgcgtccctggcgtttcagagcgtagaccacgtccatggcc 1086

                                                                        
Query: 212  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
            || |||||||| |    ||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1085 gtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttctca 1026

                                                                        
Query: 272  aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
            ||||| | ||| ||||| |||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 1025 aggaacaccttcaggacaccgcgggtctcctcgtagatcagcccggagatacgcttcacg 966

                                                                        
Query: 332  ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
            ||||| |  |  ||||| |  || ||||| ||||||||||| ||||||||||| ||||||
Sbjct: 965  ccgccacggcgagccagacggcgaatggcgggcttggtgattccctggatgttatcgcgg 906

                                                              
Query: 392  aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcc 441
            || ||||| ||||| ||||||||||| || || || || |||||||||||
Sbjct: 905  agaaccttacggtgacgcttggcgcctccttttccgagtcccttgccgcc 856



to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  224 bits (113), Expect = 2e-55
 Identities = 248/293 (84%)
 Strand = Plus / Plus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           |||||||||||||||||||||||||||||||| || || || ||||||||||||||||| 
Sbjct: 286 ccgaagccgtagagggtgcggccctggcgcttcagagcatacacgacgtccatggcggtc 345

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||||| |||||||||||||| ||||| | ||| |||||||| ||||| |||
Sbjct: 346 acagtcttgcggcgagcgtgctcggtgtacgtgaccgagtcacggatgacattctcaagg 405

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           ||| |||| || ||   |||||||||||||||||||||||||  ||| ||||||||||||
Sbjct: 406 aagttcttcagcacagtgcgggtctcctcgtagatgaggccgctgatacgcttcacaccg 465

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  ||||| || ||||| ||||| ||||| ||||||||||| || 
Sbjct: 466 ccacgacgtgccagacgacggatagcaggcttcgtgataccctgaatgttgtcgcgaagc 525

                                                                
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 447
           ||||| || |||||||| || || ||||||||||  ||||| |||||||||||
Sbjct: 526 accttgcgatggcgcttagctcctcccttgcccaagccctttccgcccttgcc 578



to top

>gb|BC078038.1| Xenopus laevis histone 1, H4l, mRNA (cDNA clone MGC:82777
           IMAGE:5161621), complete cds
          Length = 1057

 Score =  222 bits (112), Expect = 9e-55
 Identities = 259/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||| |||||||||||||||||||| ||||| || || |||||||||
Sbjct: 319 ccgccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatggcg 260

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           || |||||||| |    |||||| || ||||||||||||||||| |||||||| ||||| 
Sbjct: 259 gtaacggtcttcctcttggcgtgttctgtgtaggtgacggcgtcccggatgacattctcc 200

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||||||||| || || |||||||| ||||||||||| ||||||||||| || 
Sbjct: 199 aggaaaaccttgaggaccccacgagtctcctcatagatgaggccagagatgcgcttgact 140

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || ||||  ||||| |  |||||||| ||||||||||||||||||||||| || | |
Sbjct: 139 ccccctctccgtgccaggcggcggatggcgggcttggtgatgccctggatgttatccctg 80

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||||| ||| ||||||||||| || || ||||| || || || || |||||||| 
Sbjct: 79  agcaccttcctgtgccgcttggcgcctcctttccccagtccttttcctcctttgccgcgg 20

                   
Query: 452 ccagacat 459
           || |||||
Sbjct: 19  ccggacat 12



to top

>ref|XM_604220.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC525863), mRNA
          Length = 312

 Score =  222 bits (112), Expect = 9e-55
 Identities = 259/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| ||||| ||   ||| |||||||||||||||||  |||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttccgcttggcatgctcggtgtaggtgaccacgtcccggatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           || || |  || ||||| ||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 188 agaaacacttttaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || |  |  ||||| |  ||||| || || || ||||||||||||||||||||||| 
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| || ||||| || |||||||| |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>gb|AC150544.3| Bos taurus  BAC CH240-75C8 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 190186

 Score =  222 bits (112), Expect = 9e-55
 Identities = 259/308 (84%)
 Strand = Plus / Plus

                                                                          
Query: 152    ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
              ||||| ||||||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 184923 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 184982

                                                                          
Query: 212    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
              ||||| ||||| ||   ||| |||||||||||||||||  |||| ||||| |||||||| 
Sbjct: 184983 gtgactgtcttccgcttggcatgctcggtgtaggtgaccacgtcccggatcacgttctcc 185042

                                                                          
Query: 272    aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
              || || |  || ||||| ||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 185043 agaaacacttttaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 185102

                                                                          
Query: 332    ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
              || || |  |  ||||| |  ||||| || || || ||||||||||||||||||||||| 
Sbjct: 185103 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 185162

                                                                          
Query: 392    aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
              || ||||| ||||||||||| |||||||| || ||||| || |||||||| |||||||| 
Sbjct: 185163 agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 185222

                      
Query: 452    ccagacat 459
              ||||||||
Sbjct: 185223 ccagacat 185230



to top

>emb|X13554.1|RNH4G Rat H4 gene for somatic histone H4
          Length = 1028

 Score =  220 bits (111), Expect = 3e-54
 Identities = 261/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||| ||||| |||||||||||||||||||||||||| || |||||||| |
Sbjct: 847 agccgccgaagccatagagcgtgcggccctggcgcttgagcgcgtacaccacgtccatag 788

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||||||||||||||| || ||||| || || || |
Sbjct: 787 ccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacagcatcgcgaatcacatttt 728

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| ||||||||||| |||||||||||||| || || ||||| ||||| |
Sbjct: 727 caaggaaaaccttcaggacgccgcgagtctcctcgtagataagacccgagatacgcttga 668

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           ||||||| | ||  ||||  | |||||| || |||||||| |||||||||||||| || |
Sbjct: 667 caccgccgcgccgagccaaacgccggatagcgggcttggtaatgccctggatgttatctc 608

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||| ||||| ||||||||||| || || ||||| || |||||||| || || |
Sbjct: 607 ggagaaccttgcggtgtcgcttggcgccacctttacccagacctttgccgcctttccctc 548

                      
Query: 450 gcccagacatc 460
           | |||||||||
Sbjct: 547 gtccagacatc 537



to top

>ref|XM_578415.1| PREDICTED: Rattus norvegicus similar to germinal histone H4 gene
           (LOC502913), mRNA
          Length = 495

 Score =  220 bits (111), Expect = 3e-54
 Identities = 261/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||| ||||| |||||||||||||||||||||||||| || |||||||| |
Sbjct: 493 agccgccgaagccatagagcgtgcggccctggcgcttgagcgcgtacaccacgtccatag 434

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||||||||||||||| || ||||| || || || |
Sbjct: 433 ccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacagcatcgcgaatcacatttt 374

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| ||||||||||| |||||||||||||| || || ||||| ||||| |
Sbjct: 373 caaggaaaaccttcaggacgccgcgagtctcctcgtagataagacctgagatacgcttga 314

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           ||||||| | ||  ||||  | |||||| || |||||||| |||||||||||||| || |
Sbjct: 313 caccgccgcgccgagccaaacgccggatagcgggcttggtaatgccctggatgttatctc 254

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||| ||||| ||||||||||| || || ||||| || |||||||| || || |
Sbjct: 253 ggagaaccttgcggtgtcgcttggcgccacctttacccagacctttgccgcctttccctc 194

                      
Query: 450 gcccagacatc 460
           | |||||||||
Sbjct: 193 gtccagacatc 183



to top

>ref|XM_602616.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC524294), mRNA
          Length = 312

 Score =  214 bits (108), Expect = 2e-52
 Identities = 258/308 (83%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||| ||||||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           ||||| | ||| ||   ||| ||||||||||||||||| ||||| | ||| |||||||| 
Sbjct: 248 gtgaccgccttccgcttggcatgctcggtgtaggtgaccgcgtcccagatcacgttctcc 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           || || |  || ||||| ||||||||||| ||||||||||| || |||||||||||||||
Sbjct: 188 agaaacactttcaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || |  |  ||||| |  ||||| || || || ||||||||||||||||||||||| 
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||| ||||||||||| |||||||| || ||||| || |||||||| |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>gb|J00987.1|XELHIS4LB x.laevis histone gene h4 and flanks
          Length = 408

 Score =  214 bits (108), Expect = 2e-52
 Identities = 258/308 (83%)
 Strand = Plus / Minus

                                                                       
Query: 152 ccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 211
           ||||||||||||||||| |||||||||||||||||||| ||||| || || |||||||||
Sbjct: 308 ccgccgaagccgtagagagtgcggccctggcgcttgagagcgtacaccacatccatggcg 249

                                                                       
Query: 212 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 271
           || |||||||| |    ||||||||||||||||||||| ||||| |||||||| ||||| 
Sbjct: 248 gtaacggtcttcctcttggcgtgctcggtgtaggtgacagcgtcccggatgacattctct 189

                                                                       
Query: 272 aggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcaca 331
           ||||| | ||||||||| || || || ||||| || |||||||| ||||||||||| || 
Sbjct: 188 aggaaaaccttgaggaccccacgagtttcctcataaatgaggccagagatgcgcttgact 129

                                                                       
Query: 332 ccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcgg 391
           || || ||||  || || |  |||||||| |||||||||||||||||||||||||| |  
Sbjct: 128 ccccctctccgtgctaggcggcggatggcaggcttggtgatgccctggatgttgtcccta 69

                                                                       
Query: 392 aggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgc 451
           || ||||||| ||| ||||||||||| || || ||||| || || || || |||||||| 
Sbjct: 68  agcaccttcctgtgccgcttggcgcctcctttccccagtccttttcctcctttgccgcgt 9

                   
Query: 452 ccagacat 459
           ||||||||
Sbjct: 8   ccagacat 1



to top

>ref|XM_950909.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1) partial mRNA
          Length = 324

 Score =  212 bits (107), Expect = 8e-52
 Identities = 248/295 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| ||||||||||| ||||||||||||||||| |||||||| ||||| | || ||||
Sbjct: 317 ccgaaaccgtagagggtacggccctggcgcttgagggcgtagacaacgtcgagggaggtg 258

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||   |||||||||||||||||||||||| || ||||||||   |||||||
Sbjct: 257 acggtcttgcgcttggcgtgctcggtgtaggtgacggcatcacggatgacaccctcgagg 198

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           ||| |||||||||| || ||||||||||||||||| | | | ||||| ||||| ||||| 
Sbjct: 197 aaggtcttgaggacaccacgggtctcctcgtagatcatggcagagatacgcttgacacca 138

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || |  ||||| || ||||||||||| |||||||||||||| || || 
Sbjct: 137 ccacgacgagcgagacggcggatagcgggcttggtgataccctggatgttgtcacgaaga 78

                                                                  
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | ||| || ||||||||||| |||||||| || || |||||||||||||||||||
Sbjct: 77  atcttgcgatggcgcttggcaccgccctttccgaggcccttgccgcccttgccgc 23



to top

>ref|XM_328072.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1) partial mRNA
          Length = 324

 Score =  212 bits (107), Expect = 8e-52
 Identities = 248/295 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| ||||||||||| ||||||||||||||||| |||||||| ||||| | || ||||
Sbjct: 317 ccgaaaccgtagagggtacggccctggcgcttgagggcgtagacaacgtcgagggaggtg 258

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           |||||||||||   |||||||||||||||||||||||| || ||||||||   |||||||
Sbjct: 257 acggtcttgcgcttggcgtgctcggtgtaggtgacggcatcacggatgacaccctcgagg 198

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           ||| |||||||||| || ||||||||||||||||| | | | ||||| ||||| ||||| 
Sbjct: 197 aaggtcttgaggacaccacgggtctcctcgtagatcatggcagagatacgcttgacacca 138

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  || || |  ||||| || ||||||||||| |||||||||||||| || || 
Sbjct: 137 ccacgacgagcgagacggcggatagcgggcttggtgataccctggatgttgtcacgaaga 78

                                                                  
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | ||| || ||||||||||| |||||||| || || |||||||||||||||||||
Sbjct: 77  atcttgcgatggcgcttggcaccgccctttccgaggcccttgccgcccttgccgc 23



to top

>emb|CR542172.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0824D for
           gene HIST2H4, histone 2, H4; complete cds, incl.
           stopcodon
          Length = 312

 Score =  212 bits (107), Expect = 8e-52
 Identities = 236/279 (84%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| |||||||||||||||||||| |||||||||||||||||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtagagggtgcgcccctggcgcttgagcgcgtacaccacatccat 253

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||
Sbjct: 252 ggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacatt 193

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 192 ctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgctt 133

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || ||||| | ||  || || | ||| ||||| ||||||||||||||||| ||||||||
Sbjct: 132 aacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtc 73

                                                  
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcc 426
            |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 72  tctcaagaccttgcggtggcgcttagcgccccctttgcc 34



to top

>ref|NM_003546.2| Homo sapiens histone 1, H4l (HIST1H4L), mRNA
          Length = 364

 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||| ||||| || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 311 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 252

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 251 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 192

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | |  || |  || || || ||||| ||||||||||| || ||||| ||||||||||| |
Sbjct: 191 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 132

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || | ||  ||||| |  |||||||| ||||||||||||||||| ||||||||||
Sbjct: 131 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 72

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || || || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 71  gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 12

                     
Query: 450 gcccagacat 459
           ||||||||||
Sbjct: 11  gcccagacat 2



to top

>gb|AY128665.1| Homo sapiens clone HIST1H4L histone H4 gene, complete cds
          Length = 930

 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||| ||||| || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 620 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 561

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 560 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 501

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | |  || |  || || || ||||| ||||||||||| || ||||| ||||||||||| |
Sbjct: 500 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 441

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || | ||  ||||| |  |||||||| ||||||||||||||||| ||||||||||
Sbjct: 440 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 381

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || || || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 380 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 321

                     
Query: 450 gcccagacat 459
           ||||||||||
Sbjct: 320 gcccagacat 311



to top

>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3
             Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ,
             H2AFN, and H2BFN histone genes, the OR2B2 gene for
             olfactory receptor 2B2, histone H2B family member I
             pseudogene H2BFIP, a hypothetical protein pseudogene,
             ESTs, STSs, GSSs and CpG islands, complete sequence
          Length = 100374

 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Plus

                                                                         
Query: 150   agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
             ||||||| ||||| || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 36942 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 37001

                                                                         
Query: 210   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
             | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 37002 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 37061

                                                                         
Query: 270   cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
             | |  || |  || || || ||||| ||||||||||| || ||||| ||||||||||| |
Sbjct: 37062 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 37121

                                                                         
Query: 330   caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
             | || || | ||  ||||| |  |||||||| ||||||||||||||||| ||||||||||
Sbjct: 37122 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 37181

                                                                         
Query: 390   ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             | || || || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 37182 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 37241

                       
Query: 450   gcccagacat 459
             ||||||||||
Sbjct: 37242 gcccagacat 37251



to top

>emb|X83548.1|HSHISTN4 H.sapiens gene for histone H4
          Length = 870

 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||| ||||| || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 667 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 608

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 607 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 548

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | |  || |  || || || ||||| ||||||||||| || ||||| ||||||||||| |
Sbjct: 547 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 488

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || | ||  ||||| |  |||||||| ||||||||||||||||| ||||||||||
Sbjct: 487 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 428

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || || || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 427 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 368

                     
Query: 450 gcccagacat 459
           ||||||||||
Sbjct: 367 gcccagacat 358



to top

>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4
          Length = 1504

 Score =  210 bits (106), Expect = 3e-51
 Identities = 253/302 (83%)
 Strand = Plus / Plus

                                                                       
Query: 158 aagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacg 217
           ||||| || |||||||||||||||||||| || ||||| |||||||||||||| ||||| 
Sbjct: 82  aagccatacagggtgcggccctggcgcttaagtgcgtatacgacgtccatggctgtgaca 141

                                                                       
Query: 218 gtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaag 277
           ||||||||||| |||||||| || || || || |  || |||||||||||||| ||||||
Sbjct: 142 gtcttgcggcgagcgtgctcagtataagtaactgaatcacggatgacgttctccaggaag 201

                                                                       
Query: 278 atcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccgccc 337
            ||||||||||   |||||| |||||||| ||||| |||   || ||||| |||||||| 
Sbjct: 202 ttcttgaggaccgtgcgggtttcctcgtaaatgagcccgctaatacgctttacaccgcca 261

                                                                       
Query: 338 ctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggaggacc 397
           |  |  ||||  | ||| ||||| |||||||||||||| ||||||||||| ||||| || 
Sbjct: 262 cggcgagccaatcgccgaatggcaggcttggtgatgccttggatgttgtcacggagaact 321

                                                                       
Query: 398 ttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcgcccagac 457
           || ||||||||||| || |||||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 322 ttgcggtggcgctttgcaccgcccttgcccaggcccttgccacccttgccgcgtccagac 381

             
Query: 458 at 459
           ||
Sbjct: 382 at 383



to top

>gb|BC069392.1| Homo sapiens histone 1, H4l, mRNA (cDNA clone MGC:97405
           IMAGE:7262681), complete cds
          Length = 363

 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||| ||||| || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 311 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 252

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 251 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 192

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | |  || |  || || || ||||| ||||||||||| || ||||| ||||||||||| |
Sbjct: 191 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 132

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || | ||  ||||| |  |||||||| ||||||||||||||||| ||||||||||
Sbjct: 131 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 72

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || || || ||||||||||| ||||| || |||||||| ||||| ||||| |||||||
Sbjct: 71  gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 12

                     
Query: 450 gcccagacat 459
           ||||||||||
Sbjct: 11  gcccagacat 2



to top

>ref|XM_575704.1| PREDICTED: Rattus norvegicus similar to germinal histone H4 gene
           (LOC500351), mRNA
          Length = 336

 Score =  210 bits (106), Expect = 3e-51
 Identities = 259/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||| ||||| ||||||||||||||||||||||| || || |||||||| |
Sbjct: 329 agccgccgaagccatagagcgtgcggccctggcgcttgagcgcatacaccacgtccatag 270

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||||||||||||||| || ||||| || || || |
Sbjct: 269 ccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacagcatcgcgaatcacatttt 210

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| ||||||||||| |||||||||||||| || || ||||| ||||| |
Sbjct: 209 caaggaaaaccttcaggacgccgcgagtctcctcgtagataagacccgagatacgcttga 150

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           ||||||| | ||  ||||  | |||||| || |||||||| ||||||||||||||||| |
Sbjct: 149 caccgccgcgccgagccaaacgccggatagcgggcttggtaatgccctggatgttgtctc 90

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           |||| ||||| || || ||||||||||| || || ||||| || |||||||| || || |
Sbjct: 89  ggagaaccttgcgatgtcgcttggcgccacctttacccagacctttgccgcctttccctc 30

                     
Query: 450 gcccagacat 459
           | ||||||||
Sbjct: 29  gtccagacat 20



to top

>gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140
          Length = 946

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 320 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 261

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 260 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 201

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 200 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 141

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 140 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 81

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 80  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 41



to top

>ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA
          Length = 396

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 341 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 282

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 281 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 222

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 221 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 162

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 161 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 102

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 101 ctctcaagaccttgcggtggcgcttagcgccccctttgcc 62



to top

>ref|XM_513765.1| PREDICTED: Pan troglodytes LOC457262 (LOC457262), mRNA
          Length = 1963

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 615 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 556

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 555 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 496

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 495 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 436

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 435 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 376

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 375 ctctcaagaccttgcggtggcgcttagcgccccctttgcc 336



to top

>ref|NM_001034077.3| Homo sapiens histone H4/o (H4/o), mRNA
          Length = 373

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 335 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 276

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 275 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 216

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 215 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 156

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 155 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 96

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 95  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 56



to top

>gb|AF525682.1| Homo sapiens histone H4 (HIST2H4) gene, complete cds
          Length = 864

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 624 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 565

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 564 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 505

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 504 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 445

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 444 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 385

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 384 ctctcaagaccttgcggtggcgcttagcgccccctttgcc 345



to top

>gb|BC112193.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:138398
           IMAGE:8327661), complete cds
          Length = 373

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 335 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 276

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 275 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 216

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 215 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 156

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 155 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 96

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 95  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 56



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Plus

                                                                          
Query: 147    cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
              ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 122545 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 122604

                                                                          
Query: 207    tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
              |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 122605 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 122664

                                                                          
Query: 267    tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
              |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 122665 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 122724

                                                                          
Query: 327    tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
              | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 122725 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 122784

                                                      
Query: 387    cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
              | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 122785 ctctcaagaccttgcggtggcgcttagcgccccctttgcc 122824



 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                         
Query: 147   cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
             ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 94721 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 94662

                                                                         
Query: 207   tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
             |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 94661 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 94602

                                                                         
Query: 267   tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
             |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 94601 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 94542

                                                                         
Query: 327   tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
             | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 94541 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 94482

                                                     
Query: 387   cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
             | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 94481 ctctcaagaccttgcggtggcgcttagcgccccctttgcc 94442



to top

>emb|BX061454.1|CNS09JKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 107



to top

>emb|BX057867.1|CNS09GTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 413 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 354

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 353 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 294

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 293 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 234

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 233 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 174

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 173 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 118



to top

>emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 107



to top

>emb|BX048034.1|CNS09986 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 382 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 323

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 322 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 263

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 262 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 203

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 202 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 143

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 142 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 87



to top

>emb|BX037780.1|CNS091BC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 622

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 237 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 296

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 356

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 357 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 416

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 417 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 476

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 477 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 532



to top

>emb|BX037779.1|CNS091BB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 421 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 362

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 361 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 302

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 301 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 242

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 241 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 182

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 181 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 126



to top

>emb|BX020583.1|CNS08O1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 394

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 323 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 264

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 263 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 204

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 203 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 144

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 143 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 84

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 83  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 28



to top

>emb|BX009114.1|CNS08F72 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 384 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 325

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 324 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 265

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 264 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 205

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 204 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 145

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 144 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 89



to top

>ref|XM_942850.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 4 (LOC648164), mRNA
          Length = 622

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 338 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 279

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 278 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 219

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 218 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 159

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 158 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 99

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 98  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 59



to top

>ref|XM_942844.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 3 (LOC648164), mRNA
          Length = 1878

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 338 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 279

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 278 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 219

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 218 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 159

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 158 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 99

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 98  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 59



to top

>ref|XM_942841.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 2 (LOC648164), mRNA
          Length = 1128

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 338 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 279

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 278 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 219

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 218 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 159

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 158 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 99

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 98  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 59



to top

>ref|XM_936503.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 1 (LOC648164), mRNA
          Length = 2148

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 338 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 279

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 278 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 219

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 218 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 159

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 158 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 99

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 98  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 59



to top

>gb|BC093969.1| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:121004
           IMAGE:7939814), complete cds
          Length = 373

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 335 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 276

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 275 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 216

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 215 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 156

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 155 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 96

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 95  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 56



to top

>ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125
           (ENSANGG00000000123), partial mRNA
          Length = 312

 Score =  206 bits (104), Expect = 5e-50
 Identities = 248/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 155 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 214
           ||||| |||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 215 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 274
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 275 aagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttcacaccg 334
           || | ||| || || ||||| ||||| |||||||| ||||||||||| |||||||| |||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 335 cccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgcggagg 394
           || |  |  ||||| |  |||||||| ||||||||||||||||||||||| ||||| || 
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                   
Query: 395 accttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgcg 450
           ||||| || || |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 10



to top

>gb|BC108260.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:102836
           IMAGE:6011519), complete cds
          Length = 1712

 Score =  206 bits (104), Expect = 5e-50
 Identities = 236/280 (84%)
 Strand = Plus / Minus

                                                                       
Query: 147 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 206
           ||||||| ||||||||||| |||||||| |||||||||||||||||||| || || ||||
Sbjct: 330 cctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatcca 271

                                                                       
Query: 207 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 266
           |||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || |
Sbjct: 270 tggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacat 211

                                                                       
Query: 267 tctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgct 326
           |||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| ||||
Sbjct: 210 tctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgct 151

                                                                       
Query: 327 tcacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgt 386
           | || ||||| | ||  || || | ||| ||||| ||||||||||||||||| |||||||
Sbjct: 150 taacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgt 91

                                                   
Query: 387 cgcggaggaccttccggtggcgcttggcgccgcccttgcc 426
           | |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 90  ctctcaagaccttgcggtggcgcttagcgccccctttgcc 51



to top

>ref|XM_601250.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC522961), mRNA
          Length = 312

 Score =  204 bits (103), Expect = 2e-49
 Identities = 235/279 (84%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           ||||||||||||| ||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccatagagggtgcgtccttggcgtttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           ||||||| ||||||||   ||||||||||||||||||||| || || ||||| || ||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgactgcatcccggatcacattct 191

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| || || ||||||||||||||||||||||||||||||||||| || |
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgaggccggagatgcgtttga 131

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || | ||  || || |  ||||| || ||||| |||||||||||||||||||| |
Sbjct: 130 ctcctccacgccgagctaggcggcggatagcgggcttagtgatgccctggatgttgtctc 71

                                                  
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgccca 428
           | |  || || ||||| ||||||||||| ||||| ||||
Sbjct: 70  gcaaaactttgcggtgacgcttggcgccccccttcccca 32



to top

>ref|NM_173880.2| Bos taurus histone H4 (H4), mRNA
          Length = 1517

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| || ||||| |||||||||||||| ||||||||||| || |||||||| 
Sbjct: 351 tagccgccgaaaccatagagagtgcggccctggcgtttgagcgcgtaaaccacgtccata 292

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           ||||| || ||||||||   ||||||||| ||||||||||| ||||| ||||| || || 
Sbjct: 291 gcggttacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtcccggatcacattt 232

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || || || | ||| || || || |||||||||||||||||||| |||||||||||||||
Sbjct: 231 tccagaaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttc 172

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           ||||| || |  |  ||||| |  |||||||| ||||||||||| |||||||| ||||||
Sbjct: 171 acaccaccacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcg 112

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| ||||||||||| ||||| || || || || || |||||||| ||||| 
Sbjct: 111 cgcagaaccttgcggtggcgcttagcgcctcctttcccaaggcctttgccgcctttgcca 52

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 51  cgtccagacat 41



to top

>gb|AY890621.1| Synthetic construct Homo sapiens clone FLH141160.01X histone 2 H4
           (H4FN) mRNA, complete cds
          Length = 312

 Score =  204 bits (103), Expect = 2e-49
 Identities = 235/279 (84%)
 Strand = Plus / Minus

                                                                       
Query: 148 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 207
           |||||| ||||||||||| |||||||| |||||||||||||||||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatccat 253

                                                                       
Query: 208 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 267
           ||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||
Sbjct: 252 ggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacatt 193

                                                                       
Query: 268 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 327
           ||| ||||| | ||| || || ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 192 ctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgctt 133

                                                                       
Query: 328 cacaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtc 387
            || ||||| | ||  || || | ||| ||||| ||||||||||||||||| ||||||||
Sbjct: 132 aacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtc 73

                                                  
Query: 388 gcggaggaccttccggtggcgcttggcgccgcccttgcc 426
            |  | |||||| ||||||||||| ||||| || |||||
Sbjct: 72  tctcaagaccttgcggtggcgcttagcgccccctttgcc 34



to top

>gb|AF001288.1|AF001288 Bos taurus histone H4.1 mRNA, complete cds
          Length = 1517

 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                       
Query: 149 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 208
           ||||||||||| || ||||| |||||||||||||| ||||||||||| || |||||||| 
Sbjct: 351 tagccgccgaaaccatagagagtgcggccctggcgtttgagcgcgtaaaccacgtccata 292

                                                                       
Query: 209 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 268
           ||||| || ||||||||   ||||||||| ||||||||||| ||||| ||||| || || 
Sbjct: 291 gcggttacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtcccggatcacattt 232

                                                                       
Query: 269 tcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttc 328
           || || || | ||| || || || |||||||||||||||||||| |||||||||||||||
Sbjct: 231 tccagaaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttc 172

                                                                       
Query: 329 acaccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcg 388
           ||||| || |  |  ||||| |  |||||||| ||||||||||| |||||||| ||||||
Sbjct: 171 acaccaccacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcg 112

                                                                       
Query: 389 cggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccg 448
           || || ||||| ||||||||||| ||||| || || || || || |||||||| ||||| 
Sbjct: 111 cgcagaaccttgcggtggcgcttagcgcctcctttcccaaggcctttgccgcctttgcca 52

                      
Query: 449 cgcccagacat 459
           || ||||||||
Sbjct: 51  cgtccagacat 41



to top

>ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal histone H4 gene
           (LOC465305), mRNA
          Length = 1195

 Score =  202 bits (102), Expect = 8e-49
 Identities = 258/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||||||||| || ||||||||||| |||||||| || ||||| || || || |||||||
Sbjct: 457 agccgccgaaaccatagagggtgcgaccctggcgtttcagcgcatacaccacatccatgg 398

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||||||||||||   ||||||||| ||||| || || ||||||||||| |||||||
Sbjct: 397 ccgtgacggtcttgcgcttggcgtgctccgtgtaagtcaccgcgtcgcggatcacgttct 338

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | |||||||  |||||||| || |||||||||||||||||||| || || |||||||| |
Sbjct: 337 ccaggaagactttgaggactccccgggtctcctcgtagatgagaccagaaatgcgcttaa 278

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || |  | ||| || |  || || |||||||| || ||||| ||||||||||| |
Sbjct: 277 cgcccccacgtcgggcgagacggcgaatcgccggctttgtaatgccttggatgttgtccc 218

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
           | || ||||||||||||||||| ||||| ||||| |||||||||||||| || || || |
Sbjct: 217 gcagcaccttccggtggcgcttagcgcctcccttacccagccccttgccacctttacctc 158

                     
Query: 450 gcccagacat 459
           ||||||||||
Sbjct: 157 gcccagacat 148



to top

>ref|XM_540284.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC483166), mRNA
          Length = 459

 Score =  202 bits (102), Expect = 8e-49
 Identities = 258/310 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 209
           |||| ||||||||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 457 agcccccgaagccgtagagggtgcggccttggcgcttaagcgcgtacactacgtccatgg 398

                                                                       
Query: 210 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 269
           | ||||| ||||||||   ||||||||| ||||| |||||||| || ||||| |||||||
Sbjct: 397 ccgtgaccgtcttgcgcttggcgtgctccgtgtaagtgacggcatcccggatcacgttct 338

                                                                       
Query: 270 cgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgcttca 329
           | ||||| | ||| ||||| || || ||||| ||||| ||||| || ||||| |||||||
Sbjct: 337 ccaggaacaccttcaggacaccccgagtctcttcgtaaatgagacccgagatccgcttca 278

                                                                       
Query: 330 caccgcccctcctggccagcctccggatggccggcttggtgatgccctggatgttgtcgc 389
           | || || | ||  || || | ||||||||||||||| |||||||||||||||||||| |
Sbjct: 277 ctcccccacgccgagcgaggcgccggatggccggcttagtgatgccctggatgttgtctc 218

                                                                       
Query: 390 ggaggaccttccggtggcgcttggcgccgcccttgcccagccccttgccgcccttgccgc 449
             |||||||| || || ||||| ||||| || |||||||| ||||| || ||||| || |
Sbjct: 217 tcaggaccttacgatgacgcttcgcgccacctttgcccagacccttaccacccttccctc 158

                     
Query: 450 gcccagacat 459
            |||||||||
Sbjct: 157 tcccagacat 148


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,861,302
Number of Sequences: 3902068
Number of extensions: 2861302
Number of successful extensions: 69646
Number of sequences better than 10.0: 917
Number of HSP's better than 10.0 without gapping: 914
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 65421
Number of HSP's gapped (non-prelim): 3782
length of query: 515
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 492
effective length of database: 17,143,297,704
effective search space: 8434502470368
effective search space used: 8434502470368
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top