ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags7b22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carbox... 133 7e-29
2gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carbox... 133 7e-29
3gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-... 133 7e-29
4gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxyl... 133 7e-29
5gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate car... 133 7e-29
6gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate c... 133 7e-29
7gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-b... 133 7e-29
8gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate c... 133 7e-29
9gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carbox... 133 7e-29
10gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate car... 133 7e-29
11gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxyla... 133 7e-29
12gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxy... 133 7e-29
13gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxyl... 133 7e-29
14gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo... 133 7e-29
15gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carbo... 133 7e-29
16gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carbo... 133 7e-29
17gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate c... 133 7e-29
18gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate ca... 133 7e-29
19emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL ge... 133 7e-29
20emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene fo... 133 7e-29
21emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL ge... 133 7e-29
22emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gen... 133 7e-29
23emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL g... 133 7e-29
24gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carbo... 133 7e-29
25emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribul... 133 7e-29
26emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribul... 133 7e-29
27emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for rib... 133 7e-29
28emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribul... 133 7e-29
29emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for rib... 133 7e-29
30emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ... 133 7e-29
31emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for r... 133 7e-29
32emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for r... 133 7e-29
33emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ... 133 7e-29
34emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF... 133 7e-29
35emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, O... 133 7e-29
36emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB 133 7e-29
37gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bispho... 133 7e-29
38gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose... 133 7e-29
39gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose... 133 7e-29
40gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate car... 133 7e-29
41gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carb... 133 7e-29
42gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-... 133 7e-29
43gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisph... 133 7e-29
44gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carbox... 133 7e-29
45gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carbox... 133 7e-29
46gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi... 133 7e-29
47gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carbox... 133 7e-29
48gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulo... 133 7e-29
49gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate car... 133 7e-29
50gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carbox... 133 7e-29
51gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate ca... 133 7e-29
52gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose... 133 7e-29
53gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,... 133 7e-29
54gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1... 133 7e-29
55gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carb... 133 7e-29
56gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carbo... 133 7e-29
57gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxy... 133 7e-29
58gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca... 133 7e-29
59gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carbo... 133 7e-29
60gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxy... 133 7e-29
61gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph... 133 7e-29
62gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisph... 133 7e-29
63gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-... 133 7e-29
64gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b... 133 7e-29
65gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
66gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
67gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
68gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
69gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
70gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
71gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
72gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
73gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
74gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
75gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 133 7e-29
76gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H... 133 7e-29
77gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H... 133 7e-29
78gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H... 133 7e-29
79gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H... 133 7e-29
80gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H... 133 7e-29
81gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H... 133 7e-29
82emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ... 133 7e-29
83emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene fo... 133 7e-29
84emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partia... 133 7e-29
85emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene ... 133 7e-29
86emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene ... 133 7e-29
87emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene ... 133 7e-29
88emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for... 133 7e-29
89emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL ... 133 7e-29
90emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gen... 133 7e-29
91emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene ... 133 7e-29
92gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxy... 133 7e-29
93gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5... 133 7e-29
94gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris vouche... 133 7e-29
95gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose... 133 7e-29
96gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher ... 133 7e-29
97gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher ... 133 7e-29
98gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis vouc... 133 7e-29
99gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H880... 133 7e-29
100gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H880... 133 7e-29
101gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H880... 133 7e-29
102gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5... 133 7e-29
103gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carbo... 133 7e-29
104gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate... 133 7e-29
105gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosph... 133 7e-29
106gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate car... 133 7e-29
107gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate... 133 7e-29
108gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxy... 133 7e-29
109gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bispho... 133 7e-29
110gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose... 133 7e-29
111gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose... 133 7e-29
112gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate ca... 133 7e-29
113gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate car... 133 7e-29
114gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carbo... 133 7e-29
115gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate ca... 133 7e-29
116gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi... 133 7e-29
117gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph... 133 7e-29
118gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b... 133 7e-29
119gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca... 133 7e-29
120gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulo... 133 7e-29
121gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphat... 133 7e-29
122gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carbo... 133 7e-29
123gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate ... 133 7e-29
124gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate ca... 133 7e-29
125gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carb... 133 7e-29
126gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carbo... 133 7e-29
127gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate car... 133 7e-29
128gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxy... 133 7e-29
129gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate... 133 7e-29
130gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosph... 133 7e-29
131gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphat... 133 7e-29
132gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate car... 133 7e-29
133gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate car... 133 7e-29
134gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxy... 133 7e-29
135gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxy... 133 7e-29
136dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome 133 7e-29
137emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene fo... 133 7e-29
138emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribu... 133 7e-29
139dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ri... 133 7e-29
140gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate car... 127 5e-27
141gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica vou... 127 5e-27
142gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5... 127 5e-27
143gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate ca... 125 2e-26
144gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate c... 125 2e-26
145gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carbox... 125 2e-26
146gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate car... 125 2e-26
147gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate ca... 125 2e-26
148gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate c... 125 2e-26
149gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate car... 125 2e-26
150emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL... 125 2e-26
151emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene... 125 2e-26
152emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL ge... 125 2e-26
153emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ri... 125 2e-26
154emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for... 125 2e-26
155emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL... 125 2e-26
156emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ri... 125 2e-26
157emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbc... 125 2e-26
158gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate ca... 125 2e-26
159gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphat... 125 2e-26
160gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphospha... 125 2e-26
161gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydroge... 125 2e-26
162gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphospha... 125 2e-26
163emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribul... 119 1e-24
164gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carbo... 117 4e-24
165gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carbox... 117 4e-24
166gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carbox... 117 4e-24
167gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxyl... 117 4e-24
168gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carbox... 117 4e-24
169gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosp... 117 4e-24
170ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative... 117 4e-24
171gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carbo... 117 4e-24
172gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate ca... 117 4e-24
173gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate car... 117 4e-24
174gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate ca... 117 4e-24
175gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate car... 117 4e-24
176gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar N... 117 4e-24
177gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA... 117 4e-24
178gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-1... 117 4e-24
179gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carb... 117 4e-24
180emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene fo... 117 4e-24
181emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL g... 117 4e-24
182emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene fo... 117 4e-24
183emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gen... 117 4e-24
184emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL ... 117 4e-24
185emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gen... 117 4e-24
186gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1... 117 4e-24
187gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA... 117 4e-24
188gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N... 117 4e-24
189emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for... 117 4e-24
190emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene... 117 4e-24
191emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chlor... 117 4e-24
192emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for... 117 4e-24
193emb|AJ746299.1| Phragmites australis chloroplast partial rbcL ge... 117 4e-24
194emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for r... 117 4e-24
195emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene f... 117 4e-24
196emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene fo... 117 4e-24
197emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL ... 117 4e-24
198emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL... 117 4e-24
199emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for r... 117 4e-24
200emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL g... 117 4e-24
201emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gen... 117 4e-24
202emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene f... 117 4e-24
203emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for r... 117 4e-24
204emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene... 117 4e-24
205emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL g... 117 4e-24
206emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene fo... 117 4e-24
207emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL g... 117 4e-24
208emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for... 117 4e-24
209gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxyl... 117 4e-24
210gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome... 117 4e-24
211gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast,... 117 4e-24
212gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxyl... 117 4e-24
213gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate ... 117 4e-24
214gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar N... 117 4e-24
215gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bispho... 117 4e-24
216gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carb... 117 4e-24
217gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosph... 117 4e-24
218gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carb... 117 4e-24
219dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
220dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
221dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
222dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
223gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate c... 117 4e-24
224gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate car... 117 4e-24
225gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate... 117 4e-24
226gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxy... 117 4e-24
227gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carbo... 117 4e-24
228gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-... 117 4e-24
229dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
230dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
231dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-24
232dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-24
233dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-24
234dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 4e-24
235gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 117 4e-24
236gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 117 4e-24
237emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa... 117 4e-24
238dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete ... 117 4e-24
239dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome 117 4e-24
240gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosph... 117 4e-24
241gb|M91626.1|BAMCPRBCL Bamboo chloroplast ribulosebisphosphate (r... 117 4e-24
242gb|U31381.1|TBU31381 Tristachya biseriata ribulose-1,5-bisphosph... 117 4e-24
243gb|U31442.1|SDU31442 Stipa dregeana var. dregeana ribulose-1,5-b... 117 4e-24
244gb|U31438.1|MMU31438 Merxmuellera macowanii ribulose-1,5-bisphos... 117 4e-24
245gb|U31439.1|MJU31439 Moliniopsis japonica ribulose-1,5-bisphosph... 117 4e-24
246gb|U31105.1|GSU31105 Gynerium sagittatum ribulose-1,5-bisphospha... 117 4e-24
247gb|U31101.1|CLU31101 Chasmanthium latifolium ribulose-1,5-bispho... 117 4e-24
248gb|U31100.1|CGU31100 Centropodia glauca ribulose-1,5-bisphosphat... 117 4e-24
249emb|X04789.1|CHOSRBCL Rice chloroplast DNA for ribulose-1,5-biph... 117 4e-24
250gb|U13231.1|LHU13231 Lithachne humilis chloroplast ribulose-1,5-... 117 4e-24
251gb|L14623.1|PENCARBOXL Pennisetum glaucum ribulosebiphosphate ca... 117 4e-24
252gb|L14622.1|CEHRBCL Cenchrus setigerus chloroplast ribulose 1,5-... 117 4e-24
253dbj|D00207.1|RICCPRBCL Oryza sativa chloroplast gene for ribulos... 117 4e-24
254gb|AY601672.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo... 115 2e-23
255emb|AJ746255.1| Aira praecox chloroplast partial rbcL gene for r... 113 7e-23
256gb|AY618660.1| Arundinaria gigantea ribulose 1,5-bisphosphate ca... 113 7e-23
257gb|AY632375.1| Zoysia sp. JID-2004 ribulose-1,5-bisphosphate car... 109 1e-21
258gb|AY632373.1| Uniola paniculata ribulose-1,5-bisphosphate carbo... 109 1e-21
259gb|AY632369.1| Pariana radiciflora ribulose-1,5-bisphosphate car... 109 1e-21
260gb|AY632366.1| Micraira subulifolia ribulose-1,5-bisphosphate ca... 109 1e-21
261gb|AY632363.1| Distichlis spicata ribulose-1,5-bisphosphate carb... 109 1e-21
262gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome 109 1e-21
263gb|AY626351.1| Eriachne triseta ribulose 1,5-bisphosphate carbox... 109 1e-21
264gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit... 109 1e-21
265emb|AJ784836.1| Muhlenbergia racemosa chloroplast partial rbcL g... 109 1e-21
266emb|AJ784829.1| Bouteloua gracilis chloroplast partial rbcL gene... 109 1e-21
267emb|AJ784822.1| Festuca rubra subsp. juncea chloroplast partial ... 109 1e-21
268emb|Z11973.1|CHZMRBCLG Z.mays chloroplast rbcL gene for ribulose... 109 1e-21
269emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome 109 1e-21
270emb|V00171.1|CHZM02 Zea mays chloroplast gene for the large subu... 109 1e-21
271emb|AJ746288.1| Cyperochloa hirsuta chloroplast partial rbcL gen... 109 1e-21
272emb|AJ746283.1| Aristida congesta subsp. barbicollis chloroplast... 109 1e-21
273emb|AJ746280.1| Agrostis stolonifera chloroplast partial rbcL ge... 109 1e-21
274emb|AJ746278.1| Sasa palmata chloroplast partial rbcL gene for r... 109 1e-21
275emb|AJ746277.1| Yushania maling chloroplast partial rbcL gene fo... 109 1e-21
276emb|AJ746274.1| Phragmites sp. TH-203 chloroplast partial rbcL g... 109 1e-21
277emb|AJ746273.1| Pseudosasa amabilis chloroplast partial rbcL gen... 109 1e-21
278emb|AJ746272.1| Phyllostachys nigra chloroplast partial rbcL gen... 109 1e-21
279emb|AJ746270.1| Oligostachyum oedogonatum chloroplast partial rb... 109 1e-21
280emb|AJ746267.1| Hibanobambusa tranquillans chloroplast partial r... 109 1e-21
281emb|AJ746266.1| Fargesia dracocephala chloroplast partial rbcL g... 109 1e-21
282emb|AJ746265.1| Drepanostachyum falcatum chloroplast partial rbc... 109 1e-21
283emb|AJ746261.1| Festuca rubra chloroplast partial rbcL gene for ... 109 1e-21
284emb|AJ746259.1| Brachystachyum densiflorum chloroplast partial r... 109 1e-21
285emb|AJ746179.1| Arundinaria tecta chloroplast partial rbcL gene ... 109 1e-21
286gb|AF352580.1| Eriachne triodioides ribulose-1,5-bisphosphate ca... 109 1e-21
287emb|AJ746178.1| Arundinaria oedogonata chloroplast partial rbcL ... 109 1e-21
288emb|AJ746177.1| Indocalamus latifolius chloroplast partial rbcL ... 109 1e-21
289emb|AJ746176.1| Chimonobambusa marmorea chloroplast partial rbcL... 109 1e-21
290gb|AY167975.1| Zea mays ribulose-1,5-bisphosphate carboxylase/ox... 109 1e-21
291gb|U88404.1|CHU88404 Cyperochloa hirsuta ribulose-1,5-bisphospha... 109 1e-21
292gb|U31359.1|ACU31359 Aristida congesta subsp. barbicollis ribulo... 109 1e-21
293gb|AY622898.1| Piptatherum miliaceum ribulose-1,5-bisphosphate c... 109 1e-21
294gb|AY622896.1| Nassella viridula ribulose-1,5-bisphosphate carbo... 109 1e-21
295gb|AY622892.1| Eremitis sp. MRD-2004 ribulose-1,5-bisphosphate c... 109 1e-21
296gb|AY622888.1| Brachyelytrum erectum ribulose-1,5-bisphosphate c... 109 1e-21
297gb|AY928077.1| Zea mays cultivar B73 chloroplast, complete genome 109 1e-21
298dbj|AB088833.1| Phyllostachys bambusoides chloroplast rbcL gene ... 109 1e-21
299gb|L05043.2|ZIZCPRBCL Zizania texana ribulose 1,5-bisphosphate c... 109 1e-21
300emb|AM110249.1| Fargesia sp. Asmussen 105 plastid partial rbcL g... 109 1e-21
301gb|U31378.1|SZU31378 Stipagrostis zeyheri subsp. zeyheri ribulos... 109 1e-21
302gb|U31379.1|MPU31379 Monachather paradoxus ribulose-1,5-bisphosp... 109 1e-21
303gb|U31436.1|HHU31436 Hyparrhenia hirta ribulose-1,5-bisphosphate... 109 1e-21
304gb|U31104.1|ECU31104 Eragrostis capensis ribulose-1,5-bisphospha... 109 1e-21
305emb|X79900.1|SILCRBCL S.italica L. chloroplast rbcL gene 109 1e-21
306gb|U13230.1|PBU13230 Phyllostachys bambusoides chloroplast ribul... 109 1e-21
307dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond... 109 1e-21
308gb|AY137446.1| Hordeum patagonicum subsp. mustersii ribulose-1,5... 107 4e-21
309gb|AY691638.1| Pyrrhanthera exigua ribulose-1,5-bisphosphate car... 101 3e-19
310gb|DQ005609.1| Cortaderia selloana ribulose-1,5-bisphosphate car... 101 3e-19
311gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion... 101 3e-19
312emb|AJ784830.1| Cortaderia richardii chloroplast partial rbcL ge... 101 3e-19
313emb|AJ784819.1| Arthraxon sp. mvdb-G3 chloroplast partial rbcL g... 101 3e-19
314emb|AJ746260.1| Cortaderia sp. TH-158 chloroplast partial rbcL g... 101 3e-19
315emb|AJ746254.1| Arthrostylidium sp. TH-53B chloroplast partial r... 101 3e-19
316emb|AJ746253.1| Arthraxon sp. TH-111 chloroplast partial rbcL ge... 101 3e-19
317gb|U31441.1|RNU31441 Rytidosperma nudiflorum ribulose-1,5-bispho... 101 3e-19
318gb|U31440.1|PPU31440 Plinthanthesis paradoxa ribulose-1,5-bispho... 101 3e-19
319gb|U31437.1|KPU31437 Karroochloa purpurea ribulose-1,5-bisphosph... 101 3e-19
320gb|U31103.1|ESU31103 Enneapogon scaber ribulose-1,5-bisphosphate... 101 3e-19
321gb|U31102.1|DSU31102 Danthonia spicata ribulose-1,5-bisphosphate... 101 3e-19
322gb|U13227.1|CCU13227 Chusquea circinata chloroplast ribulose-1,5... 101 3e-19
323gb|AY632372.1| Streptochaeta sodiroana ribulose-1,5-bisphosphate... 96 2e-17
324gb|AY357724.1| Pharus latifolius ribulose-1,5-bisphosphate carbo... 96 2e-17
325emb|AJ419950.1|PPA419950 Pharus parvifolius chloroplast partial ... 96 2e-17
326emb|AJ419949.1|SSP419949 Streptochaeta spicata chloroplast parti... 96 2e-17
327gb|AY632371.1| Spartina pectinata ribulose-1,5-bisphosphate carb... 94 6e-17
328emb|AJ784821.1| Spartina pectinata chloroplast partial rbcL gene... 94 6e-17
329gb|AY622894.1| Lygeum spartum ribulose-1,5-bisphosphate carboxyl... 94 6e-17
330gb|AY216650.1| Luzula nivea ribulose-1,5-bisphosphate carboxylas... 88 4e-15
331gb|AY034250.1| Wolffia borealis ribulose-1,5-biphosphate carboxy... 88 4e-15
332gb|AY034248.1| Wolffia brasiliensis ribulose-1,5-biphosphate car... 88 4e-15
333gb|AY034227.1| Lemna tenera ribulose-1,5-biphosphate carboxylase... 88 4e-15
334gb|U80704.1|LSU80704 Limnobium spongia ribulose-1,5-bisphosphate... 88 4e-15
335gb|U80701.1|HMU80701 Hydrocharis morsus-ranae ribulose-1,5-bisph... 88 4e-15
336dbj|AB004894.1| Limnobium laevigatum chloroplast rbcL gene for r... 88 4e-15
337dbj|AB004892.1| Hydrocharis dubia chloroplast rbcL gene for ribu... 88 4e-15
338gb|AC134256.4| Oryza sativa (japonica cultivar-group), complete ... 86 2e-14
339emb|AJ746296.1| Nardus stricta chloroplast partial rbcL gene for... 86 2e-14
340dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 86 2e-14
341gb|AY622895.1| Nardus stricta ribulose-1,5-bisphosphate carboxyl... 86 2e-14
342gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 86 2e-14
343gb|AY320253.1| Vesicularia reticulata ribulose-1,5-bisphosphate ... 84 6e-14
344gb|AY312938.1| Timmia megapolitana ribulose 1,5-bisphosphate car... 84 6e-14
345gb|AF491014.1| Timmia austriaca 162 ribulose-1,5-bisphosphate ca... 84 6e-14
346emb|AJ275185.1|TAU275185 Timmia austriaca chloroplast partial rb... 84 6e-14
347emb|AJ275166.1|TSI275166 Timmia sibirica chloroplast partial rbc... 84 6e-14
348gb|AF226815.1|AF226815 Campylopus eberhardtii ribulose-1,5-bisph... 84 6e-14
349gb|AF158175.1|AF158175 Pterobryon densum ribulose 1,5-bisphospha... 84 6e-14
350gb|AF478242.1| Timmia megapolitana ribulose 1,5-bisphosphate car... 84 6e-14
351dbj|AB100957.1| Dixonia thamnioides chloroplast rbcL gene for ri... 84 6e-14
352dbj|AB100955.1| Dixonia thamnioides chloroplast rbcL gene for ri... 84 6e-14
353dbj|AB100954.1| Dixonia thamnioides chloroplast rbcL gene for ri... 84 6e-14
354dbj|AB019466.1| Taiwanobryum speciosum chloroplast gene for ribu... 84 6e-14
355dbj|AB019462.1| Pterobryopsis orientalis var. yunnanensis chloro... 84 6e-14
356dbj|AB019460.1| Pilotrichopsis dentata chloroplast gene for ribu... 84 6e-14
357dbj|AB019459.1| Pilotrichopsis dentata chloroplast gene for ribu... 84 6e-14
358gb|AF148766.1| Centrolepis strigosa ribulose-1,5-bisphosphate ca... 82 2e-13
359emb|AJ286558.1|CST286558 Centrolepis strigosa chloroplast partia... 82 2e-13
360gb|AC133248.4| Oryza sativa (japonica cultivar-group) chromosome... 80 1e-12
361gb|AY395548.1| Luzula campestris ribulose-1,5-bisphosphate carbo... 80 1e-12
362gb|AY395543.1| Juncus articulatus ribulose-1,5-bisphosphate carb... 80 1e-12
363gb|AY368371.1| Thecostele alata ribulose-1,5-bisphosphate carbox... 80 1e-12
364gb|AY368370.1| Scuticaria hadwenii ribulose-1,5-bisphosphate car... 80 1e-12
365gb|AY368360.1| Hexadesmia sp. Chase O-336 ribulose-1,5-bisphosph... 80 1e-12
366gb|AY368356.1| Cymbidium eburneum ribulose-1,5-bisphosphate carb... 80 1e-12
367gb|AY368341.1| Gennaria diphylla ribulose-1,5-bisphosphate carbo... 80 1e-12
368gb|AF148773.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate... 80 1e-12
369gb|AF148772.1| Georgeantha hexandra ribulose-1,5-bisphosphate ca... 80 1e-12
370gb|AF264167.1| Eulophia petersii ribulose-1,5-bisphosphate carbo... 80 1e-12
371gb|L10248.2|MNACPRBCL Montrichardia arborescens ribulose 1,5-bis... 80 1e-12
372gb|L10246.2|XAOCPRBCL Xanthosoma sagittifolium ribulose 1,5-bisp... 80 1e-12
373emb|Z69237.1|BVRBCL B.volubilis chloroplast rbcL gene 80 1e-12
374emb|Y12968.1|SDY12968 S.distans rbcL gene 80 1e-12
375emb|Y12947.1|STY12947 S.terrestris rbcL gene 80 1e-12
376emb|AJ419947.1|RMA419947 Rostkovia magellanica chloroplast parti... 80 1e-12
377emb|AJ419946.1|MGR419946 Marsippospermum grandiflorum chloroplas... 80 1e-12
378emb|AJ419945.1|LMU419945 Luzula multiflora chloroplast partial r... 80 1e-12
379emb|AJ419944.1|DAC419944 Distichia acicularis chloroplast partia... 80 1e-12
380emb|AJ286563.1|XCA286563 Xyris capensis chloroplast partial rbcL... 80 1e-12
381emb|AJ286559.1|EMO286559 Ecdeiocolea monostachya chloroplast par... 80 1e-12
382gb|AF497112.1| Hapaline sp. HAR 056 ribulose-1,5-bisphosphate ca... 80 1e-12
383gb|AF497110.1| Filarum manserichense ribulose-1,5-bisphosphate c... 80 1e-12
384gb|AY216603.1| Juncus hallii ribulose-1,5-bisphosphate carboxyla... 80 1e-12
385gb|AY216655.1| Luzula canariensis ribulose-1,5-bisphosphate carb... 80 1e-12
386gb|AY216654.1| Luzula purpureosplendens ribulose-1,5-bisphosphat... 80 1e-12
387gb|AY216653.1| Luzula pilosa ribulose-1,5-bisphosphate carboxyla... 80 1e-12
388gb|AY216652.1| Luzula campestris ribulose-1,5-bisphosphate carbo... 80 1e-12
389gb|AY216651.1| Luzula arcuata ribulose-1,5-bisphosphate carboxyl... 80 1e-12
390gb|AY216649.1| Luzula wahlenbergii ribulose-1,5-bisphosphate car... 80 1e-12
391gb|AY216647.1| Luzula sudetica ribulose-1,5-bisphosphate carboxy... 80 1e-12
392gb|AY216646.1| Luzula divulgata ribulose-1,5-bisphosphate carbox... 80 1e-12
393gb|AY216645.1| Luzula spicata ribulose-1,5-bisphosphate carboxyl... 80 1e-12
394gb|AY216644.1| Luzula glabrata ribulose-1,5-bisphosphate carboxy... 80 1e-12
395gb|AY216643.1| Luzula novaecambriae ribulose-1,5-bisphosphate ca... 80 1e-12
396gb|AY216641.1| Luzula meridionalis ribulose-1,5-bisphosphate car... 80 1e-12
397gb|AY216640.1| Luzula gigantea ribulose-1,5-bisphosphate carboxy... 80 1e-12
398gb|AY216636.1| Luzula nodulosa ribulose-1,5-bisphosphate carboxy... 80 1e-12
399gb|AY216635.1| Luzula traversii ribulose-1,5-bisphosphate carbox... 80 1e-12
400gb|AY216634.1| Luzula johnstonii ribulose-1,5-bisphosphate carbo... 80 1e-12
401gb|AY216633.1| Luzula kjellmanniana ribulose-1,5-bisphosphate ca... 80 1e-12
402gb|AY216632.1| Luzula luzulina ribulose-1,5-bisphosphate carboxy... 80 1e-12
403gb|AY216631.1| Juncus oxycarpus ribulose-1,5-bisphosphate carbox... 80 1e-12
404gb|AY216630.1| Juncus subnodulosus ribulose-1,5-bisphosphate car... 80 1e-12
405gb|AY216629.1| Juncus maritimus ribulose-1,5-bisphosphate carbox... 80 1e-12
406gb|AY216628.1| Juncus himalensis ribulose-1,5-bisphosphate carbo... 80 1e-12
407gb|AY216627.1| Juncus repens ribulose-1,5-bisphosphate carboxyla... 80 1e-12
408gb|AY216625.1| Juncus compressus ribulose-1,5-bisphosphate carbo... 80 1e-12
409gb|AY216624.1| Juncus xiphioides ribulose-1,5-bisphosphate carbo... 80 1e-12
410gb|AY216622.1| Juncus bulbosus ribulose-1,5-bisphosphate carboxy... 80 1e-12
411gb|AY216621.1| Juncus oxymeris ribulose-1,5-bisphosphate carboxy... 80 1e-12
412gb|AY216618.1| Juncus trifidus ribulose-1,5-bisphosphate carboxy... 80 1e-12
413gb|AY216617.1| Juncus lomatophyllus ribulose-1,5-bisphosphate ca... 80 1e-12
414gb|AY216616.1| Juncus capensis ribulose-1,5-bisphosphate carboxy... 80 1e-12
415gb|AY216614.1| Juncus articulatus ribulose-1,5-bisphosphate carb... 80 1e-12
416gb|AY216613.1| Juncus gerardii ribulose-1,5-bisphosphate carboxy... 80 1e-12
417gb|AY216612.1| Juncus effusus ribulose-1,5-bisphosphate carboxyl... 80 1e-12
418gb|AY216611.1| Juncus ensifolius ribulose-1,5-bisphosphate carbo... 80 1e-12
419gb|AY216610.1| Juncus stygius ribulose-1,5-bisphosphate carboxyl... 80 1e-12
420gb|AY216609.1| Juncus kraussii ribulose-1,5-bisphosphate carboxy... 80 1e-12
421gb|AY216608.1| Juncus vaginatus ribulose-1,5-bisphosphate carbox... 80 1e-12
422gb|AY216607.1| Juncus dichotomus ribulose-1,5-bisphosphate carbo... 80 1e-12
423gb|AY216606.1| Juncus covillei ribulose-1,5-bisphosphate carboxy... 80 1e-12
424gb|AY216605.1| Juncus triglumis ribulose-1,5-bisphosphate carbox... 80 1e-12
425gb|AY216604.1| Juncus capillaceus ribulose-1,5-bisphosphate carb... 80 1e-12
426gb|AY216602.1| Juncus imbricatus ribulose-1,5-bisphosphate carbo... 80 1e-12
427gb|AY034258.1| Wolffia elongata ribulose-1,5-biphosphate carboxy... 80 1e-12
428gb|AY034257.1| Wolffia globosa ribulose-1,5-biphosphate carboxyl... 80 1e-12
429gb|AY034256.1| Wolffia cylindracea ribulose-1,5-biphosphate carb... 80 1e-12
430gb|AY034255.1| Wolffia columbiana ribulose-1,5-biphosphate carbo... 80 1e-12
431gb|AY034254.1| Wolffia arrhiza ribulose-1,5-biphosphate carboxyl... 80 1e-12
432gb|AY034253.1| Wolffia angusta ribulose-1,5-biphosphate carboxyl... 80 1e-12
433gb|AY034252.1| Wolffia neglecta ribulose-1,5-biphosphate carboxy... 80 1e-12
434gb|AY034247.1| Wolffiella denticulata ribulose-1,5-biphosphate c... 80 1e-12
435gb|AY034246.1| Wolffiella neotropica ribulose-1,5-biphosphate ca... 80 1e-12
436gb|AY034245.1| Wolffiella welwitschii ribulose-1,5-biphosphate c... 80 1e-12
437gb|AY034244.1| Wolffiella caudata ribulose-1,5-biphosphate carbo... 80 1e-12
438gb|AY034243.1| Wolffiella gladiata ribulose-1,5-biphosphate carb... 80 1e-12
439gb|AY034242.1| Wolffiella oblonga ribulose-1,5-biphosphate carbo... 80 1e-12
440gb|AY034241.1| Wolffiella lingulata ribulose-1,5-biphosphate car... 80 1e-12
441gb|AY034240.1| Wolffiella hyalina ribulose-1,5-biphosphate carbo... 80 1e-12
442gb|AY034239.1| Wolffiella repanda ribulose-1,5-biphosphate carbo... 80 1e-12
443gb|AY034238.1| Wolffiella rotunda ribulose-1,5-biphosphate carbo... 80 1e-12
444gb|AY034236.1| Lemna disperma ribulose-1,5-biphosphate carboxyla... 80 1e-12
445gb|AY034232.1| Lemna obscura ribulose-1,5-biphosphate carboxylas... 80 1e-12
446gb|AY034231.1| Lemna ecuadoriensis ribulose-1,5-biphosphate carb... 80 1e-12
447gb|AY034230.1| Lemna turionifera ribulose-1,5-biphosphate carbox... 80 1e-12
448gb|AY034229.1| Lemna perpusilla ribulose-1,5-biphosphate carboxy... 80 1e-12
449gb|AY034228.1| Lemna aequinoctialis ribulose-1,5-biphosphate car... 80 1e-12
450gb|AY034226.1| Lemna yungensis ribulose-1,5-biphosphate carboxyl... 80 1e-12
451gb|AY034225.1| Lemna valdiviana ribulose-1,5-biphosphate carboxy... 80 1e-12
452gb|AY034224.1| Lemna minuta ribulose-1,5-biphosphate carboxylase... 80 1e-12
453gb|AY012494.1| Drymophloeus beguinii ribulose bisphosphate carbo... 80 1e-12
454gb|AY012493.1| Balaka seemannii ribulose bisphosphate carboxylas... 80 1e-12
455gb|M91630.1|LGICPRBCL Lemna minuta ribulose 1,5-bisphosphate car... 80 1e-12
456gb|AY660588.1| Oxychloe andina voucher Brooks 20583 (C1436) ribu... 80 1e-12
457gb|AY660585.1| Oxychloe castellanosii voucher H319/2 ribulose-1,... 80 1e-12
458gb|AF537122.1| Trichomanes cuspidatum ribulose-1,5-bisphosphate ... 80 1e-12
459gb|AF206834.1| Xyris sp. Chase 154 ribulose 1,5-bisphosphate car... 80 1e-12
460gb|AF074235.1|AF074235 Trichotosia ferox ribulose-1,5-bisphospha... 80 1e-12
461gb|AF074230.1|AF074230 Stanhopea ecornuta ribulose-1,5-bisphosph... 80 1e-12
462gb|AF074222.1|AF074222 Polystachya pubescens ribulose-1,5-bispho... 80 1e-12
463gb|AF074211.1|AF074211 Phalaenopsis equestris ribulose-1,5-bisph... 80 1e-12
464gb|AF074197.1|AF074197 Neofinetia falcata ribulose-1,5-bisphosph... 80 1e-12
465gb|AF074192.1|AF074192 Meiracyllium trinasutum ribulose-1,5-bisp... 80 1e-12
466gb|AF074170.1|AF074170 Eulophia nuda ribulose-1,5-bisphosphate c... 80 1e-12
467gb|AF074157.1|AF074157 Encyclia sp. KMC1998 ribulose-1,5-bisphos... 80 1e-12
468gb|AF074148.1|AF074148 Diceratostele gabonensis ribulose-1,5-bis... 80 1e-12
469gb|AF074147.1|AF074147 Diaphananthe rutila ribulose-1,5-bisphosp... 80 1e-12
470gb|AF074122.1|AF074122 Cattleya dowiana ribulose-1,5-bisphosphat... 80 1e-12
471gb|AF074106.1|AF074106 Angraecum sesquipedale ribulose-1,5-bisph... 80 1e-12
472gb|AF074104.1|AF074104 Aeranthes ramosa ribulose-1,5-bisphosphat... 80 1e-12
473gb|AF233578.1|AF233578 Lepidopilum surinamense ribulose 1,5-bisp... 80 1e-12
474gb|AF074130.1| Cleisostoma rolfeanum ribulose-1,5-bisphosphate c... 80 1e-12
475gb|AF074103.1| Aerangis calligera ribulose-1,5-bisphosphate carb... 80 1e-12
476gb|AY123235.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate... 80 1e-12
477emb|AJ542427.1|EBO542427 Eurystyles borealis plastid partial rbc... 80 1e-12
478gb|AF518075.1| Sophronitis mirandae specimen-voucher MWC1208 rib... 80 1e-12
479gb|AF518073.1| Sophronitis harpophylla specimen-voucher MWC1249 ... 80 1e-12
480gb|AF518072.1| Sophronitis coccinea specimen-voucher C237 ribulo... 80 1e-12
481gb|AF518071.1| Cattleya violacea specimen-voucher MWC1261 ribulo... 80 1e-12
482gb|AF518070.1| Laelia speciosa specimen-voucher MWC6088 ribulose... 80 1e-12
483gb|AF518069.1| Broughtonia sanguinea specimen-voucher MWC1191 ri... 80 1e-12
484gb|AF518067.1| Scaphyglottis modesta specimen-voucher MWC1243 ri... 80 1e-12
485gb|AF518066.1| Hexadesmia crurigera specimen-voucher MWC336 ribu... 80 1e-12
486gb|AF518064.1| Scaphyglottis punctulata specimen-voucher MWC299 ... 80 1e-12
487gb|AF518063.1| Prosthechea abbreviata specimen-voucher MWC5942 r... 80 1e-12
488gb|AF518062.1| Encyclia oncidioides specimen-voucher MWC5938 rib... 80 1e-12
489gb|AF518061.1| Dinema polybulbon specimen-voucher MWC1233 ribulo... 80 1e-12
490gb|AF518060.1| Epidendrum campestre specimen-voucher C242 ribulo... 80 1e-12
491gb|AF518059.1| Caularthron bilamellatum specimen-voucher MWC1188... 80 1e-12
492gb|AF518058.1| Amblostoma armeniacum specimen-voucher MWC1229 ri... 80 1e-12
493gb|AF518057.1| Pseudolaelia vellozicola specimen-voucher C229 ri... 80 1e-12
494gb|AF518045.1| Neobenthamia gracilis specimen-voucher C304 ribul... 80 1e-12
495gb|AF518028.1| Eulophia sp. Chase O-403 specimen-voucher MWC403 ... 80 1e-12
496emb|AM110235.1| Ptychosperma macarthurii plastid partial rbcL ge... 80 1e-12
497gb|AY916449.1| Phalaenopsis aphrodite subsp. formosana plastid, ... 80 1e-12
498gb|DQ058339.1| Scleria distans ribulose-1,5-bisphosphate carboxy... 80 1e-12
499gb|AF249647.1| Microstrobos niphophilus ribulose-1,5-bisphosphat... 80 1e-12
500gb|AF021875.1|AF021875 Anomochloa marantoidea ribulose 1,5-bisph... 80 1e-12

>gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) mRNA, complete cds; chloroplast
          Length = 1510

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1217 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1158

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1157 acccagtcctgagtgaaaaa 1138



to top

>gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1333

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1140 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1081

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1080 acccagtcctgagtgaaaaa 1061



to top

>gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1323

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1127 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1068

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1067 acccagtcctgagtgaaaaa 1048



to top

>gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1287

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1109 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1050

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1049 acccagtcctgagtgaaaaa 1030



to top

>gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1332

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1130 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1071

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1070 acccagtcctgagtgaaaaa 1051



to top

>gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1296

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1125 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1066

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1065 acccagtcctgagtgaaaaa 1046



to top

>gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1299

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1128 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1069

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1068 acccagtcctgagtgaaaaa 1049



to top

>gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1110 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1051

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1050 acccagtcctgagtgaaaaa 1031



to top

>gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1350

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1259

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1105 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1046

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1045 acccagtcctgagtgaaaaa 1026



to top

>gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1408

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1156 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1097

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1096 acccagtcctgagtgaaaaa 1077



to top

>emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1363

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1164 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1105

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1104 acccagtcctgagtgaaaaa 1085



to top

>emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1349

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1150 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1091

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1090 acccagtcctgagtgaaaaa 1071



to top

>emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1360

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1151 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1092

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1091 acccagtcctgagtgaaaaa 1072



to top

>gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcl) mRNA, complete cds; chloroplast gene
            for chloroplast product
          Length = 1519

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1225 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1166

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1165 acccagtcctgagtgaaaaa 1146



to top

>emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
            large subunit of ribulose 1,5 bisphosphate
            carboxylase/oxygenase and apoprotein I
          Length = 3830

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1003 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 944

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 943  acccagtcctgagtgaaaaa 924



to top

>emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for large
            subunit of ribulose 1,5 bisphosphate
            carboxylase/oxygenase and apoprotein I
          Length = 4811

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1003 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 944

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 943  acccagtcctgagtgaaaaa 924



to top

>emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
            large subunit of ribulose 1,5 bisphosphate
            carboxylase/oxygenase and apoprotein I
          Length = 4075

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1003 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 944

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 943  acccagtcctgagtgaaaaa 924



to top

>emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB
          Length = 2174

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 2061 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 2002

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 2001 acccagtcctgagtgaaaaa 1982



to top

>gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast gene for chloroplast product
          Length = 1477

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1142 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1083

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1082 acccagtcctgagtgaaaaa 1063



to top

>gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1610

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1606

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1621

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1628

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-voucher H28
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-voucher H161
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-voucher H837
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-voucher H832
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-voucher H828
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-voucher H826
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-voucher H824
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-voucher H823
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-voucher H820
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-voucher H81
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-voucher H64
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H620
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H607
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H544
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H522
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H87
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H41
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1287

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1109 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1050

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1049 acccagtcctgagtgaaaaa 1030



to top

>emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1332

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1130 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1071

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1070 acccagtcctgagtgaaaaa 1051



to top

>emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partial rbcL gene for
            ribulose bisphosphate carboxylase large chain
          Length = 1296

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1125 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1066

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1065 acccagtcctgagtgaaaaa 1046



to top

>emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1299

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1128 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1069

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1068 acccagtcctgagtgaaaaa 1049



to top

>emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1110 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1051

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1050 acccagtcctgagtgaaaaa 1031



to top

>emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1329

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1130 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1071

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1070 acccagtcctgagtgaaaaa 1051



to top

>emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1323

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1127 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1068

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1067 acccagtcctgagtgaaaaa 1048



to top

>emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1370

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1619

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1276 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1217

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1216 acccagtcctgagtgaaaaa 1197



to top

>gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1617

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris voucher H6701
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1611

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1594

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher H4378
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher H4375
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis voucher H4348
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1275 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1216

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1215 acccagtcctgagtgaaaaa 1196



to top

>gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1279 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1220

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1219 acccagtcctgagtgaaaaa 1200



to top

>gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1279 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1220

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1219 acccagtcctgagtgaaaaa 1200



to top

>gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1279 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1220

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1219 acccagtcctgagtgaaaaa 1200



to top

>gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1614

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1279 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1220

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1219 acccagtcctgagtgaaaaa 1200



to top

>gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3054

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1133 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1074

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1073 acccagtcctgagtgaaaaa 1054



to top

>gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3179

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; and rbcL-psaI
            intergenic spacer, partial sequence; chloroplast
          Length = 2360

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3138

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3155

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2309

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1142 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1083

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1082 acccagtcctgagtgaaaaa 1063



to top

>gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            psaI gene, partial sequence; chloroplast
          Length = 3071

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2752

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3106

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2136

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3158

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3110

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3095

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3108

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3102

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2371

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2372

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3166

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2366

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2374

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3190

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3192

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3171

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2268

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1135 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1076

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1075 acccagtcctgagtgaaaaa 1056



to top

>gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2373

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2365

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3183

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2360

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3234

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3215

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1214 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1155

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1154 acccagtcctgagtgaaaaa 1135



to top

>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome
          Length = 134545

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 56075 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 56016

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 56015 acccagtcctgagtgaaaaa 55996



to top

>emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1224

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (H-type), complete
            cds
          Length = 1755

 Score =  133 bits (67), Expect = 7e-29
 Identities = 76/80 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1261 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1202

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1201 acccagtcctgagtgaaaaa 1182



to top

>gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  127 bits (64), Expect = 5e-27
 Identities = 73/77 (94%)
 Strand = Plus / Minus

                                                                        
Query: 4    ggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggatacc 63
            |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||
Sbjct: 1151 ggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggatacc 1092

                             
Query: 64   cagacctgantgaaaaa 80
            ||| ||||| |||||||
Sbjct: 1091 cagtcctgagtgaaaaa 1075



to top

>gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica voucher H6703
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1471

 Score =  127 bits (64), Expect = 5e-27
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||
Sbjct: 1135 gctggcatatgccaaacatgaataccacctgaagctaccggtataacanctggcatggat 1076

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1075 acccagtcctgagtgaaaaa 1056



to top

>gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds
          Length = 1484

 Score =  127 bits (64), Expect = 5e-27
 Identities = 73/77 (94%)
 Strand = Plus / Minus

                                                                        
Query: 4    ggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggatacc 63
            |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||
Sbjct: 1163 ggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggatacc 1104

                             
Query: 64   cagacctgantgaaaaa 80
            ||| ||||| |||||||
Sbjct: 1103 cagtcctgagtgaaaaa 1087



to top

>gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1143

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1122 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1063

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1062 acccagtcctgagtgaaaaa 1043



to top

>gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1277

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1113 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1054

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1053 acccagtcctgagtgaaaaa 1034



to top

>gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| | ||| |||||||
Sbjct: 1094 acccagtcttgagtgaaaaa 1075



to top

>gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcagggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||  ||||| |||||||
Sbjct: 1086 acccaatcctgagtgaaaaa 1067



to top

>gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1408

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1346

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1147 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1088

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1087 acccagtcctgagtgaaaaa 1068



to top

>emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1358

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1148 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1089

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1088 acccagtcctgagtgaaaaa 1069



to top

>emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1357

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1153 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1094

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1093 acccagtcctgagtgaaaaa 1074



to top

>emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1332

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1301

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1135 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1076

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| | ||| |||||||
Sbjct: 1075 acccagtcttgagtgaaaaa 1056



to top

>emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1397

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||
Sbjct: 1156 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcatggat 1097

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1096 acccagtcctgagtgaaaaa 1077



to top

>emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||  |||||||
Sbjct: 1106 acccagtcctgggtgaaaaa 1087



to top

>emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1362

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit gene, partial cds;
            chloroplast
          Length = 1330

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||  |||||||
Sbjct: 1076 acccagtcctgggtgaaaaa 1057



to top

>gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydrogenase (rbcL) gene, complete
            cds
          Length = 1623

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1264 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcatggat 1205

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||  |||||||
Sbjct: 1204 acccagtcctgggtgaaaaa 1185



to top

>gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  125 bits (63), Expect = 2e-26
 Identities = 75/80 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1434

 Score =  119 bits (60), Expect = 1e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgncaaacatgaataccacctgaagctaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||  |||||||
Sbjct: 1106 acccagtcctgtgtgaaaaa 1087



to top

>gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1175

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaatacctcctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1201

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1103 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1044

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1043 acccagtcctgagtgaaaaa 1024



to top

>gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||| ||| |||||
Sbjct: 1103 gctggcatatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggat 1044

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1043 acccagtcctgagtgaaaaa 1024



to top

>gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||
Sbjct: 1103 gctggcatatgccaaacatgaataccacctgaagccaccggtataacacctggcatggat 1044

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||  ||||| |||||||
Sbjct: 1043 acccaatcctgagtgaaaaa 1024



to top

>gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; plastid
          Length = 1171

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative rbcL; RuBisCO large
            subunit from chromosome 10 chloroplast insertion
            (OSJNBb0075K12.39), mRNA
          Length = 1434

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1154 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| |||||||||||||||  ||||
Sbjct: 1154 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcagggat 1095

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1094 acccagtcctgagtgaaaaa 1075



to top

>gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare chloroplast,
             complete genome
          Length = 134551

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 55268 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 55209

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 55208 acccagtcctgagtgaaaaa 55189



to top

>gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA64S chloroplast,
             complete genome
          Length = 134551

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 55268 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 55209

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 55208 acccagtcctgagtgaaaaa 55189



to top

>gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-11 chloroplast,
             complete genome
          Length = 134496

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 55216 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 55157

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 55156 acccagtcctgagtgaaaaa 55137



to top

>gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1349

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||| 
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaa 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1328

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||| 
Sbjct: 1150 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaa 1091

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1090 acccagtcctgagtgaaaaa 1071



to top

>emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1359

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1151 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1092

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1091 acccagtcctgagtgaaaaa 1072



to top

>emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1353

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||| 
Sbjct: 1164 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaa 1105

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1104 acccagtcctgagtgaaaaa 1085



to top

>emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1356

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1148 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1089

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1088 acccagtcctgagtgaaaaa 1069



to top

>emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| |||||||||||||||  ||||
Sbjct: 1147 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcagggat 1088

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1087 acccagtcctgagtgaaaaa 1068



to top

>emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1338

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1148 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1089

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1088 acccagtcctgagtgaaaaa 1069



to top

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 1      gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
              |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 125557 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 125498

                                  
Query: 61     acccagacctgantgaaaaa 80
              |||||| ||||| |||||||
Sbjct: 125497 acccagtcctgagtgaaaaa 125478



 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 30497 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 30438

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 30437 acccagtcctgagtgaaaaa 30418



to top

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 1      gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
              |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 124584 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 124525

                                  
Query: 61     acccagacctgantgaaaaa 80
              |||||| ||||| |||||||
Sbjct: 124524 acccagtcctgagtgaaaaa 124505



 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 30003 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 29944

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 29943 acccagtcctgagtgaaaaa 29924



to top

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 1      gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
              |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 124584 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 124525

                                  
Query: 61     acccagacctgantgaaaaa 80
              |||||| ||||| |||||||
Sbjct: 124524 acccagtcctgagtgaaaaa 124505



 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 30003 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 29944

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 29943 acccagtcctgagtgaaaaa 29924



to top

>emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for the rubisco large subunit
            (EC 4.1.1.39)
          Length = 1990

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1583 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1524

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1523 acccagtcctgagtgaaaaa 1504



to top

>emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene for the rubisco large
            subunit (EC 4.1.1.39)
          Length = 2010

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1603 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1544

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1543 acccagtcctgagtgaaaaa 1524



to top

>emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chloroplast genome
          Length = 134525

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 55260 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 55201

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 55200 acccagtcctgagtgaaaaa 55181



to top

>emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1289

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1081 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1022

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1021 acccagtcctgagtgaaaaa 1002



to top

>emb|AJ746299.1| Phragmites australis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1341

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1146 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1295

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||| ||| |||||
Sbjct: 1124 gctggcatatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggat 1065

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1064 acccagtcctgagtgaaaaa 1045



to top

>emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1239

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1031 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 972

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 971  acccagtcctgagtgaaaaa 952



to top

>emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1408

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| |||||||||||||||  ||||
Sbjct: 1146 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcagggat 1087

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1086 acccagtcctgagtgaaaaa 1067



to top

>emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1166 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1409

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1149 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1090

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1089 acccagtcctgagtgaaaaa 1070



to top

>emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1385

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1151 gctggcatatgccaaacatgaataccgcctgaagccaccggtataacacctggcatggat 1092

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1091 acccagtcctgagtgaaaaa 1072



to top

>emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1388

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||| 
Sbjct: 1126 gctggcatatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaa 1067

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1066 acccagtcctgagtgaaaaa 1047



to top

>emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| || | |||||||||||||||||||||| |||||
Sbjct: 1081 gctggcatatgccaaacatgaatacccccagaagctaccggtataacacctggcatggat 1022

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1021 acccagtcctgagtgaaaaa 1002



to top

>emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| ||| |||||||||||||| ||| |||||
Sbjct: 1081 gctggcatatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggat 1022

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1021 acccagtcctgagtgaaaaa 1002



to top

>emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            ||||||||||||||||||||||||||||||| |||||| |||||||||||||||  ||||
Sbjct: 1166 gctggcatatgccaaacatgaataccacctgaagctactggtataacacctggcagggat 1107

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1106 acccagtcctgagtgaaaaa 1087



to top

>emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1339

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1149 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1090

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1089 acccagtcctgagtgaaaaa 1070



to top

>gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0075K12, complete sequence
          Length = 125936

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 53470 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 53411

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 53410 acccagtcctgagtgaaaaa 53391



to top

>gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast, complete genome
          Length = 141182

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 1      gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
              |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 120247 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 120188

                                  
Query: 61     acccagacctgantgaaaaa 80
              |||||| ||||| |||||||
Sbjct: 120187 acccagtcctgagtgaaaaa 120168



to top

>gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxylase (rbcL) gene,
            partial cds; chloroplast gene for chloroplast product
          Length = 1289

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1081 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1022

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1021 acccagtcctgagtgaaaaa 1002



to top

>gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate carboxylase (rbcL)
            gene, partial cds; chloroplast gene for chloroplast
            product
          Length = 1239

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1031 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 972

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 971  acccagtcctgagtgaaaaa 952



to top

>gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar Nipponbare from
              chromosome 10, complete sequence
          Length = 134933

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                          
Query: 1      gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
              |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 128403 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 128344

                                  
Query: 61     acccagacctgantgaaaaa 80
              |||||| ||||| |||||||
Sbjct: 128343 acccagtcctgagtgaaaaa 128324



to top

>gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carboxylase large subunit
            (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast gene
            for chloroplast product
          Length = 1320

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1398

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                           
Query: 1       gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
               |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 5614308 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 5614249

                                   
Query: 61      acccagacctgantgaaaaa 80
               |||||| ||||| |||||||
Sbjct: 5614248 acccagtcctgagtgaaaaa 5614229



 Score = 50.1 bits (25), Expect = 9e-04
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 1        gctggcatatgccaaacatgaatac 25
                |||||||||||||||||||||||||
Sbjct: 26145117 gctggcatatgccaaacatgaatac 26145093



 Score = 40.1 bits (20), Expect = 0.84
 Identities = 27/30 (90%)
 Strand = Plus / Minus

                                              
Query: 51       tggcntggatacccagacctgantgaaaaa 80
                |||| ||||||||||| ||||| |||||||
Sbjct: 13437103 tggcatggatacccagtcctgagtgaaaaa 13437074



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                            
Query: 1        gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
                |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 10347078 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 10347019

                                    
Query: 61       acccagacctgantgaaaaa 80
                |||||| ||||| |||||||
Sbjct: 10347018 acccagtcctgagtgaaaaa 10346999



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                            
Query: 1        gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
                |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 23203827 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 23203886

                                    
Query: 61       acccagacctgantgaaaaa 80
                |||||| ||||| |||||||
Sbjct: 23203887 acccagtcctgagtgaaaaa 23203906



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                            
Query: 1        gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
                |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 33527404 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 33527463

                                    
Query: 61       acccagacctgantgaaaaa 80
                |||||| ||||| |||||||
Sbjct: 33527464 acccagtcctgagtgaaaaa 33527483



to top

>gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1304

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1285

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1117 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1058

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1057 acccagtcctgagtgaaaaa 1038



to top

>gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1305

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds
          Length = 1320

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0557A01
          Length = 147201

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 72601 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 72660

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 72661 acccagtcctgagtgaaaaa 72680



to top

>dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0417D05
          Length = 165752

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                          
Query: 1      gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
              |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 154475 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 154534

                                  
Query: 61     acccagacctgantgaaaaa 80
              |||||| ||||| |||||||
Sbjct: 154535 acccagtcctgagtgaaaaa 154554



to top

>dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0642B07
          Length = 139297

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 38589 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 38648

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 38649 acccagtcctgagtgaaaaa 38668



to top

>dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-A05, full
            insert sequence
          Length = 2485

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1221 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1162

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1161 acccagtcctgagtgaaaaa 1142



to top

>dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G09, full
           insert sequence
          Length = 838

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
           |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 226 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 167

                               
Query: 61  acccagacctgantgaaaaa 80
           |||||| ||||| |||||||
Sbjct: 166 acccagtcctgagtgaaaaa 147



to top

>dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-B12, full
           insert sequence
          Length = 1243

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                       
Query: 1   gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
           |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 964 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 905

                               
Query: 61  acccagacctgantgaaaaa 80
           |||||| ||||| |||||||
Sbjct: 904 acccagtcctgagtgaaaaa 885



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                            
Query: 1        gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
                |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 10353117 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 10353058

                                    
Query: 61       acccagacctgantgaaaaa 80
                |||||| ||||| |||||||
Sbjct: 10353057 acccagtcctgagtgaaaaa 10353038



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                           
Query: 1       gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
               |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 5614297 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 5614238

                                   
Query: 61      acccagacctgantgaaaaa 80
               |||||| ||||| |||||||
Sbjct: 5614237 acccagtcctgagtgaaaaa 5614218



 Score = 50.1 bits (25), Expect = 9e-04
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 1        gctggcatatgccaaacatgaatac 25
                |||||||||||||||||||||||||
Sbjct: 26073293 gctggcatatgccaaacatgaatac 26073269



 Score = 40.1 bits (20), Expect = 0.84
 Identities = 27/30 (90%)
 Strand = Plus / Minus

                                              
Query: 51       tggcntggatacccagacctgantgaaaaa 80
                |||| ||||||||||| ||||| |||||||
Sbjct: 13391377 tggcatggatacccagtcctgagtgaaaaa 13391348



to top

>emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa0021D06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 139684

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Plus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 38577 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 38636

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 38637 acccagtcctgagtgaaaaa 38656



to top

>dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete genome
          Length = 141182

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 58620 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 58561

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 58560 acccagtcctgagtgaaaaa 58541



to top

>dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome
          Length = 134494

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                         
Query: 1     gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
             |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 55195 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 55136

                                 
Query: 61    acccagacctgantgaaaaa 80
             |||||| ||||| |||||||
Sbjct: 55135 acccagtcctgagtgaaaaa 55116



to top

>gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|M91626.1|BAMCPRBCL Bamboo chloroplast ribulosebisphosphate (rbcL) gene, partial cds
          Length = 1324

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1135 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1076

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1075 acccagtcctgagtgaaaaa 1056



to top

>gb|U31381.1|TBU31381 Tristachya biseriata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31442.1|SDU31442 Stipa dregeana var. dregeana ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31438.1|MMU31438 Merxmuellera macowanii ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31439.1|MJU31439 Moliniopsis japonica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31105.1|GSU31105 Gynerium sagittatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31101.1|CLU31101 Chasmanthium latifolium ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>gb|U31100.1|CGU31100 Centropodia glauca ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057



to top

>emb|X04789.1|CHOSRBCL Rice chloroplast DNA for ribulose-1,5-biphosphate carboxylase (clone
            pCT-1)
          Length = 1989

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1553 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1494

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1493 acccagtcctgagtgaaaaa 1474



to top

>gb|U13231.1|LHU13231 Lithachne humilis chloroplast ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds
          Length = 1320

 Score =  117 bits (59), Expect = 4e-24
 Identities = 74/80 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggcatatgccaaacatgaataccacctgnagctaccggtataacacctggcntggat 60
            |||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||
Sbjct: 1136 gctggcatatgccaaacatgaataccccctgaagccaccggtataacacctggcatggat 1077

                                
Query: 61   acccagacctgantgaaaaa 80
            |||||| ||||| |||||||
Sbjct: 1076 acccagtcctgagtgaaaaa 1057


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 320,478
Number of Sequences: 3902068
Number of extensions: 320478
Number of successful extensions: 27866
Number of sequences better than 10.0: 11826
Number of HSP's better than 10.0 without gapping: 11825
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 15881
Number of HSP's gapped (non-prelim): 11988
length of query: 80
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 59
effective length of database: 17,151,101,840
effective search space: 1011915008560
effective search space used: 1011915008560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top