ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags7e11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009017.1| Triticum aestivum clone wdk3c.pk006.l8:fis, full ... 434 e-118
2ref|XM_469071.1| Oryza sativa (japonica cultivar-group), mRNA 268 2e-68
3dbj|AK066745.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
4dbj|AK120254.1| Oryza sativa (japonica cultivar-group) cDNA clon... 252 1e-63
5gb|BT017009.1| Zea mays clone EK07D2310G02.c mRNA sequence 220 4e-54
6gb|AY108697.1| Zea mays PCO126508 mRNA sequence 220 4e-54
7gb|BT016862.1| Zea mays clone Contig695 mRNA sequence 212 1e-51
8gb|AY112331.1| Zea mays CL362_2 mRNA sequence 208 2e-50
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 174 2e-40
10gb|AC133859.4| Oryza sativa chromosome 3 BAC OSJNBa0075A22 genom... 174 2e-40
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
12ref|NM_106704.2| Arabidopsis thaliana 3-isopropylmalate dehydrog... 62 2e-06
13emb|Y10216.1|ATIMDH A.thaliana mRNA for hypothetical 3-isopropyl... 62 2e-06
14gb|AY114627.1| Arabidopsis thaliana putative 3-isopropylmalate d... 62 2e-06
15gb|AY062441.1| Arabidopsis thaliana putative 3-isopropylmalate d... 62 2e-06
16emb|BX815110.1|CNS0ABD5 Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
17gb|AY085451.1| Arabidopsis thaliana clone 152141 mRNA, complete ... 62 2e-06
18ref|NM_121424.4| Arabidopsis thaliana 3-isopropylmalate dehydrog... 56 1e-04
19ref|NM_001036803.1| Arabidopsis thaliana 3-isopropylmalate dehyd... 56 1e-04
20ref|NM_001036802.1| Arabidopsis thaliana 3-isopropylmalate dehyd... 56 1e-04
21gb|BT015784.1| Arabidopsis thaliana At5g14200 mRNA, complete cds 56 1e-04
22gb|AY074587.1| Arabidopsis thaliana AT5g14200/MUA22_20 mRNA, com... 56 1e-04
23emb|BX831418.1|CNS09ZG0 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
24emb|BX831381.1|CNS09ZGM Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
25dbj|AB007650.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 1e-04
26gb|BT021093.1| Arabidopsis thaliana At5g14200 gene, complete cds 56 1e-04
27ref|NM_102856.1| Arabidopsis thaliana 3-isopropylmalate dehydrog... 54 5e-04
28gb|BT013160.1| Lycopersicon esculentum clone 134192F, mRNA sequence 54 5e-04
29emb|BX817489.1|CNS0ACN3 Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
30emb|BX815528.1|CNS0ACYQ Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
31emb|BX815259.1|CNS0ACUD Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
32gb|AY087344.1| Arabidopsis thaliana clone 34420 mRNA, complete s... 54 5e-04
33dbj|AK118237.1| Arabidopsis thaliana At1g31180 mRNA for putative... 54 5e-04
34gb|AC004793.2|F28K20 Arabidopsis thaliana chromosome 1 BAC F28K2... 54 5e-04
35ref|XM_752382.1| Ustilago maydis 521 hypothetical protein (UM013... 52 0.002
36emb|BX813607.1|CNS0ADTH Arabidopsis thaliana Full-length cDNA Co... 50 0.009
37gb|AC060761.10| Mus musculus chromosome 17, clone RP23-218D19, c... 44 0.53
38gb|AC018848.6|AC018848 Arabidopsis thaliana chromosome 1 BAC F5I... 44 0.53
39gb|AC018849.2|AC018849 Arabidopsis thaliana chromosome 1 BAC T21... 44 0.53
40dbj|AP001002.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 44 0.53
41emb|AL592112.7| Mouse DNA sequence from clone RP23-87H12 on chro... 44 0.53
42gb|BT013694.1| Lycopersicon esculentum clone 132535R, mRNA sequence 42 2.1
43ref|XM_779501.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.1
44emb|AL117353.6|HSJ944F13 Human DNA sequence from clone RP5-944F1... 42 2.1
45gb|AC079630.18| Homo sapiens 12 BAC RP11-476D10 (Roswell Park Ca... 42 2.1
46gb|AC161620.5| Pan troglodytes BAC clone CH251-232H7 from chromo... 42 2.1
47gb|AC135377.3| Mus musculus BAC clone RP24-66B2 from chromosome ... 42 2.1
48gb|AC005828.1|AC005828 Homo sapiens chromosome 17, clone hRPK.26... 42 2.1
49gb|AE004362.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 8.3
50emb|AL354760.11| Human DNA sequence from clone RP4-671G15 on chr... 40 8.3
51ref|XM_791287.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.3
52emb|Y00557.1|VCHLYA Vibrio cholerae DNA for hlyA, hlyB, lipA, li... 40 8.3
53emb|AL928632.13| Mouse DNA sequence from clone RP23-303M15 on ch... 40 8.3
54dbj|AK158464.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 40 8.3
55gb|AC154563.2| Mus musculus BAC clone RP23-401E22 from chromosom... 40 8.3
56gb|AC079171.22| Homo sapiens X BAC RP11-791M20 (Roswell Park Can... 40 8.3
57ref|NM_001033477.1| Mus musculus gene model 1322, (NCBI) (Gm1322... 40 8.3
58emb|Z81107.1|CER07H5 Caenorhabditis elegans Cosmid R07H5, comple... 40 8.3
59emb|Z81049.1|CEC48D1 Caenorhabditis elegans Cosmid C48D1, comple... 40 8.3
60emb|AL845473.7| Mouse DNA sequence from clone RP23-212E8 on chro... 40 8.3
61emb|AL845531.3| Mouse DNA sequence from clone RP23-232I4 on chro... 40 8.3
62emb|AL670544.7| Mouse DNA sequence from clone RP23-16G8 on chrom... 40 8.3
63emb|Y10690.1|MRZPG2 M.radiata mRNA for zona pellucida glycoprote... 40 8.3
64emb|AL713912.8| Mouse DNA sequence from clone RP23-85C14 on chro... 40 8.3 
>gb|BT009017.1| Triticum aestivum clone wdk3c.pk006.l8:fis, full insert mRNA
           sequence
          Length = 984

 Score =  434 bits (219), Expect = e-118
 Identities = 285/307 (92%)
 Strand = Plus / Minus

                                                                       
Query: 301 gcgctttcgaccatcccatgtggcatgcttggtacaccgtccataccgatgtctatcagg 360
           ||||||||||||||||||||| ||| ||||  |  ||| ||| ||| |||| ||||  | 
Sbjct: 720 gcgctttcgaccatcccatgttgcaggcttcttcaaccctccgtactgatggctattggt 661

                                                                       
Query: 361 ttactgtttacttctgcgactccagagccttcaggacttcctctcccattcgcttgcatc 420
           ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 660 ttgatgtttacttctgcgactccagagccttcaggacttcctctcccattcgcttgcatc 601

                                                                       
Query: 421 caaccaatgtcgttccaggagaatatatgtccccagttcggaacccattgtccagtgtct 480
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 600 caaccaatgtcgtcccaggagaatatatgtccccagttcggaacccattgtccagtgtct 541

                                                                       
Query: 481 ctgtaaccgcaacttcgattctctttgcagcactttctacgccaaggccatatttcaata 540
           ||||||||||  |||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 540 ctgtaaccgcggcttcgattctctttgcagcactttctacaccaaggccatatttcaata 481

                                                                       
Query: 541 gcattgccgcactaagaattgtagctaatgggtttgccttgtcctggccagcaatgtcag 600
           |||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 480 gcatcgcagcactaagaattgtagctaacgggtttgccttgtcctggccagcaatgtcag 421

                  
Query: 601 gagcaga 607
           |||||||
Sbjct: 420 gagcaga 414



 Score =  117 bits (59), Expect = 4e-23
 Identities = 149/177 (84%), Gaps = 14/177 (7%)
 Strand = Plus / Minus

                                                                       
Query: 95  cattccatccaggtgcaaagggaatcatccccatttttctatccat---ggacacaattc 151
           ||||||| |||||||||||||||| |||||||||||||||||||||   |||||||||||
Sbjct: 949 cattccagccaggtgcaaagggaaccatccccatttttctatccatcacggacacaattc 890

                                                                       
Query: 152 attcaatcgaggcacacgaaaatcattccgacgagcaatggaaagggaaaaggcgactca 211
           |||||||| ||||||||  ||||| |||| |||       |||||||||||| ||    |
Sbjct: 889 attcaatcaaggcacacacaaatctttccaacg------cgaaagggaaaagacg----a 840

                                                                    
Query: 212 tccgctaaaattcctgcactgaactacaagggcggaagcagacaaacagaaacaaaa 268
           |||||| ||||||||||||  |||||||||||||||||||| |||||| ||| ||||
Sbjct: 839 tccgct-aaattcctgcacccaactacaagggcggaagcaggcaaacataaaaaaaa 784
to top
>ref|XM_469071.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1712

 Score =  268 bits (135), Expect = 2e-68
 Identities = 210/235 (89%)
 Strand = Plus / Minus

                                                                        
Query: 373  tctgcgactccagagccttcaggacttcctctcccattcgcttgcatccaaccaatgtcg 432
            |||||||||| | || ||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 1367 tctgcgactctacagtcttcaggacttcctctcccattcgcttgcatccgaccaaggtcg 1308

                                                                        
Query: 433  ttccaggagaatatatgtccccagttcggaacccattgtccagtgtctctgtaaccgcaa 492
            |||||||||||||||||||||||||||||||||| ||||  |||||||||||||| ||  
Sbjct: 1307 ttccaggagaatatatgtccccagttcggaacccgttgtttagtgtctctgtaactgcgg 1248

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| | ||||||||||||| ||||| | |||||||||||   ||||||||| || ||||
Sbjct: 1247 cttcaactctctttgcagcattttcttctccaaggccataccgcaatagcatggcagcac 1188

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            |||||||||||||||||||||||||||| ||||| ||||||||||| || |||||
Sbjct: 1187 taagaattgtagctaatgggtttgccttatcctgcccagcaatgtcgggcgcaga 1133
to top
>dbj|AK066745.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013084N20, full
           insert sequence
          Length = 839

 Score =  268 bits (135), Expect = 2e-68
 Identities = 210/235 (89%)
 Strand = Plus / Minus

                                                                       
Query: 373 tctgcgactccagagccttcaggacttcctctcccattcgcttgcatccaaccaatgtcg 432
           |||||||||| | || ||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 577 tctgcgactctacagtcttcaggacttcctctcccattcgcttgcatccgaccaaggtcg 518

                                                                       
Query: 433 ttccaggagaatatatgtccccagttcggaacccattgtccagtgtctctgtaaccgcaa 492
           |||||||||||||||||||||||||||||||||| ||||  |||||||||||||| ||  
Sbjct: 517 ttccaggagaatatatgtccccagttcggaacccgttgtttagtgtctctgtaactgcgg 458

                                                                       
Query: 493 cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
           |||| | ||||||||||||| ||||| | |||||||||||   ||||||||| || ||||
Sbjct: 457 cttcaactctctttgcagcattttcttctccaaggccataccgcaatagcatggcagcac 398

                                                                  
Query: 553 taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
           |||||||||||||||||||||||||||| ||||| ||||||||||| || |||||
Sbjct: 397 taagaattgtagctaatgggtttgccttatcctgcccagcaatgtcgggcgcaga 343
to top
>dbj|AK120254.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013045L02, full
            insert sequence
          Length = 1540

 Score =  252 bits (127), Expect = 1e-63
 Identities = 209/235 (88%), Gaps = 1/235 (0%)
 Strand = Plus / Minus

                                                                        
Query: 373  tctgcgactccagagccttcaggacttcctctcccattcgcttgcatccaaccaatgtcg 432
            |||||||||| | || ||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 1199 tctgcgactctacagtcttcaggacttcctctcccattcgcttgcatccgaccaaggtcg 1140

                                                                        
Query: 433  ttccaggagaatatatgtccccagttcggaacccattgtccagtgtctctgtaaccgcaa 492
            |||||||||||||||||||||||||||||||||| ||||  |||||||||||||| ||  
Sbjct: 1139 ttccaggagaatatatgtccccagttcggaacccgttgtttagtgtctctgtaactgcgg 1080

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |  |||||||||||| ||||| | |||||||||||   ||||||||| || ||||
Sbjct: 1079 cttc-aacctctttgcagcattttcttctccaaggccataccgcaatagcatggcagcac 1021

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            |||||||||||||||||||||||||||| ||||| ||||||||||| || |||||
Sbjct: 1020 taagaattgtagctaatgggtttgccttatcctgcccagcaatgtcgggcgcaga 966
to top
>gb|BT017009.1| Zea mays clone EK07D2310G02.c mRNA sequence
          Length = 1036

 Score =  220 bits (111), Expect = 4e-54
 Identities = 192/219 (87%)
 Strand = Plus / Minus

                                                                       
Query: 389 cttcaggacttcctctcccattcgcttgcatccaaccaatgtcgttccaggagaatatat 448
           ||||| ||||||||| ||||| |||||||||||||||| ||| |||||||||||||||||
Sbjct: 750 cttcaagacttcctcccccatccgcttgcatccaaccagtgttgttccaggagaatatat 691

                                                                       
Query: 449 gtccccagttcggaacccattgtccagtgtctctgtaaccgcaacttcgattctctttgc 508
           |||||||||||||||||||| || |||||| |||||||| ||| |||| |||||| | ||
Sbjct: 690 gtccccagttcggaacccatggttcagtgtttctgtaactgcagcttcaattctcctcgc 631

                                                                       
Query: 509 agcactttctacgccaaggccatatttcaatagcattgccgcactaagaattgtagctaa 568
           |||| ||||| | || |||||||||  ||||||||| || || |||||||||||||||||
Sbjct: 630 agcattttcttctcctaggccatatcgcaatagcatcgctgcgctaagaattgtagctaa 571

                                                  
Query: 569 tgggtttgccttgtcctggccagcaatgtcaggagcaga 607
           ||| || ||||||||||| |||||||| ||||| |||||
Sbjct: 570 tggattggccttgtcctgtccagcaatatcaggggcaga 532
to top
>gb|AY108697.1| Zea mays PCO126508 mRNA sequence
          Length = 1558

 Score =  220 bits (111), Expect = 4e-54
 Identities = 192/219 (87%)
 Strand = Plus / Minus

                                                                        
Query: 389  cttcaggacttcctctcccattcgcttgcatccaaccaatgtcgttccaggagaatatat 448
            ||||| ||||||||| ||||| |||||||||||||||| ||| |||||||||||||||||
Sbjct: 1265 cttcaagacttcctcccccatccgcttgcatccaaccagtgttgttccaggagaatatat 1206

                                                                        
Query: 449  gtccccagttcggaacccattgtccagtgtctctgtaaccgcaacttcgattctctttgc 508
            |||||||||||||||||||| || |||||| |||||||| ||| |||| |||||| | ||
Sbjct: 1205 gtccccagttcggaacccatggttcagtgtttctgtaactgcagcttcaattctcctcgc 1146

                                                                        
Query: 509  agcactttctacgccaaggccatatttcaatagcattgccgcactaagaattgtagctaa 568
            |||| ||||| | || |||||||||  ||||||||| || || |||||||||||||||||
Sbjct: 1145 agcattttcttctcctaggccatatcgcaatagcatcgctgcgctaagaattgtagctaa 1086

                                                   
Query: 569  tgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            ||| || ||||||||||| |||||||| ||||| |||||
Sbjct: 1085 tggattggccttgtcctgtccagcaatatcaggggcaga 1047
to top
>gb|BT016862.1| Zea mays clone Contig695 mRNA sequence
          Length = 1573

 Score =  212 bits (107), Expect = 1e-51
 Identities = 191/219 (87%)
 Strand = Plus / Plus

                                                                       
Query: 389 cttcaggacttcctctcccattcgcttgcatccaaccaatgtcgttccaggagaatatat 448
           |||||||||||| || ||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 344 cttcaggacttcttcccccatccgcttgcatccaaccaatgttgttccaggagaatatat 403

                                                                       
Query: 449 gtccccagttcggaacccattgtccagtgtctctgtaaccgcaacttcgattctctttgc 508
           |||||||||||||||||||| || |||||| || ||||| ||| |||| ||||| || ||
Sbjct: 404 gtccccagttcggaacccatggttcagtgtttcagtaactgcagcttcaattctgttcgc 463

                                                                       
Query: 509 agcactttctacgccaaggccatatttcaatagcattgccgcactaagaattgtagctaa 568
           |||| ||||| | || ||||||||| |||||||||| || ||||||||||||||||| ||
Sbjct: 464 agcattttcttctcctaggccatatctcaatagcatcgctgcactaagaattgtagccaa 523

                                                  
Query: 569 tgggtttgccttgtcctggccagcaatgtcaggagcaga 607
           |||  |  |||||||||| |||||||| ||||| |||||
Sbjct: 524 tggactgcccttgtcctgtccagcaatatcaggggcaga 562
to top
>gb|AY112331.1| Zea mays CL362_2 mRNA sequence
          Length = 604

 Score =  208 bits (105), Expect = 2e-50
 Identities = 174/197 (88%)
 Strand = Plus / Minus

                                                                       
Query: 411 cgcttgcatccaaccaatgtcgttccaggagaatatatgtccccagttcggaacccattg 470
           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
Sbjct: 303 cgcttgcatccaaccaatgttgttccaggagaatatatgtccccagttcggaacccatgg 244

                                                                       
Query: 471 tccagtgtctctgtaaccgcaacttcgattctctttgcagcactttctacgccaaggcca 530
           | |||||| || ||||| ||| |||| ||||| || |||||| ||||| | || ||||||
Sbjct: 243 ttcagtgtttcagtaactgcagcttcaattctgttcgcagcattttcttctcctaggcca 184

                                                                       
Query: 531 tatttcaatagcattgccgcactaagaattgtagctaatgggtttgccttgtcctggcca 590
           ||| |||||||||| || ||||||||||||||||| ||||| || ||||||||||| |||
Sbjct: 183 tatctcaatagcatcgctgcactaagaattgtagccaatggattggccttgtcctgtcca 124

                            
Query: 591 gcaatgtcaggagcaga 607
           ||||| ||||| |||||
Sbjct: 123 gcaatatcaggggcaga 107
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  174 bits (88), Expect = 2e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                            
Query: 431      cgttccaggagaatatatgtccccagttcggaacccattgtccagtgtctctgtaaccgc 490
                |||||||||||||||||||||||||||||||||||| ||||  |||||||||||||| ||
Sbjct: 25303239 cgttccaggagaatatatgtccccagttcggaacccgttgtttagtgtctctgtaactgc 25303180

                                                                            
Query: 491      aacttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgc 550
                  |||| | ||||||||||||| ||||| | |||||||||||   ||||||||| || ||
Sbjct: 25303179 ggcttcaactctctttgcagcattttcttctccaaggccataccgcaatagcatggcagc 25303120

                                                    
Query: 551      actaagaattgtagctaatgggtttgccttgtcctg 586
                |||||||||||||||||||||||||||||| |||||
Sbjct: 25303119 actaagaattgtagctaatgggtttgccttatcctg 25303084



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                       
Query: 373      tctgcgactccagagccttcaggacttcctctcccattcgcttgcatccaaccaa 427
                |||||||||| | || ||||||||||||||||||||||||||||||||| |||||
Sbjct: 25303853 tctgcgactctacagtcttcaggacttcctctcccattcgcttgcatccgaccaa 25303799
to top
>gb|AC133859.4| Oryza sativa chromosome 3 BAC OSJNBa0075A22 genomic sequence, complete
              sequence
          Length = 152828

 Score =  174 bits (88), Expect = 2e-40
 Identities = 139/156 (89%)
 Strand = Plus / Plus

                                                                          
Query: 431    cgttccaggagaatatatgtccccagttcggaacccattgtccagtgtctctgtaaccgc 490
              |||||||||||||||||||||||||||||||||||| ||||  |||||||||||||| ||
Sbjct: 140121 cgttccaggagaatatatgtccccagttcggaacccgttgtttagtgtctctgtaactgc 140180

                                                                          
Query: 491    aacttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgc 550
                |||| | ||||||||||||| ||||| | |||||||||||   ||||||||| || ||
Sbjct: 140181 ggcttcaactctctttgcagcattttcttctccaaggccataccgcaatagcatggcagc 140240

                                                  
Query: 551    actaagaattgtagctaatgggtttgccttgtcctg 586
              |||||||||||||||||||||||||||||| |||||
Sbjct: 140241 actaagaattgtagctaatgggtttgccttatcctg 140276



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                     
Query: 373    tctgcgactccagagccttcaggacttcctctcccattcgcttgcatccaaccaa 427
              |||||||||| | || ||||||||||||||||||||||||||||||||| |||||
Sbjct: 139507 tctgcgactctacagtcttcaggacttcctctcccattcgcttgcatccgaccaa 139561
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  174 bits (88), Expect = 2e-40
 Identities = 139/156 (89%)
 Strand = Plus / Minus

                                                                            
Query: 431      cgttccaggagaatatatgtccccagttcggaacccattgtccagtgtctctgtaaccgc 490
                |||||||||||||||||||||||||||||||||||| ||||  |||||||||||||| ||
Sbjct: 25394548 cgttccaggagaatatatgtccccagttcggaacccgttgtttagtgtctctgtaactgc 25394489

                                                                            
Query: 491      aacttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgc 550
                  |||| | ||||||||||||| ||||| | |||||||||||   ||||||||| || ||
Sbjct: 25394488 ggcttcaactctctttgcagcattttcttctccaaggccataccgcaatagcatggcagc 25394429

                                                    
Query: 551      actaagaattgtagctaatgggtttgccttgtcctg 586
                |||||||||||||||||||||||||||||| |||||
Sbjct: 25394428 actaagaattgtagctaatgggtttgccttatcctg 25394393



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                       
Query: 373      tctgcgactccagagccttcaggacttcctctcccattcgcttgcatccaaccaa 427
                |||||||||| | || ||||||||||||||||||||||||||||||||| |||||
Sbjct: 25395162 tctgcgactctacagtcttcaggacttcctctcccattcgcttgcatccgaccaa 25395108
to top
>ref|NM_106704.2| Arabidopsis thaliana 3-isopropylmalate dehydrogenase/ oxidoreductase
            AT1G80560 mRNA, complete cds
          Length = 1432

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 1124 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 1065

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            | ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1064 ttagaatggttgccaatgggtttgccttatcctgtccagcaatatcaggtgcaga 1010
to top
>emb|Y10216.1|ATIMDH A.thaliana mRNA for hypothetical 3-isopropylmalate dehydrogenase
          Length = 1457

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 1124 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 1065

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            | ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1064 ttagaatggttgccaatgggtttgccttatcctgtccagcaatatcaggtgcaga 1010
to top
>gb|AY114627.1| Arabidopsis thaliana putative 3-isopropylmalate dehydrogenase
            (At1g80560) mRNA, complete cds
          Length = 1356

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 1081 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 1022

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            | ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1021 ttagaatggttgccaatgggtttgccttatcctgtccagcaatatcaggtgcaga 967
to top
>gb|AY062441.1| Arabidopsis thaliana putative 3-isopropylmalate dehydrogenase
            (At1g80560; T21F11.11) mRNA, complete cds
          Length = 1406

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 1102 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 1043

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            | ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1042 ttagaatggttgccaatgggtttgccttatcctgtccagcaatatcaggtgcaga 988
to top
>emb|BX815110.1|CNS0ABD5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS33ZE01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1375

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 1102 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 1043

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            | ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1042 ttagaatggttgccaatgggtttgccttatcctgtccagcaatatcaggtgcaga 988
to top
>gb|AY085451.1| Arabidopsis thaliana clone 152141 mRNA, complete sequence
          Length = 1420

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 493  cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
            |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 1116 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 1057

                                                                   
Query: 553  taagaattgtagctaatgggtttgccttgtcctggccagcaatgtcaggagcaga 607
            | ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 1056 ttagaatggttgccaatgggtttgccttatcctgtccagcaatatcaggtgcaga 1002
to top
>ref|NM_121424.4| Arabidopsis thaliana 3-isopropylmalate dehydrogenase/ oxidoreductase
            AT5G14200 transcript variant AT5G14200.1 mRNA, complete
            cds
          Length = 1377

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1103 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1044

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1043 gtggccaatgggtttgccttgtcttgtccagc 1012
to top
>ref|NM_001036803.1| Arabidopsis thaliana 3-isopropylmalate dehydrogenase/ oxidoreductase
            AT5G14200 transcript variant AT5G14200.3 mRNA, complete
            cds
          Length = 1463

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1103 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1044

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1043 gtggccaatgggtttgccttgtcttgtccagc 1012
to top
>ref|NM_001036802.1| Arabidopsis thaliana 3-isopropylmalate dehydrogenase/ oxidoreductase
            AT5G14200 transcript variant AT5G14200.2 mRNA, complete
            cds
          Length = 1379

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1105 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1046

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1045 gtggccaatgggtttgccttgtcttgtccagc 1014
to top
>gb|BT015784.1| Arabidopsis thaliana At5g14200 mRNA, complete cds
          Length = 1230

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1085 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1026

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1025 gtggccaatgggtttgccttgtcttgtccagc 994
to top
>gb|AY074587.1| Arabidopsis thaliana AT5g14200/MUA22_20 mRNA, complete cds
          Length = 1360

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1099 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1040

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1039 gtggccaatgggtttgccttgtcttgtccagc 1008
to top
>emb|BX831418.1|CNS09ZG0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS88ZF05 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1320

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1077 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1018

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1017 gtggccaatgggtttgccttgtcttgtccagc 986
to top
>emb|BX831381.1|CNS09ZGM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS84ZG10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1329

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1081 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1022

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1021 gtggccaatgggtttgccttgtcttgtccagc 990
to top
>dbj|AB007650.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA22
          Length = 65465

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 501   ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
             |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 53739 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 53680

                                             
Query: 561   gtagctaatgggtttgccttgtcctggccagc 592
             || || ||||||||||||||||| || |||||
Sbjct: 53679 gtggccaatgggtttgccttgtcttgtccagc 53648
to top
>gb|BT021093.1| Arabidopsis thaliana At5g14200 gene, complete cds
          Length = 1290

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 501  ctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaatt 560
            |||||||||||  ||||| | ||||| ||||| ||||  ||||| ||||| || ||||| 
Sbjct: 1087 ctctttgcagccttttcttctccaagtccatacttcagaagcatcgccgcgctgagaatg 1028

                                            
Query: 561  gtagctaatgggtttgccttgtcctggccagc 592
            || || ||||||||||||||||| || |||||
Sbjct: 1027 gtggccaatgggtttgccttgtcttgtccagc 996
to top
>ref|NM_102856.1| Arabidopsis thaliana 3-isopropylmalate dehydrogenase/ oxidoreductase
            AT1G31180 mRNA, complete cds
          Length = 1347

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 502  tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
            ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 1090 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 1031

                                           
Query: 562  tagctaatgggtttgccttgtcctggccagc 592
            | || ||||||||||||||||| || |||||
Sbjct: 1030 tggccaatgggtttgccttgtcttgtccagc 1000
to top
>gb|BT013160.1| Lycopersicon esculentum clone 134192F, mRNA sequence
          Length = 1488

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                        
Query: 525  aggccatatttcaatagcattgccgcactaagaattgtagctaatgggtttgccttgtcc 584
            |||||||| ||||  ||||| || ||||| || ||||| || || |||||||| || |||
Sbjct: 1068 aggccatacttcagaagcatagcagcactgagcattgttgccaaagggtttgctttatcc 1009

                                   
Query: 585  tggccagcaatgtcaggagcaga 607
            || |||||||| |||||||||||
Sbjct: 1008 tgcccagcaatatcaggagcaga 986
to top
>emb|BX817489.1|CNS0ACN3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL26ZC03 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 1252

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 502  tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
            ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 1033 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 974

                                           
Query: 562  tagctaatgggtttgccttgtcctggccagc 592
            | || ||||||||||||||||| || |||||
Sbjct: 973  tggccaatgggtttgccttgtcttgtccagc 943
to top
>emb|BX815528.1|CNS0ACYQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS6ZE10 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1292

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 502  tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
            ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 1066 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 1007

                                           
Query: 562  tagctaatgggtttgccttgtcctggccagc 592
            | || ||||||||||||||||| || |||||
Sbjct: 1006 tggccaatgggtttgccttgtcttgtccagc 976
to top
>emb|BX815259.1|CNS0ACUD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS47ZC06 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1371

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 502  tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
            ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 1142 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 1083

                                           
Query: 562  tagctaatgggtttgccttgtcctggccagc 592
            | || ||||||||||||||||| || |||||
Sbjct: 1082 tggccaatgggtttgccttgtcttgtccagc 1052
to top
>gb|AY087344.1| Arabidopsis thaliana clone 34420 mRNA, complete sequence
          Length = 1348

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                        
Query: 502  tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
            ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 1091 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 1032

                                           
Query: 562  tagctaatgggtttgccttgtcctggccagc 592
            | || ||||||||||||||||| || |||||
Sbjct: 1031 tggccaatgggtttgccttgtcttgtccagc 1001
to top
>dbj|AK118237.1| Arabidopsis thaliana At1g31180 mRNA for putative 3-isopropylmalate
           dehydrogenase, complete cds, clone: RAFL19-54-L24
          Length = 1203

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Minus

                                                                       
Query: 502 tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
           ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 955 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 896

                                          
Query: 562 tagctaatgggtttgccttgtcctggccagc 592
           | || ||||||||||||||||| || |||||
Sbjct: 895 tggccaatgggtttgccttgtcttgtccagc 865
to top
>gb|AC004793.2|F28K20 Arabidopsis thaliana chromosome 1 BAC F28K20 sequence, complete
             sequence
          Length = 76458

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                         
Query: 502   tctttgcagcactttctacgccaaggccatatttcaatagcattgccgcactaagaattg 561
             ||||||||||  ||||| | ||||| ||||| || |  ||||| |||||||| ||||| |
Sbjct: 54209 tctttgcagccttttcttctccaagtccatacttgagaagcatcgccgcactgagaatgg 54268

                                            
Query: 562   tagctaatgggtttgccttgtcctggccagc 592
             | || ||||||||||||||||| || |||||
Sbjct: 54269 tggccaatgggtttgccttgtcttgtccagc 54299
to top
>ref|XM_752382.1| Ustilago maydis 521 hypothetical protein (UM01328.1) partial mRNA
          Length = 1161

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 570 gggtttgccttgtcctggccagcaatgtcaggagcaga 607
           ||||| ||||||||||||||||||||||| || |||||
Sbjct: 986 gggttcgccttgtcctggccagcaatgtcgggggcaga 949
to top
>emb|BX813607.1|CNS0ADTH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB27ZF05 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1293

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 540  agcattgccgcactaagaattgtagctaatgggtttgccttgtcctggccagc 592
            ||||| |||||||| ||||| || || ||||||||||||||||| || |||||
Sbjct: 1031 agcatcgccgcactgagaatggtggccaatgggtttgccttgtcttgtccagc 979
to top
>gb|AC060761.10| Mus musculus chromosome 17, clone RP23-218D19, complete sequence
          Length = 228922

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 11     atgagatgacatgattgaccaatgac 36
              ||||||||| ||||||||||||||||
Sbjct: 162848 atgagatgagatgattgaccaatgac 162873
to top
>gb|AC018848.6|AC018848 Arabidopsis thaliana chromosome 1 BAC F5I6 genomic sequence, complete
              sequence
          Length = 132990

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 76/94 (80%)
 Strand = Plus / Minus

                                                                          
Query: 493    cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
              |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 117368 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 117309

                                                
Query: 553    taagaattgtagctaatgggtttgccttgtcctg 586
              | ||||| || || |||||||||||||| |||||
Sbjct: 117308 ttagaatggttgccaatgggtttgccttatcctg 117275
to top
>gb|AC018849.2|AC018849 Arabidopsis thaliana chromosome 1 BAC T21F11 genomic sequence, complete
             sequence
          Length = 89811

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                         
Query: 493   cttcgattctctttgcagcactttctacgccaaggccatatttcaatagcattgccgcac 552
             |||| |||||||| || ||  ||||| | ||||| || |||||||  |||||||| || |
Sbjct: 28782 cttcaattctcttggctgccttttcttctccaagtccgtatttcagaagcattgcagcgc 28841

                                               
Query: 553   taagaattgtagctaatgggtttgccttgtcctg 586
             | ||||| || || |||||||||||||| |||||
Sbjct: 28842 ttagaatggttgccaatgggtttgccttatcctg 28875
to top
>dbj|AP001002.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-678K21, complete
              sequences
          Length = 164380

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 125    ccatttttctatccatggacac 146
              ||||||||||||||||||||||
Sbjct: 101132 ccatttttctatccatggacac 101111
to top
>emb|AL592112.7| Mouse DNA sequence from clone RP23-87H12 on chromosome 17, complete
             sequence
          Length = 158307

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 11    atgagatgacatgattgaccaatgac 36
             ||||||||| ||||||||||||||||
Sbjct: 36365 atgagatgagatgattgaccaatgac 36390
to top
>gb|BT013694.1| Lycopersicon esculentum clone 132535R, mRNA sequence
          Length = 2264

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 184 gagcaatggaaagggaaaagg 204
           |||||||||||||||||||||
Sbjct: 247 gagcaatggaaagggaaaagg 227
to top
>ref|XM_779501.1| PREDICTED: Strongylocentrotus purpuratus similar to calcyphosphine
           2 (LOC579381), mRNA
          Length = 2154

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 248 agcagacaaacagaaacaaaa 268
           |||||||||||||||||||||
Sbjct: 159 agcagacaaacagaaacaaaa 179
to top
>emb|AL117353.6|HSJ944F13 Human DNA sequence from clone RP5-944F13 on chromosome 1p31.2-32.1
             Contains part of gene KIAA1365, complete sequence
          Length = 113515

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 251   agacaaacagaaacaaaatca 271
             |||||||||||||||||||||
Sbjct: 22922 agacaaacagaaacaaaatca 22942
to top
>gb|AC079630.18| Homo sapiens 12 BAC RP11-476D10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178388

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 125    ccatttttctatccatggaca 145
              |||||||||||||||||||||
Sbjct: 163497 ccatttttctatccatggaca 163517
to top
>gb|AC161620.5| Pan troglodytes BAC clone CH251-232H7 from chromosome unknown, complete
              sequence
          Length = 204271

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 125    ccatttttctatccatggaca 145
              |||||||||||||||||||||
Sbjct: 145087 ccatttttctatccatggaca 145067
to top
>gb|AC135377.3| Mus musculus BAC clone RP24-66B2 from chromosome 19, complete sequence
          Length = 179745

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 64    cagtgccaaaatataaatcaaactt 88
             ||||||||||||||||| |||||||
Sbjct: 85698 cagtgccaaaatataaaacaaactt 85722
to top
>gb|AC005828.1|AC005828 Homo sapiens chromosome 17, clone hRPK.269_G_24, complete sequence
          Length = 163685

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 188   aatggaaagggaaaaggcgac 208
             |||||||||||||||||||||
Sbjct: 62792 aatggaaagggaaaaggcgac 62812
to top
>gb|AE004362.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 19
             of 93 of the complete chromosome
          Length = 11541

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    agatgacatgattgaccaat 33
             ||||||||||||||||||||
Sbjct: 10387 agatgacatgattgaccaat 10406
to top
>emb|AL354760.11| Human DNA sequence from clone RP4-671G15 on chromosome 1p13.1-13.3
             Contains the 3' end of the gene for a novel protein, the
             5' end of the WNT2B gene for wingless-type MMTV
             integration site family, member 2B and a CpG island,
             complete sequence
          Length = 111977

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 59    aatgacagtgccaaaatata 78
             ||||||||||||||||||||
Sbjct: 12206 aatgacagtgccaaaatata 12225
to top
>ref|XM_791287.1| PREDICTED: Strongylocentrotus purpuratus similar to Nasopharyngeal
           epithelium specific protein 1 (LOC591735), partial mRNA
          Length = 1158

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 aagcagacaaacagaaacaa 266
           ||||||||||||||||||||
Sbjct: 425 aagcagacaaacagaaacaa 444
to top
>emb|Y00557.1|VCHLYA Vibrio cholerae DNA for hlyA, hlyB, lipA, lipB and prtV genes
          Length = 11162

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 14   agatgacatgattgaccaat 33
            ||||||||||||||||||||
Sbjct: 9214 agatgacatgattgaccaat 9233
to top
>emb|AL928632.13| Mouse DNA sequence from clone RP23-303M15 on chromosome 2, complete
             sequence
          Length = 217309

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    accaatgacaggaatttgcc 47
             ||||||||||||||||||||
Sbjct: 32558 accaatgacaggaatttgcc 32539
to top
>dbj|AK158464.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
            library, clone:F930118H22 product:hypothetical protein,
            full insert sequence
          Length = 1976

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 125  ccatttttctatccatggac 144
            ||||||||||||||||||||
Sbjct: 1078 ccatttttctatccatggac 1059
to top
>gb|AC154563.2| Mus musculus BAC clone RP23-401E22 from chromosome 14, complete
             sequence
          Length = 206798

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 249   gcagacaaacagaaacaaaa 268
             ||||||||||||||||||||
Sbjct: 94934 gcagacaaacagaaacaaaa 94915
to top
>gb|AC079171.22| Homo sapiens X BAC RP11-791M20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 147895

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 253   acaaacagaaacaaaatcac 272
             ||||||||||||||||||||
Sbjct: 96573 acaaacagaaacaaaatcac 96554
to top
>ref|NM_001033477.1| Mus musculus gene model 1322, (NCBI) (Gm1322), mRNA
          Length = 1976

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 125  ccatttttctatccatggac 144
            ||||||||||||||||||||
Sbjct: 1078 ccatttttctatccatggac 1059
to top
>emb|Z81107.1|CER07H5 Caenorhabditis elegans Cosmid R07H5, complete sequence
          Length = 33802

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   aatcatccccatttttctat 136
             ||||||||||||||||||||
Sbjct: 14209 aatcatccccatttttctat 14228
to top
>emb|Z81049.1|CEC48D1 Caenorhabditis elegans Cosmid C48D1, complete sequence
          Length = 39908

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   aatcatccccatttttctat 136
             ||||||||||||||||||||
Sbjct: 32683 aatcatccccatttttctat 32664
to top
>emb|AL845473.7| Mouse DNA sequence from clone RP23-212E8 on chromosome 2, complete
              sequence
          Length = 189998

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    ccatttttctatccatggac 144
              ||||||||||||||||||||
Sbjct: 137663 ccatttttctatccatggac 137644
to top
>emb|AL845531.3| Mouse DNA sequence from clone RP23-232I4 on chromosome 2, complete
             sequence
          Length = 120366

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 357   caggttactgtttacttctg 376
             ||||||||||||||||||||
Sbjct: 72491 caggttactgtttacttctg 72472
to top
>emb|AL670544.7| Mouse DNA sequence from clone RP23-16G8 on chromosome X, complete
              sequence
          Length = 236946

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 388    ccttcaggacttcctctcccattc 411
              ||||||| ||||||||||||||||
Sbjct: 125484 ccttcagtacttcctctcccattc 125507
to top
>emb|Y10690.1|MRZPG2 M.radiata mRNA for zona pellucida glycoprotein-2
          Length = 2280

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 51  tcatcacaaatgacagtgcc 70
           ||||||||||||||||||||
Sbjct: 170 tcatcacaaatgacagtgcc 151
to top
>emb|AL713912.8| Mouse DNA sequence from clone RP23-85C14 on chromosome 4, complete
             sequence
          Length = 46478

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    aacttccgttccattccatccagg 107
             |||| |||||||||||||||||||
Sbjct: 39175 aactcccgttccattccatccagg 39152


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,372,527
Number of Sequences: 3902068
Number of extensions: 5372527
Number of successful extensions: 121603
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 121436
Number of HSP's gapped (non-prelim): 165
length of query: 607
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 584
effective length of database: 17,143,297,704
effective search space: 10011685859136
effective search space used: 10011685859136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top