>emb|X74545.1|TAATP2 T.aestivum atp-2 mRNA for ATP synthase beta subunit
          Length = 1891

 Score = 63.9 bits (32), Expect = 4e-08
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 9    ttaacttgtncagggtggtggtaacacctcgtnatcaagcattctccttggcgatctt 66
            ||||||||| ||| | |||||||||||||||| |||| ||||||||  ||||||||||
Sbjct: 1710 ttaacttgtacagagcggtggtaacacctcgtcatcaggcattctcgctggcgatctt 1653

>ref|XM_801267.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053511297.10) partial mRNA
          Length = 6591

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 45   aagcattctccttggcgat 63
            |||||||||||||||||||
Sbjct: 5594 aagcattctccttggcgat 5576

>ref|XM_806101.1| Trypanosoma cruzi strain CL Brener hypothetical protein
          (Tc00.1047053511365.100) partial mRNA
          Length = 1024

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 45 aagcattctccttggcgat 63
          |||||||||||||||||||
Sbjct: 27 aagcattctccttggcgat 9

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
               sequence
          Length = 2105742

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                    
Query: 15      tgtncagggtggtggtaacac 35
               ||| |||||||||||||||||
Sbjct: 1514415 tgtccagggtggtggtaacac 1514395

>ref|XM_569797.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNC05030) partial mRNA
          Length = 1275

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 15  tgtncagggtggtggtaacac 35
           ||| |||||||||||||||||
Sbjct: 456 tgtccagggtggtggtaacac 476

>gb|AC091189.4| Homo sapiens chromosome 8, clone RP11-606D13, complete sequence
          Length = 174458

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    cagggtggtggtaacacc 36
             ||||||||||||||||||
Sbjct: 21721 cagggtggtggtaacacc 21704

>ref|XM_687081.1| PREDICTED: Danio rerio similar to Adenylate cyclase, type II (ATP
            pyrophosphate-lyase 2) (Adenylyl cyclase 2) (LOC563724),
            mRNA
          Length = 2499

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 48   cattctccttggcgatct 65
            ||||||||||||||||||
Sbjct: 1612 cattctccttggcgatct 1595

>gb|AC174765.1| Gasterosteus aculeatus clone VMRC28-42K03, complete sequence
          Length = 143816

 Score = 36.2 bits (18), Expect = 9.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     ggtggtggtaacacctcg 39
              ||||||||||||||||||
Sbjct: 129901 ggtggtggtaacacctcg 129918


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 234,297
Number of Sequences: 3902068
Number of extensions: 234297
Number of successful extensions: 13380
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13370
Number of HSP's gapped (non-prelim): 10
length of query: 66
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 45
effective length of database: 17,151,101,840
effective search space: 771799582800
effective search space used: 771799582800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)