>gb|AY106714.1| Zea mays PCO119626 mRNA sequence
          Length = 1251

 Score = 56.0 bits (28), Expect = 9e-06
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 21  tctatggcggtgcaaaantgcattgacgaat 51
           ||||||||||||||||| |||||||||||||
Sbjct: 278 tctatggcggtgcaaaattgcattgacgaat 248

>gb|AC005345.1| Homo sapiens Xp22-144-145 BAC GSHB-541M1 (Genome Systems Human BAC
              Library) complete sequence
          Length = 160439

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 9      ggctgccttctgtctatgg 27
              |||||||||||||||||||
Sbjct: 155003 ggctgccttctgtctatgg 154985

>gb|AC154757.2| Mus musculus BAC clone RP23-116J1 from chromosome 14, complete sequence
          Length = 202303

 Score = 38.2 bits (19), Expect = 2.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 11     ctgccttctgtctatggcg 29
              |||||||||||||||||||
Sbjct: 140135 ctgccttctgtctatggcg 140117

>gb|AC165274.2| Mus musculus BAC clone RP24-97D3 from chromosome 16, complete sequence
          Length = 175488

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     caaggctgccttctgtct 23
             ||||||||||||||||||
Sbjct: 27285 caaggctgccttctgtct 27302

>gb|AC131703.3| Mus musculus BAC clone RP24-141B8 from chromosome 9, complete sequence
          Length = 135770

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     caaggctgccttctgtct 23
             ||||||||||||||||||
Sbjct: 16857 caaggctgccttctgtct 16874

>ref|XM_810819.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508219.160) partial mRNA
          Length = 579

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 9   ggctgccttctgtctatggcgg 30
           ||||||| ||||||||||||||
Sbjct: 410 ggctgccatctgtctatggcgg 431

>gb|AC125054.4| Mus musculus BAC clone RP23-389M1 from chromosome 15, complete sequence
          Length = 188536

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 4     ggcaaggctgccttctgt 21
             ||||||||||||||||||
Sbjct: 64616 ggcaaggctgccttctgt 64633

>gb|AC102633.7| Mus musculus chromosome 15, clone RP23-326O18, complete sequence
          Length = 225738

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      ggcaaggctgccttctgt 21
              ||||||||||||||||||
Sbjct: 199211 ggcaaggctgccttctgt 199228

>gb|AC161195.4| Mus musculus chromosome 15, clone RP23-313M10, complete sequence
          Length = 166637

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 6    caaggctgccttctgtct 23
            ||||||||||||||||||
Sbjct: 5405 caaggctgccttctgtct 5422

>gb|AC124231.17| Mus musculus chromosome 18, clone RP23-17N19, complete sequence
          Length = 219005

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      aaggctgccttctgtcta 24
              ||||||||||||||||||
Sbjct: 193173 aaggctgccttctgtcta 193156

>ref|XM_692248.1| PREDICTED: Danio rerio similar to ring finger protein 123
           (LOC568886), partial mRNA
          Length = 906

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 6   caaggctgccttctgtct 23
           ||||||||||||||||||
Sbjct: 268 caaggctgccttctgtct 251

>dbj|AP003017.1| Mesorhizobium loti MAFF303099 plasmid pMLb DNA, complete genome
          Length = 208315

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 41     cattgacgaatgaacgag 58
              ||||||||||||||||||
Sbjct: 190283 cattgacgaatgaacgag 190266

>gb|AC118008.14| Mus musculus chromosome 15, clone RP23-435B2, complete sequence
          Length = 204342

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     caaggctgccttctgtct 23
             ||||||||||||||||||
Sbjct: 92708 caaggctgccttctgtct 92725

>gb|AC139322.4| Mus musculus BAC clone RP24-397L22 from 9, complete sequence
          Length = 186567

 Score = 36.2 bits (18), Expect = 8.4
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      caaggctgccttctgtct 23
              ||||||||||||||||||
Sbjct: 174719 caaggctgccttctgtct 174736


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 264,065
Number of Sequences: 3902068
Number of extensions: 264065
Number of successful extensions: 16290
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16273
Number of HSP's gapped (non-prelim): 17
length of query: 59
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 38
effective length of database: 17,151,101,840
effective search space: 651741869920
effective search space used: 651741869920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)