ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags7e04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC146340.1| Genomic sequence for Oryza sativa, Nipponbare str... 44 0.081
2gb|AC090487.3| Genomic Sequence for Oryza sativa, Nipponbare str... 44 0.081
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.081
4gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.081
5gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, c... 38 5.0
6ref|NM_120322.1| Arabidopsis thaliana unknown protein AT5G02440 ... 38 5.0
7ref|NM_113585.2| Arabidopsis thaliana unknown protein AT3G26740 ... 38 5.0
8ref|NM_116248.2| Arabidopsis thaliana transcription regulator AT... 38 5.0
9ref|XM_633606.1| Dictyostelium discoideum hypothetical protein (... 38 5.0
10ref|XM_640756.1| Dictyostelium discoideum hypothetical protein (... 38 5.0
11ref|XM_638252.1| Dictyostelium discoideum putative GCN2 family k... 38 5.0
12ref|XM_634942.1| Dictyostelium discoideum histidine kinase (DDB0... 38 5.0
13ref|XM_634212.1| Dictyostelium discoideum putative GCN2 family k... 38 5.0
14ref|XM_633905.1| Dictyostelium discoideum rhodanese-like domain-... 38 5.0
15ref|XM_482655.1| Oryza sativa (japonica cultivar-group), mRNA 38 5.0
16ref|NM_196978.1| Oryza sativa (japonica cultivar-group) putative... 38 5.0
17gb|BT017669.1| Zea mays clone EL01N0442A09.c mRNA sequence 38 5.0
18gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 38 5.0
19gb|AC091330.18| Trypanosoma brucei chromosome 3 clone RPCI93-48O... 38 5.0
20ref|NM_001007257.1| Homo sapiens PR domain containing 2, with ZN... 38 5.0
21ref|NM_012231.3| Homo sapiens PR domain containing 2, with ZNF d... 38 5.0
22ref|NM_015866.3| Homo sapiens PR domain containing 2, with ZNF d... 38 5.0
23gb|AY359966.1| Lycopersicon esculentum EIX receptor 2 (Eix2) gen... 38 5.0
24ref|XM_717718.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
25ref|XM_717573.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
26ref|XM_707450.1| Candida albicans SC5314 putative kinteochore or... 38 5.0
27ref|XM_707420.1| Candida albicans SC5314 putative kinteochore or... 38 5.0
28ref|XM_708602.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
29ref|XM_708601.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
30ref|XM_708557.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
31ref|XM_708556.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
32ref|XM_707284.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
33ref|XM_707248.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
34ref|XM_453824.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D17270g ... 38 5.0
35gb|AY816032.1| Schistosoma japonicum SJCHGC02588 protein mRNA, c... 38 5.0
36gb|AY557702.1| Saccharomyces cerevisiae clone FLH001734.01X YDR1... 38 5.0
37gb|AC116979.3| Dictyostelium discoideum chromosome 2 map 6445720... 38 5.0
38gb|AC141425.3| Mus musculus BAC clone RP23-283P2 from chromosome... 38 5.0
39ref|XM_710157.1| Candida albicans SC5314 hypothetical protein (R... 38 5.0
40ref|XM_821527.1| Trypanosoma brucei TREU927 clone RPCI93-48O8 hy... 38 5.0
41ref|XM_799664.1| Trypanosoma cruzi strain CL Brener hypothetical... 38 5.0
42gb|AC004097.1|HUAC004097 Human Chromosome 16 BAC clone CIT987SK-... 38 5.0
43gb|AC126428.3| Mus musculus BAC clone RP24-387B13 from chromosom... 38 5.0
44ref|XM_883892.1| Candida albicans SC5314 hypothetical protein (C... 38 5.0
45emb|CR391986.5| Zebrafish DNA sequence from clone CH211-195O20 i... 38 5.0
46ref|XM_721531.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 38 5.0
47ref|XM_736261.1| Plasmodium chabaudi chabaudi hypothetical prote... 38 5.0
48gb|AC163007.4| Mus musculus chromosome 1, clone RP23-421G18, com... 38 5.0
49gb|AC144517.7| Medicago truncatula clone mth2-13k17, complete se... 38 5.0
50gb|AC144722.11| Medicago truncatula clone mth2-26h11, complete s... 38 5.0
51gb|AC137996.33| Medicago truncatula clone mth2-19k16, complete s... 38 5.0
52ref|XM_784611.1| PREDICTED: Strongylocentrotus purpuratus simila... 38 5.0
53emb|AL049553.20|HSJ402N21 Human DNA sequence from clone RP3-402N... 38 5.0
54emb|AL035106.28|HS998C11 Human DNA sequence from clone RP5-998C1... 38 5.0
55emb|AL031277.1|HS1177E19 Human DNA sequence from clone RP5-1177E... 38 5.0
56gb|AY237156.1| Homo sapiens ABPA2 gene, intron 3 and repeat region 38 5.0
57emb|Z50046.1|SC8358 S.cerevisiae chromosome IV cosmid 8358 38 5.0
58emb|X98130.1|AT81KBGEN Arabidopsis thaliana 81kb genomic sequence 38 5.0
59emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 38 5.0
60emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete ... 38 5.0
61emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chrom... 38 5.0
62emb|AL645862.14| Mouse DNA sequence from clone RP23-223A11 on ch... 38 5.0
63emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, B... 38 5.0
64emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BA... 38 5.0
65emb|AL161579.2|ATCHRIV75 Arabidopsis thaliana DNA chromosome 4, ... 38 5.0
66emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c... 38 5.0
67emb|AL049607.1|ATF11C18 Arabidopsis thaliana DNA chromosome 4, B... 38 5.0
68gb|AC023712.5| Drosophila melanogaster X BAC RP98-1M22 (Roswell ... 38 5.0
69gb|AC023692.5| Drosophila melanogaster X BAC RP98-15B10 (Roswell... 38 5.0
70gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete s... 38 5.0
71gb|AC107029.4| Homo sapiens 3 BAC RP11-550H20 (Roswell Park Canc... 38 5.0
72gb|AC116350.2| Homo sapiens chromosome 5 clone RP11-357F12, comp... 38 5.0
73dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111 38 5.0
74gb|AC006284.4| Arabidopsis thaliana chromosome 2 clone T4M8 map ... 38 5.0
75dbj|AB108394.1| Phleum pratense DNA, SSR, microsatellite D01-F06 38 5.0
76gb|AC024474.8| Homo sapiens chromosome 15, clone RP11-686I6, com... 38 5.0
77gb|AC055723.22| Homo sapiens 3 BAC RP11-201E8 (Roswell Park Canc... 38 5.0
78gb|AF098987.1| Caenorhabditis elegans cosmid F40H3, complete seq... 38 5.0
79gb|AF361590.1| Arabidopsis thaliana AT4g00270/A_IG005I10_11 mRNA... 38 5.0
80gb|AF375445.1| Arabidopsis thaliana AT3g26740/MLJ15_14 mRNA, com... 38 5.0
81gb|AY074837.1| Arabidopsis thaliana AT4g00270/A_IG005I10_11 mRNA... 38 5.0
82gb|AC099514.2| Homo sapiens chromosome 5 clone RP11-454E7, compl... 38 5.0
83gb|AY060542.1| Arabidopsis thaliana AT3g26740/MLJ15_14 mRNA, com... 38 5.0
84gb|AC078948.11| Oryza sativa chromosome 10 BAC OSJNBa0001K12 gen... 38 5.0
85gb|AF424610.1|AF424610 Arabidopsis thaliana AT3g26740/MLJ15_14 m... 38 5.0
86gb|AF410315.1|AF410315 Arabidopsis thaliana AT3g26740/MLJ15_14 m... 38 5.0
87gb|AC060788.11| Homo sapiens chromosome 8, clone CTD-2008O4, com... 38 5.0
88ref|NM_062832.1| Caenorhabditis elegans F40H3.1 (F40H3.1) mRNA, ... 38 5.0
89ref|NM_171411.2| Caenorhabditis elegans Temporarily Assigned Gen... 38 5.0
90ref|NM_171410.3| Caenorhabditis elegans Temporarily Assigned Gen... 38 5.0
91gb|AC008002.3|AC008002 Drosophila melanogaster, chromosome 2L, r... 38 5.0
92dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
93dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
94emb|BX821643.1|CNS0A8EF Arabidopsis thaliana Full-length cDNA Co... 38 5.0
95emb|BX823670.1|CNS0A7KD Arabidopsis thaliana Full-length cDNA Co... 38 5.0
96emb|BX823778.1|CNS0A5CC Arabidopsis thaliana Full-length cDNA Co... 38 5.0
97emb|BX842202.1|CNS09YD3 Arabidopsis thaliana Full-length cDNA Co... 38 5.0
98gb|AF247465.1|AF247465 Coptotermes formosanus clone Cf4-10 micro... 38 5.0
99gb|AF247464.1|AF247464 Coptotermes formosanus clone Cf4-9A micro... 38 5.0
100gb|AF463766.1| Mus musculus strain C57BL/6J cytokine gene cluste... 38 5.0
101gb|AF463761.1| Mus musculus strain C57BL/6J cytokine gene cluste... 38 5.0
102gb|AY183077.1| Trifolium repens clone A68 microsatellite sequence 38 5.0
103ref|XM_345858.2| PREDICTED: Rattus norvegicus similar to hypothe... 38 5.0
104ref|XM_575159.1| PREDICTED: Rattus norvegicus similar to fibrous... 38 5.0
105gb|U17838.1|HSU17838 Homo sapiens zinc finger protein RIZ mRNA, ... 38 5.0
106gb|AC069141.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 38 5.0
107gb|AY178352.1| Trifolium repens microsatellite agr1069 sequence 38 5.0
108emb|AL954683.11| Zebrafish DNA sequence from clone DKEY-49K10 in... 38 5.0
109dbj|AB039883.2| Dictyostelium discoideum gene for tyrosine phosp... 38 5.0
110dbj|AP003747.5| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
111dbj|AB159445.1| Bombyx mori DNA, chromosome 2, clone:544H24, com... 38 5.0
112emb|BX647310.1|HSM807454 Homo sapiens mRNA; cDNA DKFZp686D2193 (... 38 5.0
113dbj|AB026648.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 38 5.0
114dbj|AP004564.3| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
115dbj|AP004764.2| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
116dbj|AP004636.3| Oryza sativa (japonica cultivar-group) genomic D... 38 5.0
117emb|X17031.1|SONIR S. oleracera NIR gene for nitrite reductase (... 38 5.0
118emb|X97829.1|ATORF19 A.thaliana mRNA (orf19) from chromosome III 38 5.0
119dbj|AK106866.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 5.0
120gb|AC154794.2| Mus musculus BAC clone RP24-485J1 from 16, comple... 38 5.0
121gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10 38 5.0
122emb|BX248511.4| Zebrafish DNA sequence from clone CH211-243G18 i... 38 5.0
123gb|AY108134.1| Zea mays PCO140142 mRNA sequence 38 5.0
124emb|Z82266.2|CEF23B2 Caenorhabditis elegans Cosmid F23B2, comple... 38 5.0
125gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 ... 38 5.0
126gb|AE003433.3| Drosophila melanogaster chromosome X, section 17 ... 38 5.0
127gb|AC079134.24| Mus musculus chromosome 1, clone RP23-395H12, co... 38 5.0
128emb|CT025753.11| Mouse DNA sequence from clone RP24-340F12 on ch... 38 5.0
129emb|BX088721.5| Zebrafish DNA sequence from clone DKEY-14M2 in l... 38 5.0
130gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s... 38 5.0
131emb|AL845264.18| Mouse DNA sequence from clone RP23-116F18 on ch... 38 5.0
132gb|AC004708.1|AC004708 CIC5B11.1 check: 4870 from: 1 to: 1672... 38 5.0
133gb|BC109439.1| Danio rerio zgc:123296, mRNA (cDNA clone MGC:1232... 38 5.0
134gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, compl... 38 5.0
135gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10 38 5.0
136dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, comp... 38 5.0
137dbj|AP006708.1| Lotus japonicus genomic DNA, chromosome 3, clone... 38 5.0
138dbj|AP006668.1| Lotus japonicus genomic DNA, chromosome 6, clone... 38 5.0
139ref|NM_001037419.1| Danio rerio zgc:123296 (zgc:123296), mRNA 38 5.0
140gb|AC155172.4| Mus musculus BAC clone RP23-36N9 from chromosome ... 38 5.0
141gb|AC127522.7| Homo sapiens chromosome 15, clone RP13-126C7, com... 38 5.0
142dbj|D76440.1|MUSNCP Mouse gene for necdin, complete cds and prom... 38 5.0
143dbj|D45132.1|HUMHOXY1 Homo sapiens mRNA for zinc-finger DNA-bind... 38 5.0 
>gb|AC146340.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNAa0044A10, from chromosome 10, complete sequence
          Length = 173374

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 66     atgatgatgatgatgagttnttgag 90
              ||||||||||||||||||| |||||
Sbjct: 137251 atgatgatgatgatgagttcttgag 137275
to top
>gb|AC090487.3| Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0044I14, from Chromosome 10, complete sequence
          Length = 63167

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 66    atgatgatgatgatgagttnttgag 90
             ||||||||||||||||||| |||||
Sbjct: 39291 atgatgatgatgatgagttcttgag 39267
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 66       atgatgatgatgatgagttnttgag 90
                ||||||||||||||||||| |||||
Sbjct: 13291002 atgatgatgatgatgagttcttgag 13291026



 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 66       atgatgatgatgatgagtt 84
                |||||||||||||||||||
Sbjct: 17101362 atgatgatgatgatgagtt 17101344
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 44.1 bits (22), Expect = 0.081
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 66       atgatgatgatgatgagttnttgag 90
                ||||||||||||||||||| |||||
Sbjct: 13298342 atgatgatgatgatgagttcttgag 13298366



 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 66       atgatgatgatgatgagtt 84
                |||||||||||||||||||
Sbjct: 17110402 atgatgatgatgatgagtt 17110384
to top
>gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, complete sequence
          Length = 218156

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 35098 atgatgatgatgatgagtt 35080
to top
>ref|NM_120322.1| Arabidopsis thaliana unknown protein AT5G02440 mRNA, complete cds
          Length = 531

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 66 atgatgatgatgatgagtt 84
          |||||||||||||||||||
Sbjct: 93 atgatgatgatgatgagtt 75
to top
>ref|NM_113585.2| Arabidopsis thaliana unknown protein AT3G26740 mRNA, complete cds
          Length = 711

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 214 atgatgatgatgatgagtt 196
to top
>ref|NM_116248.2| Arabidopsis thaliana transcription regulator AT4G00270 mRNA,
           complete cds
          Length = 1307

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 750 atgatgatgatgatgagtt 768
to top
>ref|XM_633606.1| Dictyostelium discoideum hypothetical protein (DDB0185945), partial
           mRNA
          Length = 2988

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 679 atgatgatgatgatgagtt 661
to top
>ref|XM_640756.1| Dictyostelium discoideum hypothetical protein (DDB0190151), partial
           mRNA
          Length = 3708

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 394 atgatgatgatgatgagtt 376
to top
>ref|XM_638252.1| Dictyostelium discoideum putative GCN2 family kinase (DDB0216407),
            partial mRNA
          Length = 5103

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1730 atgatgatgatgatgagtt 1748
to top
>ref|XM_634942.1| Dictyostelium discoideum histidine kinase (DDB0220020), partial
           mRNA
          Length = 7167

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 939 atgatgatgatgatgagtt 921
to top
>ref|XM_634212.1| Dictyostelium discoideum putative GCN2 family kinase (DDB0220652),
            partial mRNA
          Length = 1914

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1102 atgatgatgatgatgagtt 1084
to top
>ref|XM_633905.1| Dictyostelium discoideum rhodanese-like domain-containing protein
            (DDB0191424), partial mRNA
          Length = 3162

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 2167 atgatgatgatgatgagtt 2149
to top
>ref|XM_482655.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2168

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 140 atgatgatgatgatgagtt 158
to top
>ref|NM_196978.1| Oryza sativa (japonica cultivar-group) putative
           aspartate-semialdehyde dehydrogenase (OSJNBa0001K12.14),
           mRNA
          Length = 984

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 883 atgatgatgatgatgagtt 901
to top
>gb|BT017669.1| Zea mays clone EL01N0442A09.c mRNA sequence
          Length = 1265

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1090 atgatgatgatgatgagtt 1072
to top
>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence
          Length = 1653225

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 671012 atgatgatgatgatgagtt 670994
to top
>gb|AC091330.18| Trypanosoma brucei chromosome 3 clone RPCI93-48O8, complete sequence
          Length = 138368

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 32146 atgatgatgatgatgagtt 32164
to top
>ref|NM_001007257.1| Homo sapiens PR domain containing 2, with ZNF domain (PRDM2),
           transcript variant 3, mRNA
          Length = 6207

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 444 atgatgatgatgatgagtt 462
to top
>ref|NM_012231.3| Homo sapiens PR domain containing 2, with ZNF domain (PRDM2),
            transcript variant 1, mRNA
          Length = 7958

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1704 atgatgatgatgatgagtt 1722
to top
>ref|NM_015866.3| Homo sapiens PR domain containing 2, with ZNF domain (PRDM2),
            transcript variant 2, mRNA
          Length = 7466

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1704 atgatgatgatgatgagtt 1722
to top
>gb|AY359966.1| Lycopersicon esculentum EIX receptor 2 (Eix2) gene, complete cds
          Length = 3325

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 2973 atgatgatgatgatgagtt 2991
to top
>ref|XM_717718.1| Candida albicans SC5314 hypothetical protein (CaO19_12063), mRNA
          Length = 678

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 242 atgatgatgatgatgagtt 260
to top
>ref|XM_717573.1| Candida albicans SC5314 hypothetical protein (CaO19_4594), mRNA
          Length = 678

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 242 atgatgatgatgatgagtt 260
to top
>ref|XM_707450.1| Candida albicans SC5314 putative kinteochore orientation-monitoring
           protein kinase Ipl1 (CaO19.10978), mRNA
          Length = 1593

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 331 atgatgatgatgatgagtt 313
to top
>ref|XM_707420.1| Candida albicans SC5314 putative kinteochore orientation-monitoring
           protein kinase Ipl1 (CaO19.3474), mRNA
          Length = 1593

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 331 atgatgatgatgatgagtt 313
to top
>ref|XM_708602.1| Candida albicans SC5314 hypothetical protein (CaO19.8647), mRNA
          Length = 1062

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 902 atgatgatgatgatgagtt 920
to top
>ref|XM_708601.1| Candida albicans SC5314 hypothetical protein (CaO19.8646), mRNA
          Length = 357

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 66 atgatgatgatgatgagtt 84
          |||||||||||||||||||
Sbjct: 74 atgatgatgatgatgagtt 56
to top
>ref|XM_708557.1| Candida albicans SC5314 hypothetical protein (CaO19.1045), mRNA
          Length = 1062

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 902 atgatgatgatgatgagtt 920
to top
>ref|XM_708556.1| Candida albicans SC5314 hypothetical protein (CaO19.1044), mRNA
          Length = 357

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 66 atgatgatgatgatgagtt 84
          |||||||||||||||||||
Sbjct: 74 atgatgatgatgatgagtt 56
to top
>ref|XM_707284.1| Candida albicans SC5314 hypothetical protein (CaO19.13553), mRNA
          Length = 2448

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 437 atgatgatgatgatgagtt 455
to top
>ref|XM_707248.1| Candida albicans SC5314 hypothetical protein (CaO19.6134), mRNA
          Length = 2454

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 443 atgatgatgatgatgagtt 461
to top
>ref|XM_453824.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D17270g predicted mRNA
          Length = 1530

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 902 atgatgatgatgatgagtt 920
to top
>gb|AY816032.1| Schistosoma japonicum SJCHGC02588 protein mRNA, complete cds
          Length = 599

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 138 atgatgatgatgatgagtt 120
to top
>gb|AY557702.1| Saccharomyces cerevisiae clone FLH001734.01X YDR153C gene, complete
           cds
          Length = 1236

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 974 atgatgatgatgatgagtt 992
to top
>gb|AC116979.3| Dictyostelium discoideum chromosome 2 map 6445720-6776760 strain AX4,
             complete sequence
          Length = 331039

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 37468 atgatgatgatgatgagtt 37486
to top
>gb|AC141425.3| Mus musculus BAC clone RP23-283P2 from chromosome 14, complete sequence
          Length = 174986

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 90643 atgatgatgatgatgagtt 90625
to top
>ref|XM_710157.1| Candida albicans SC5314 hypothetical protein (RER1) partial mRNA
          Length = 615

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 359 atgatgatgatgatgagtt 377
to top
>ref|XM_821527.1| Trypanosoma brucei TREU927 clone RPCI93-48O8 hypothetical protein
            (Tb927.3.2630) partial mRNA
          Length = 2349

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1541 atgatgatgatgatgagtt 1559
to top
>ref|XM_799664.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053503679.20) partial mRNA
          Length = 1722

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 425 atgatgatgatgatgagtt 443
to top
>gb|AC004097.1|HUAC004097 Human Chromosome 16 BAC clone CIT987SK-A-161G4, complete sequence
          Length = 87077

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 75438 atgatgatgatgatgagtt 75456
to top
>gb|AC126428.3| Mus musculus BAC clone RP24-387B13 from chromosome 10, complete sequence
          Length = 225663

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 152159 atgatgatgatgatgagtt 152177
to top
>ref|XM_883892.1| Candida albicans SC5314 hypothetical protein (CaJ7.0435) partial
           mRNA
          Length = 615

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 359 atgatgatgatgatgagtt 377
to top
>emb|CR391986.5| Zebrafish DNA sequence from clone CH211-195O20 in linkage group 17,
              complete sequence
          Length = 131805

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 124336 atgatgatgatgatgagtt 124318
to top
>ref|XM_721531.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06041)
            partial mRNA
          Length = 5310

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1712 atgatgatgatgatgagtt 1730
to top
>ref|XM_736261.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000725.03.0)
          partial mRNA
          Length = 1254

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 66 atgatgatgatgatgagtt 84
          |||||||||||||||||||
Sbjct: 68 atgatgatgatgatgagtt 86
to top
>gb|AC163007.4| Mus musculus chromosome 1, clone RP23-421G18, complete sequence
          Length = 195727

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1260 atgatgatgatgatgagtt 1278
to top
>gb|AC144517.7| Medicago truncatula clone mth2-13k17, complete sequence
          Length = 107710

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 102233 atgatgatgatgatgagtt 102215
to top
>gb|AC144722.11| Medicago truncatula clone mth2-26h11, complete sequence
          Length = 122089

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 10657 atgatgatgatgatgagtt 10675
to top
>gb|AC137996.33| Medicago truncatula clone mth2-19k16, complete sequence
          Length = 122085

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 10657 atgatgatgatgatgagtt 10675
to top
>ref|XM_784611.1| PREDICTED: Strongylocentrotus purpuratus similar to Geminin
           (LOC584760), mRNA
          Length = 3096

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 475 atgatgatgatgatgagtt 457
to top
>emb|AL049553.20|HSJ402N21 Human DNA sequence from clone RP3-402N21 on chromosome 6p21.1-21.31
             Contains the MDGA1 gene for MAM domain containing
             glycosylphosphatidylinositol anchor 1, the gene for a
             novel protein and four CpG islands, complete sequence
          Length = 170302

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 50918 atgatgatgatgatgagtt 50936
to top
>emb|AL035106.28|HS998C11 Human DNA sequence from clone RP5-998C11 on chromosome 20q13.13-13.2
             Contains part of the gene for P-Rex1 protein (KIAA1415,
             PREX1), complete sequence
          Length = 131007

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 96141 atgatgatgatgatgagtt 96159
to top
>emb|AL031277.1|HS1177E19 Human DNA sequence from clone RP5-1177E19 on chromosome 1p36.12-36.31
             Contains the 3' end of the PRDM2 gene for PR domain
             containing 2 with ZNF domain, a novel gene and a CpG
             island, complete sequence
          Length = 151188

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 91665 atgatgatgatgatgagtt 91647
to top
>gb|AY237156.1| Homo sapiens ABPA2 gene, intron 3 and repeat region
          Length = 1250

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1014 atgatgatgatgatgagtt 1032
to top
>emb|Z50046.1|SC8358 S.cerevisiae chromosome IV cosmid 8358
          Length = 43468

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 21485 atgatgatgatgatgagtt 21467
to top
>emb|X98130.1|AT81KBGEN Arabidopsis thaliana 81kb genomic sequence
          Length = 81493

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 80201 atgatgatgatgatgagtt 80183
to top
>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 66      atgatgatgatgatgagtt 84
               |||||||||||||||||||
Sbjct: 1465482 atgatgatgatgatgagtt 1465464
to top
>emb|AL939116.1|SCO939116 Streptomyces coelicolor A3(2) complete genome; segment 13/29
          Length = 293050

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 222120 atgatgatgatgatgagtt 222102
to top
>emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chromosome 5, segment 2/4
          Length = 313050

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 247598 atgatgatgatgatgagtt 247580
to top
>emb|AL645862.14| Mouse DNA sequence from clone RP23-223A11 on chromosome 11, complete
              sequence
          Length = 176011

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 132518 atgatgatgatgatgagtt 132536



 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 107506 atgatgatgatgatgagtt 107488
to top
>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project)
          Length = 96424

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 12200 atgatgatgatgatgagtt 12182
to top
>emb|AL162874.1|ATT1E22 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E22 (ESSA project)
          Length = 96575

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 80219 atgatgatgatgatgagtt 80201
to top
>emb|AL161579.2|ATCHRIV75 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 75
          Length = 196242

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 158950 atgatgatgatgatgagtt 158932
to top
>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1
          Length = 197119

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 116709 atgatgatgatgatgagtt 116691
to top
>emb|AL049607.1|ATF11C18 Arabidopsis thaliana DNA chromosome 4, BAC clone F11C18 (ESSA project)
          Length = 111517

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 19611 atgatgatgatgatgagtt 19593
to top
>gb|AC023712.5| Drosophila melanogaster X BAC RP98-1M22 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170129

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 38852 atgatgatgatgatgagtt 38870
to top
>gb|AC023692.5| Drosophila melanogaster X BAC RP98-15B10 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 163090

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 12097 atgatgatgatgatgagtt 12079
to top
>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence
          Length = 117437

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 66   atgatgatgatgatgagttnttgagg 91
            ||||||||||||||| ||| ||||||
Sbjct: 4446 atgatgatgatgatgggtttttgagg 4471
to top
>gb|AC107029.4| Homo sapiens 3 BAC RP11-550H20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 182634

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 67     tgatgatgatgatgagttnttg 88
              |||||||||||||||||| |||
Sbjct: 161877 tgatgatgatgatgagttcttg 161898
to top
>gb|AC116350.2| Homo sapiens chromosome 5 clone RP11-357F12, complete sequence
          Length = 183009

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 35614 atgatgatgatgatgagtt 35632
to top
>dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111
          Length = 2356219

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 845485 atgatgatgatgatgagtt 845503
to top
>gb|AC006284.4| Arabidopsis thaliana chromosome 2 clone T4M8 map CIC11A04, complete
             sequence
          Length = 89137

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 65619 atgatgatgatgatgagtt 65601
to top
>dbj|AB108394.1| Phleum pratense DNA, SSR, microsatellite D01-F06
          Length = 528

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 370 atgatgatgatgatgagtt 352
to top
>gb|AC024474.8| Homo sapiens chromosome 15, clone RP11-686I6, complete sequence
          Length = 194973

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 70122 atgatgatgatgatgagtt 70104
to top
>gb|AC055723.22| Homo sapiens 3 BAC RP11-201E8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 166787

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 67    tgatgatgatgatgagttnttg 88
             |||||||||||||||||| |||
Sbjct: 13864 tgatgatgatgatgagttcttg 13885
to top
>gb|AF098987.1| Caenorhabditis elegans cosmid F40H3, complete sequence
          Length = 24810

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 12283 atgatgatgatgatgagtt 12265
to top
>gb|AF361590.1| Arabidopsis thaliana AT4g00270/A_IG005I10_11 mRNA, complete cds
          Length = 1302

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 750 atgatgatgatgatgagtt 768
to top
>gb|AF375445.1| Arabidopsis thaliana AT3g26740/MLJ15_14 mRNA, complete cds
          Length = 713

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 214 atgatgatgatgatgagtt 196
to top
>gb|AY074837.1| Arabidopsis thaliana AT4g00270/A_IG005I10_11 mRNA, complete cds
          Length = 909

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 677 atgatgatgatgatgagtt 695
to top
>gb|AC099514.2| Homo sapiens chromosome 5 clone RP11-454E7, complete sequence
          Length = 181674

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 171753 atgatgatgatgatgagtt 171771
to top
>gb|AY060542.1| Arabidopsis thaliana AT3g26740/MLJ15_14 mRNA, complete cds
          Length = 426

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 148 atgatgatgatgatgagtt 130
to top
>gb|AC078948.11| Oryza sativa chromosome 10 BAC OSJNBa0001K12 genomic sequence, complete
             sequence
          Length = 144724

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 90974 atgatgatgatgatgagtt 90992
to top
>gb|AF424610.1|AF424610 Arabidopsis thaliana AT3g26740/MLJ15_14 mRNA, complete cds
          Length = 595

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 201 atgatgatgatgatgagtt 183
to top
>gb|AF410315.1|AF410315 Arabidopsis thaliana AT3g26740/MLJ15_14 mRNA, complete cds
          Length = 607

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 215 atgatgatgatgatgagtt 197
to top
>gb|AC060788.11| Homo sapiens chromosome 8, clone CTD-2008O4, complete sequence
          Length = 177717

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 74154 atgatgatgatgatgagtt 74172
to top
>ref|NM_062832.1| Caenorhabditis elegans F40H3.1 (F40H3.1) mRNA, complete cds
          Length = 1491

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 66 atgatgatgatgatgagtt 84
          |||||||||||||||||||
Sbjct: 33 atgatgatgatgatgagtt 15
to top
>ref|NM_171411.2| Caenorhabditis elegans Temporarily Assigned Gene name family member
            (tag-60) (tag-60) mRNA, complete cds
          Length = 1923

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1725 atgatgatgatgatgagtt 1707
to top
>ref|NM_171410.3| Caenorhabditis elegans Temporarily Assigned Gene name family member
            (tag-60) (tag-60) mRNA, complete cds
          Length = 1855

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1208 atgatgatgatgatgagtt 1190
to top
>gb|AC008002.3|AC008002 Drosophila melanogaster, chromosome 2L, region 21D-21E, BAC clone
              BACR48E08, complete sequence
          Length = 182726

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 128527 atgatgatgatgatgagtt 128509
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 66       atgatgatgatgatgagtt 84
                |||||||||||||||||||
Sbjct: 21693155 atgatgatgatgatgagtt 21693173



 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 66       atgatgatgatgatgagtt 84
                |||||||||||||||||||
Sbjct: 19336875 atgatgatgatgatgagtt 19336893
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 66       atgatgatgatgatgagtt 84
                |||||||||||||||||||
Sbjct: 23581161 atgatgatgatgatgagtt 23581143
to top
>emb|BX821643.1|CNS0A8EF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZD05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1058

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 935 atgatgatgatgatgagtt 953
to top
>emb|BX823670.1|CNS0A7KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS64ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 564

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 195 atgatgatgatgatgagtt 177
to top
>emb|BX823778.1|CNS0A5CC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZG06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 589

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 196 atgatgatgatgatgagtt 178
to top
>emb|BX842202.1|CNS09YD3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL4ZF12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 665

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 182 atgatgatgatgatgagtt 164
to top
>gb|AF247465.1|AF247465 Coptotermes formosanus clone Cf4-10 microsatellite sequence
          Length = 439

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 146 atgatgatgatgatgagtt 128
to top
>gb|AF247464.1|AF247464 Coptotermes formosanus clone Cf4-9A microsatellite sequence
          Length = 430

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 145 atgatgatgatgatgagtt 127
to top
>gb|AF463766.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence
          Length = 28254

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 15216 atgatgatgatgatgagtt 15234
to top
>gb|AF463761.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence
          Length = 17237

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 10073 atgatgatgatgatgagtt 10091
to top
>gb|AY183077.1| Trifolium repens clone A68 microsatellite sequence
          Length = 556

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 469 atgatgatgatgatgagtt 451
to top
>ref|XM_345858.2| PREDICTED: Rattus norvegicus similar to hypothetical protein FLJ25421
            (LOC366961), mRNA
          Length = 4557

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1076 atgatgatgatgatgagtt 1094
to top
>ref|XM_575159.1| PREDICTED: Rattus norvegicus similar to fibrous sheath-interacting
             protein 2 (LOC499820), mRNA
          Length = 19912

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 15530 atgatgatgatgatgagtt 15548
to top
>gb|U17838.1|HSU17838 Homo sapiens zinc finger protein RIZ mRNA, complete cds
          Length = 7942

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1703 atgatgatgatgatgagtt 1721
to top
>gb|AC069141.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-23G24, complete
             sequence
          Length = 197264

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 35796 atgatgatgatgatgagtt 35778
to top
>gb|AY178352.1| Trifolium repens microsatellite agr1069 sequence
          Length = 644

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 603 atgatgatgatgatgagtt 621
to top
>emb|AL954683.11| Zebrafish DNA sequence from clone DKEY-49K10 in linkage group 1,
            complete sequence
          Length = 126845

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 6044 atgatgatgatgatgagtt 6062
to top
>dbj|AB039883.2| Dictyostelium discoideum gene for tyrosine phosphatase CDC25,
            complete cds
          Length = 2961

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1966 atgatgatgatgatgagtt 1948
to top
>dbj|AP003747.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1127_E01
          Length = 123787

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 33602 atgatgatgatgatgagtt 33584
to top
>dbj|AB159445.1| Bombyx mori DNA, chromosome 2, clone:544H24, complete sequence
          Length = 205107

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 123157 atgatgatgatgatgagtt 123139
to top
>emb|BX647310.1|HSM807454 Homo sapiens mRNA; cDNA DKFZp686D2193 (from clone DKFZp686D2193)
          Length = 5817

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 467 atgatgatgatgatgagtt 485
to top
>dbj|AB026648.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLJ15
          Length = 43481

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 37963 atgatgatgatgatgagtt 37945
to top
>dbj|AP004564.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0479C12
          Length = 136799

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 60725 atgatgatgatgatgagtt 60743
to top
>dbj|AP004764.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0708B04
          Length = 170523

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 153329 atgatgatgatgatgagtt 153347
to top
>dbj|AP004636.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0685B10
          Length = 148544

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 66318 atgatgatgatgatgagtt 66336
to top
>emb|X17031.1|SONIR S. oleracera NIR gene for nitrite reductase (EC=1.7.7.1)
          Length = 4234

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1251 atgatgatgatgatgagtt 1233
to top
>emb|X97829.1|ATORF19 A.thaliana mRNA (orf19) from chromosome III
          Length = 570

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 199 atgatgatgatgatgagtt 181
to top
>dbj|AK106866.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-118-C12, full
           insert sequence
          Length = 2168

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 140 atgatgatgatgatgagtt 158
to top
>gb|AC154794.2| Mus musculus BAC clone RP24-485J1 from 16, complete sequence
          Length = 179257

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 72669 atgatgatgatgatgagtt 72687
to top
>gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10
          Length = 111906

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 17228 atgatgatgatgatgagtt 17210
to top
>emb|BX248511.4| Zebrafish DNA sequence from clone CH211-243G18 in linkage group 10,
             complete sequence
          Length = 176986

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 76265 atgatgatgatgatgagtt 76247
to top
>gb|AY108134.1| Zea mays PCO140142 mRNA sequence
          Length = 1068

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 881 atgatgatgatgatgagtt 863
to top
>emb|Z82266.2|CEF23B2 Caenorhabditis elegans Cosmid F23B2, complete sequence
          Length = 38914

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 3208 atgatgatgatgatgagtt 3190
to top
>gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 of 83 of the complete
              sequence
          Length = 306076

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 222940 atgatgatgatgatgagtt 222958
to top
>gb|AE003433.3| Drosophila melanogaster chromosome X, section 17 of 74 of the complete
              sequence
          Length = 303602

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 199553 atgatgatgatgatgagtt 199571
to top
>gb|AC079134.24| Mus musculus chromosome 1, clone RP23-395H12, complete sequence
          Length = 204915

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 175071 atgatgatgatgatgagtt 175089
to top
>emb|CT025753.11| Mouse DNA sequence from clone RP24-340F12 on chromosome 16, complete
              sequence
          Length = 231697

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 225365 atgatgatgatgatgagtt 225347
to top
>emb|BX088721.5| Zebrafish DNA sequence from clone DKEY-14M2 in linkage group 14, complete
              sequence
          Length = 231054

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 102309 atgatgatgatgatgagtt 102327
to top
>gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s DS00764 (D273) and DS00501
             (D274)), complete sequence
          Length = 104278

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 92309 atgatgatgatgatgagtt 92327
to top
>emb|AL845264.18| Mouse DNA sequence from clone RP23-116F18 on chromosome 2, complete
             sequence
          Length = 207724

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 70467 atgatgatgatgatgagtt 70485
to top
>gb|AC004708.1|AC004708 CIC5B11.1  check: 4870  from: 1  to: 167234, complete sequence
          Length = 167234

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 142121 atgatgatgatgatgagtt 142103
to top
>gb|BC109439.1| Danio rerio zgc:123296, mRNA (cDNA clone MGC:123296 IMAGE:7902567),
            complete cds
          Length = 1807

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1012 atgatgatgatgatgagtt 994
to top
>gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, complete sequence
          Length = 209693

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 148618 atgatgatgatgatgagtt 148636
to top
>gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10
          Length = 111906

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 94679 atgatgatgatgatgagtt 94697
to top
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence
          Length = 949626

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 66     atgatgatgatgatgagtt 84
              |||||||||||||||||||
Sbjct: 842732 atgatgatgatgatgagtt 842750
to top
>dbj|AP006708.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590c,
             complete sequence
          Length = 79353

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 53218 atgatgatgatgatgagtt 53236
to top
>dbj|AP006668.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT16B20, TM0367,
             complete sequence
          Length = 112717

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 69766 atgatgatgatgatgagtt 69748
to top
>ref|NM_001037419.1| Danio rerio zgc:123296 (zgc:123296), mRNA
          Length = 1807

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   atgatgatgatgatgagtt 84
            |||||||||||||||||||
Sbjct: 1012 atgatgatgatgatgagtt 994
to top
>gb|AC155172.4| Mus musculus BAC clone RP23-36N9 from chromosome 14, complete sequence
          Length = 255753

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 65954 atgatgatgatgatgagtt 65972
to top
>gb|AC127522.7| Homo sapiens chromosome 15, clone RP13-126C7, complete sequence
          Length = 166914

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    atgatgatgatgatgagtt 84
             |||||||||||||||||||
Sbjct: 20440 atgatgatgatgatgagtt 20422
to top
>dbj|D76440.1|MUSNCP Mouse gene for necdin, complete cds and promoter sequence
          Length = 3899

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 453 atgatgatgatgatgagtt 435
to top
>dbj|D45132.1|HUMHOXY1 Homo sapiens mRNA for zinc-finger DNA-binding protein, complete cds
          Length = 6188

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 66  atgatgatgatgatgagtt 84
           |||||||||||||||||||
Sbjct: 422 atgatgatgatgatgagtt 440


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 663,059
Number of Sequences: 3902068
Number of extensions: 663059
Number of successful extensions: 225443
Number of sequences better than 10.0: 143
Number of HSP's better than 10.0 without gapping: 146
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 223865
Number of HSP's gapped (non-prelim): 1278
length of query: 110
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 89
effective length of database: 17,151,101,840
effective search space: 1526448063760
effective search space used: 1526448063760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top