ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags6h24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z21510.1|TATRINF4A T.aestivum translation initiation factor 4A 309 4e-81
2ref|XM_464146.1| Oryza sativa (japonica cultivar-group), mRNA 307 1e-80
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 307 1e-80
4dbj|AP005288.3| Oryza sativa (japonica cultivar-group) genomic D... 307 1e-80
5dbj|AK073620.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 1e-80
6gb|AY109160.1| Zea mays PCO074340 mRNA sequence 285 5e-74
7gb|BT017457.1| Zea mays clone EL01N0407C01.c mRNA sequence 278 1e-71
8dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 278 1e-71
9dbj|AP003726.3| Oryza sativa (japonica cultivar-group) genomic D... 278 1e-71
10dbj|AP004278.2| Oryza sativa (japonica cultivar-group) genomic D... 278 1e-71
11dbj|AK119234.1| Oryza sativa (japonica cultivar-group) cDNA clon... 278 1e-71
12dbj|AK105454.1| Oryza sativa (japonica cultivar-group) cDNA clon... 278 1e-71
13dbj|AK099927.1| Oryza sativa (japonica cultivar-group) cDNA clon... 278 1e-71
14dbj|AK065230.1| Oryza sativa (japonica cultivar-group) cDNA clon... 278 1e-71
15dbj|AK061696.1| Oryza sativa (japonica cultivar-group) cDNA clon... 278 1e-71
16dbj|D12627.1|RICEIF4A Oryza sativa (japonica cultivar-group) mRN... 278 1e-71
17dbj|AB046416.1| Oryza sativa eIF4A-1 gene for eukaryotic initiat... 278 1e-71
18gb|BT016643.1| Zea mays clone Contig476 mRNA sequence 270 3e-69
19gb|AY104966.1| Zea mays PCO149753 mRNA sequence 270 3e-69
20gb|DQ013263.1| Pennisetum glaucum eukaryotic initiation factor 4... 262 8e-67
21gb|AF079782.1|AF079782 Zea mays translation initiation factor 4A... 262 8e-67
22gb|U17979.1|ZMU17979 Zea mays translation initiation factor eIF-... 262 8e-67
23gb|AF007580.1|AF007580 Zea mays translation initiation factor (e... 254 2e-64
24dbj|AB046415.1| Oryza sativa eIF4A-2 gene for eukaryotic initiat... 244 2e-61
25dbj|AB046414.1| Oryza sativa eIF4A-2 mRNA for eukaryotic initiat... 244 2e-61
26gb|BT016640.1| Zea mays clone Contig473 mRNA sequence 222 6e-55
27gb|U73459.1|ZMU73459 Zea mays translational initiation factor eI... 214 2e-52
28gb|AY158704.1| Apium graveolens var. dulce translation initition... 178 9e-42
29gb|BT013166.1| Lycopersicon esculentum clone 134229F, mRNA sequence 170 2e-39
30emb|X61205.1|NPNEIF4A2 N. plumbaginifolia NeIF-4A2 mRNA for nico... 157 3e-35
31emb|X79137.1|NT4A7 N.tabacum NeIF-4A7 mRNA 153 5e-34
32emb|X79009.1|NTEIF4A1 N.tabacum eIF-4A10 mRNA 151 2e-33
33emb|X79141.1|NT4A14 N.tabacum NeIF-4A14 mRNA 151 2e-33
34emb|X79008.1|NTEIF4A1D N.tabacum eIF-4A10 gene 151 2e-33
35emb|X79135.1|NT4A9 N.tabacum NeIF-4A9 mRNA 139 7e-30
36gb|DQ122921.1| Chlamydomonas incerta eukaryotic translation init... 125 1e-25
37gb|AY040227.1| Elaeis oleifera eukaryotic translation initiation... 121 2e-24
38gb|AF180356.1|AF180356 Brassica oleracea isolate B265 EIF4A prot... 119 7e-24
39ref|NM_112246.2| Arabidopsis thaliana EIF4A1; ATP-dependent heli... 115 1e-22
40emb|X65052.1|ATTIF4A1 A.thaliana mRNA for eukaryotic translation... 115 1e-22
41gb|BT000655.1| Arabidopsis thaliana clone RAFL07-07-D14 (R10830)... 115 1e-22
42emb|X79138.1|NT4A15 N.tabacum NeIF-4A15 mRNA 115 1e-22
43emb|X79139.1|NT4A6 N.tabacum NeIF-4A6 mRNA 115 1e-22
44gb|AY091304.1| Arabidopsis thaliana putative eukaryotic initiati... 115 1e-22
45gb|AY050957.1| Arabidopsis thaliana putative Eukaryotic initiati... 115 1e-22
46emb|AJ298137.1|ATH298137 Arabidopsis thaliana eIF-4A1 gene for t... 115 1e-22
47gb|AY139981.1| Arabidopsis thaliana unknown protein mRNA, comple... 115 1e-22
48gb|AY098962.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, comp... 115 1e-22
49gb|AY081287.1| Arabidopsis thaliana eukaryotic translation initi... 115 1e-22
50gb|AY052344.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, comp... 115 1e-22
51emb|BX826218.1|CNS0A6AB Arabidopsis thaliana Full-length cDNA Co... 115 1e-22
52gb|AY086907.1| Arabidopsis thaliana clone 29310 mRNA, complete s... 115 1e-22
53dbj|AB019229.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 115 1e-22
54emb|AJ298138.1|ATH298138 Arabidopsis thaliana mRNA for translati... 115 1e-22
55emb|X79136.1|NT4A11 N.tabacum NeIF-4A11 mRNA 107 3e-20
56emb|BX825413.1|CNS0A6HS Arabidopsis thaliana Full-length cDNA Co... 107 3e-20
57ref|NM_001035616.1| Arabidopsis thaliana EIF4A1; ATP-dependent h... 101 2e-18
58dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 100 6e-18
59dbj|AB224877.1| Aspergillus oryzae cDNA, contig sequence: AoEST1727 98 3e-17
60ref|XM_743008.1| Aspergillus fumigatus Af293 DEAD/DEAH box helic... 96 1e-16
61gb|AY428601.1| Helianthus annuus clone HA24-15A initiation facto... 94 4e-16
62gb|AC166553.2| Nectria haematococca clone JGIAYWI-9O2, complete ... 94 4e-16
63ref|XM_387017.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 92 2e-15
64ref|XM_501158.1| Yarrowia lipolytica CLIB122, YALI0B20922g predi... 90 6e-15
65emb|X79140.1|NT4A13 N.tabacum NeIF-4A13 mRNA 90 6e-15
66emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 90 6e-15
67gb|AC137554.15| Medicago truncatula clone mth2-17j18, complete s... 88 2e-14
68gb|AC136955.20| Medicago truncatula clone mth2-10p1, complete se... 88 2e-14
69emb|X79004.1|NTEIF4A8 N.tabacum eIF-4A8 mRNA 88 2e-14
70emb|X79005.1|NTEIF4A8D N.tabacum eIF-4A8 gene 88 2e-14
71gb|AC174465.2| Medicago truncatula chromosome 2 BAC clone mth2-1... 88 2e-14
72gb|AY347787.1| Malus x domestica clone 31-4 translation initiati... 86 1e-13
73ref|XM_749705.1| Aspergillus fumigatus Af293 eukaryotic translat... 84 4e-13
74gb|AY167670.1| Pisum sativum DEAD box RNA helicase mRNA, complet... 84 4e-13
75gb|AY513583.1| Pisum sativum DEAD box RNA helicase gene, complet... 84 4e-13
76dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 82 2e-12
77emb|AJ320155.1|TGO320155 Toxoplasma gondii mRNA for eukaryotic t... 80 6e-12
78gb|AY140659.1| Carabus solieri microsatellite 1122 sequence 78 2e-11
79ref|XM_361955.1| Magnaporthe grisea 70-15 hypothetical protein (... 78 2e-11
80ref|XM_655444.1| Aspergillus nidulans FGSC A4 hypothetical prote... 78 2e-11
81emb|Z12116.1|CEEIF4AM C.elegans mRNA for eIF-4A homologue 78 2e-11
82gb|DQ086181.1| Ictalurus punctatus eukaryotic translation initia... 78 2e-11
83ref|NM_001027453.1| Caenorhabditis elegans INitiation Factor fam... 78 2e-11
84ref|NM_001027452.1| Caenorhabditis elegans INitiation Factor fam... 78 2e-11
85ref|NM_104305.3| Arabidopsis thaliana EIF4A-2; ATP-dependent hel... 76 9e-11
86gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 geno... 76 9e-11
87emb|X65053.1|ATTIF4A2 A.thaliana mRNA for eukaryotic translation... 76 9e-11
88gb|BT008504.1| Arabidopsis thaliana At1g54270 gene, complete cds 76 9e-11
89gb|AF428462.1|AF428462 Arabidopsis thaliana At1g54270/F20D21_52 ... 76 9e-11
90gb|AF386923.1|AF386923 Arabidopsis thaliana Eukaryotic Initiatio... 76 9e-11
91gb|AY087965.1| Arabidopsis thaliana clone 3997 mRNA, complete se... 76 9e-11
92emb|BX053338.1|CNS09DBI Single read from an extremity of a full-... 70 6e-09
93emb|BX020719.1|CNS08O5F Single read from an extremity of a full-... 70 6e-09
94emb|BX072009.1|CNS09RQ5 Single read from an extremity of a full-... 70 6e-09
95emb|BX068966.1|CNS09PDM Single read from an extremity of a full-... 70 6e-09
96emb|BX065544.1|CNS09MQK Single read from an extremity of a full-... 70 6e-09
97emb|BX065406.1|CNS09MMQ Single read from an extremity of a full-... 70 6e-09
98emb|BX064751.1|CNS09M4J Single read from an extremity of a full-... 70 6e-09
99emb|BX063777.1|CNS09LDH Single read from an extremity of a full-... 70 6e-09
100emb|BX063717.1|CNS09LBT Single read from an extremity of a full-... 70 6e-09
101emb|BX062174.1|CNS09K4Y Single read from an extremity of a full-... 70 6e-09
102emb|BX060629.1|CNS09IY1 Single read from an extremity of a full-... 70 6e-09
103emb|BX059457.1|CNS09I1H Single read from an extremity of a full-... 70 6e-09
104emb|BX059385.1|CNS09HZH Single read from an extremity of a full-... 70 6e-09
105emb|BX056724.1|CNS09FXK Single read from an extremity of a full-... 70 6e-09
106emb|BX057122.1|CNS09G8M Single read from an extremity of a full-... 70 6e-09
107emb|BX056400.1|CNS09FOK Single read from an extremity of a full-... 70 6e-09
108emb|BX053169.1|CNS09D6T Single read from an extremity of a full-... 70 6e-09
109emb|BX053903.1|CNS09DR7 Single read from an extremity of a full-... 70 6e-09
110emb|BX031051.1|CNS08W4F Single read from an extremity of a full-... 70 6e-09
111emb|BX048647.1|CNS099P7 Single read from an extremity of a full-... 70 6e-09
112emb|BX046370.1|CNS097XY Single read from an extremity of a full-... 70 6e-09
113emb|BX043299.1|CNS095KN Single read from an extremity of a full-... 70 6e-09
114emb|BX042604.1|CNS0951C Single read from an extremity of a full-... 70 6e-09
115emb|BX042533.1|CNS094ZD Single read from an extremity of a full-... 70 6e-09
116emb|BX037324.1|CNS090YO Single read from an extremity of a full-... 70 6e-09
117emb|BX037318.1|CNS090YI Single read from an extremity of a full-... 70 6e-09
118emb|BX036647.1|CNS090FV Single read from an extremity of a full-... 70 6e-09
119emb|BX036646.1|CNS090FU Single read from an extremity of a full-... 70 6e-09
120emb|BX036940.1|CNS090O0 Single read from an extremity of a full-... 70 6e-09
121emb|BX036785.1|CNS090JP Single read from an extremity of a full-... 70 6e-09
122emb|BX036205.1|CNS0903L Single read from an extremity of a full-... 70 6e-09
123emb|BX033621.1|CNS08Y3T Single read from an extremity of a full-... 70 6e-09
124emb|BX033102.1|CNS08XPE Single read from an extremity of a full-... 70 6e-09
125emb|BX032924.1|CNS08XKG Single read from an extremity of a full-... 70 6e-09
126emb|BX032131.1|CNS08WYF Single read from an extremity of a full-... 70 6e-09
127emb|BX031809.1|CNS08WPH Single read from an extremity of a full-... 70 6e-09
128emb|BX031808.1|CNS08WPG Single read from an extremity of a full-... 70 6e-09
129emb|BX030042.1|CNS08VCE Single read from an extremity of a full-... 70 6e-09
130emb|BX029861.1|CNS08V7D Single read from an extremity of a full-... 70 6e-09
131emb|BX029784.1|CNS08V58 Single read from an extremity of a full-... 70 6e-09
132emb|BX028816.1|CNS08UEC Single read from an extremity of a full-... 70 6e-09
133emb|BX022396.1|CNS08PG0 Single read from an extremity of a full-... 70 6e-09
134emb|BX027810.1|CNS08TME Single read from an extremity of a full-... 70 6e-09
135emb|BX027601.1|CNS08TGL Single read from an extremity of a full-... 70 6e-09
136emb|BX027600.1|CNS08TGK Single read from an extremity of a full-... 70 6e-09
137emb|BX027436.1|CNS08TC0 Single read from an extremity of a full-... 70 6e-09
138emb|BX027281.1|CNS08T7P Single read from an extremity of a full-... 70 6e-09
139emb|BX026427.1|CNS08SJZ Single read from an extremity of a full-... 70 6e-09
140emb|BX025946.1|CNS08S6M Single read from an extremity of a full-... 70 6e-09
141emb|BX025156.1|CNS08RKO Single read from an extremity of a full-... 70 6e-09
142emb|BX022818.1|CNS08PRQ Single read from an extremity of a full-... 70 6e-09
143emb|BX022573.1|CNS08PKX Single read from an extremity of a full-... 70 6e-09
144emb|BX021274.1|CNS08OKU Single read from an extremity of a full-... 70 6e-09
145emb|BX020936.1|CNS08OBG Single read from an extremity of a full-... 70 6e-09
146emb|BX020450.1|CNS08NXY Single read from an extremity of a full-... 70 6e-09
147emb|BX020352.1|CNS08NV8 Single read from an extremity of a full-... 70 6e-09
148emb|BX019825.1|CNS08NGL Single read from an extremity of a full-... 70 6e-09
149emb|BX018864.1|CNS08MPW Single read from an extremity of a full-... 70 6e-09
150emb|BX016088.1|CNS08KKS Single read from an extremity of a full-... 70 6e-09
151emb|BX014705.1|CNS08JID Single read from an extremity of a full-... 70 6e-09
152emb|BX014550.1|CNS08JE2 Single read from an extremity of a full-... 70 6e-09
153emb|BX014495.1|CNS08JCJ Single read from an extremity of a full-... 70 6e-09
154emb|BX013937.1|CNS08IX1 Single read from an extremity of a full-... 70 6e-09
155emb|BX010574.1|CNS08GBM Single read from an extremity of a full-... 70 6e-09
156emb|BX008146.1|CNS08EG6 Single read from an extremity of a full-... 70 6e-09
157emb|BX006955.1|CNS08DJ3 Single read from an extremity of a full-... 70 6e-09
158emb|BX006592.1|CNS08D90 Single read from an extremity of a full-... 70 6e-09
159emb|BX005821.1|CNS08CNL Single read from an extremity of a full-... 70 6e-09
160ref|XM_318978.2| Anopheles gambiae str. PEST ENSANGP00000014802 ... 70 6e-09
161ref|XM_318977.2| Anopheles gambiae str. PEST ENSANGP00000023201 ... 70 6e-09
162gb|BC103130.1| Bos taurus eukaryotic translation initiation fact... 68 2e-08
163ref|NM_001034228.1| Bos taurus eukaryotic translation initiation... 68 2e-08
164ref|NM_198366.1| Danio rerio eukaryotic translation initiation f... 66 9e-08
165emb|BX028053.1|CNS08TT5 Single read from an extremity of a full-... 66 9e-08
166gb|BC048899.1| Danio rerio eukaryotic translation initiation fac... 66 9e-08
167ref|XM_684934.1| PREDICTED: Danio rerio similar to Eukaryotic tr... 66 9e-08
168gb|BC055242.1| Danio rerio zgc:63783, mRNA (cDNA clone MGC:63783... 64 4e-07
169emb|CR717504.2|CNS0GGKM Tetraodon nigroviridis full-length cDNA 64 4e-07
170gb|AY167671.1| Pisum sativum DEAD box RNA helicase mRNA, complet... 64 4e-07
171ref|NM_213451.1| Danio rerio zgc:63783 (zgc:63783), mRNA 64 4e-07
172ref|XM_697557.1| PREDICTED: Danio rerio hypothetical protein LOC... 64 4e-07
173emb|CR717967.2|CNS0GGXH Tetraodon nigroviridis full-length cDNA 62 1e-06
174emb|BX069140.1|CNS09PIG Single read from an extremity of a full-... 62 1e-06
175emb|BX059694.1|CNS09I82 Single read from an extremity of a full-... 62 1e-06
176emb|BX051892.1|CNS09C7C Single read from an extremity of a full-... 62 1e-06
177emb|BX027400.1|CNS08TB0 Single read from an extremity of a full-... 62 1e-06
178emb|BX019528.1|CNS08N8C Single read from an extremity of a full-... 62 1e-06
179emb|BX011160.1|CNS08GRW Single read from an extremity of a full-... 62 1e-06
180ref|XM_521164.1| PREDICTED: Pan troglodytes similar to eukaryoti... 60 6e-06
181ref|XM_511961.1| PREDICTED: Pan troglodytes LOC455218 (LOC455218... 60 6e-06
182ref|NM_001416.1| Homo sapiens eukaryotic translation initiation ... 60 6e-06
183gb|BT019881.1| Homo sapiens eukaryotic translation initiation fa... 60 6e-06
184gb|BT019880.1| Homo sapiens eukaryotic translation initiation fa... 60 6e-06
185gb|BT019879.1| Synthetic construct Homo sapiens eukaryotic trans... 60 6e-06
186gb|BC073752.1| Homo sapiens eukaryotic translation initiation fa... 60 6e-06
187ref|NM_144958.2| Mus musculus eukaryotic translation initiation ... 60 6e-06
188ref|XM_676193.1| Aspergillus nidulans FGSC A4 hypothetical prote... 60 6e-06
189gb|BC032613.1| Homo sapiens cDNA clone IMAGE:5555330, **** WARNI... 60 6e-06
190gb|BC032078.1| Homo sapiens eukaryotic translation initiation fa... 60 6e-06
191gb|BC012282.1| Mus musculus eukaryotic translation initiation fa... 60 6e-06
192gb|BC006380.1| Homo sapiens cDNA clone IMAGE:4099962, partial cds 60 6e-06
193emb|AL136362.10| Human DNA sequence from clone RP13-136L2 on chr... 60 6e-06
194emb|BX012572.1|CNS08HV4 Single read from an extremity of a full-... 60 6e-06
195emb|X03040.1|MMEIF4AL Mouse mRNA for initiation factor eIF-4A lo... 60 6e-06
196emb|X03039.1|MMEIF4AI Mouse mRNA for initiation factor eIF-4AI 60 6e-06
197gb|BC063812.1| Rattus norvegicus eukaryotic translation initiati... 60 6e-06
198gb|BC099392.1| Mus musculus eukaryotic translation initiation fa... 60 6e-06
199emb|AL646054.20| Mouse DNA sequence from clone RP23-157N11 on ch... 60 6e-06
200ref|NM_199372.1| Rattus norvegicus eukaryotic translation initia... 60 6e-06
201emb|CR860906.1| Pongo pygmaeus mRNA; cDNA DKFZp470B2433 (from cl... 60 6e-06
202emb|CR626851.1| full-length cDNA clone CS0DF019YF06 of Fetal bra... 60 6e-06
203emb|CR624603.1| full-length cDNA clone CS0DM001YP05 of Fetal liv... 60 6e-06
204emb|CR623219.1| full-length cDNA clone CL0BB009ZA08 of Neuroblas... 60 6e-06
205emb|CR623095.1| full-length cDNA clone CS0DF003YE17 of Fetal bra... 60 6e-06
206emb|CR622601.1| full-length cDNA clone CS0DF032YG04 of Fetal bra... 60 6e-06
207emb|CR621511.1| full-length cDNA clone CS0DH007YM23 of T cells (... 60 6e-06
208emb|CR621238.1| full-length cDNA clone CS0DA004YK05 of Neuroblas... 60 6e-06
209emb|CR620740.1| full-length cDNA clone CS0DA006YA19 of Neuroblas... 60 6e-06
210emb|CR619465.1| full-length cDNA clone CS0DH002YB19 of T cells (... 60 6e-06
211emb|CR619751.1| full-length cDNA clone CS0DF001YB06 of Fetal bra... 60 6e-06
212emb|CR618674.1| full-length cDNA clone CS0DK008YE05 of HeLa cell... 60 6e-06
213emb|CR617051.1| full-length cDNA clone CS0DH001YG02 of T cells (... 60 6e-06
214emb|CR614903.1| full-length cDNA clone CS0DF007YF10 of Fetal bra... 60 6e-06
215emb|CR612440.1| full-length cDNA clone CS0DA006YH16 of Neuroblas... 60 6e-06
216emb|CR610019.1| full-length cDNA clone CS0DA009YG22 of Neuroblas... 60 6e-06
217emb|CR608998.1| full-length cDNA clone CS0DI002YI16 of Placenta ... 60 6e-06
218emb|CR607537.1| full-length cDNA clone CS0DI058YE08 of Placenta ... 60 6e-06
219emb|CR605465.1| full-length cDNA clone CS0DF002YB24 of Fetal bra... 60 6e-06
220emb|CR604267.1| full-length cDNA clone CS0DH002YN10 of T cells (... 60 6e-06
221emb|CR603854.1| full-length cDNA clone CS0DH004YM20 of T cells (... 60 6e-06
222emb|CR603368.1| full-length cDNA clone CS0DI020YH17 of Placenta ... 60 6e-06
223emb|CR602368.1| full-length cDNA clone CS0DF036YA10 of Fetal bra... 60 6e-06
224emb|CR600480.1| full-length cDNA clone CS0DA009YG09 of Neuroblas... 60 6e-06
225emb|CR600142.1| full-length cDNA clone CS0CAP004YH19 of Thymus o... 60 6e-06
226emb|CR599522.1| full-length cDNA clone CS0DE008YL11 of Placenta ... 60 6e-06
227emb|CR599489.1| full-length cDNA clone CS0DI057YL14 of Placenta ... 60 6e-06
228emb|CR598780.1| full-length cDNA clone CS0DH005YE18 of T cells (... 60 6e-06
229emb|CR598002.1| full-length cDNA clone CS0DI068YH02 of Placenta ... 60 6e-06
230emb|CR596028.1| full-length cDNA clone CL0BA005ZH08 of Placenta ... 60 6e-06
231emb|CR592725.1| full-length cDNA clone CS0DI009YB15 of Placenta ... 60 6e-06
232dbj|AK135994.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 60 6e-06
233dbj|AK145508.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 60 6e-06
234dbj|AK145375.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 60 6e-06
235dbj|AK146424.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 60 6e-06
236dbj|AK144850.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 60 6e-06
237dbj|AK146464.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 60 6e-06
238dbj|AK152694.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 60 6e-06
239ref|XM_937591.1| PREDICTED: Homo sapiens similar to eukaryotic t... 60 6e-06
240ref|XM_943353.1| PREDICTED: Homo sapiens similar to eukaryotic t... 60 6e-06
241ref|XM_926537.1| PREDICTED: Homo sapiens similar to eukaryotic t... 60 6e-06
242ref|XM_931371.1| PREDICTED: Homo sapiens similar to eukaryotic t... 60 6e-06
243dbj|AK166674.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 60 6e-06
244dbj|AK152210.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 60 6e-06
245dbj|AK168780.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 60 6e-06
246dbj|AK168697.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 60 6e-06
247dbj|AK166572.1| Mus musculus 4 cells embryo 4 cells cDNA, RIKEN ... 60 6e-06
248dbj|AK166527.1| Mus musculus 4 days embryo whole body cDNA, RIKE... 60 6e-06
249dbj|AK166439.1| Mus musculus mammary gland RCB-0527 Jyg-MC(B) cD... 60 6e-06
250dbj|AK162017.1| Mus musculus 12 days embryo male wolffian duct i... 60 6e-06
251dbj|AK159643.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 60 6e-06
252dbj|AK167196.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 60 6e-06
253dbj|AK167205.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 60 6e-06
254dbj|AK167083.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 60 6e-06
255dbj|AK169279.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 60 6e-06
256dbj|AK167988.1| Mus musculus cDNA, RIKEN full-length enriched li... 60 6e-06
257dbj|AK167003.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 60 6e-06
258dbj|AK169156.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 60 6e-06
259dbj|AK169057.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 60 6e-06
260dbj|AK169030.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 60 6e-06
261dbj|AK169023.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 60 6e-06
262dbj|AB168447.1| Macaca fascicularis testis cDNA clone: QtsA-1228... 60 6e-06
263dbj|AK010644.1| Mus musculus ES cells cDNA, RIKEN full-length en... 60 6e-06
264dbj|AK077429.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 60 6e-06
265dbj|AK088124.1| Mus musculus 2 days neonate thymus thymic cells ... 60 6e-06
266emb|AL116647.1|CNS01DCF Botrytis cinerea strain T4 cDNA library 60 6e-06
267emb|AL113286.1|CNS01AR2 Botrytis cinerea strain T4 cDNA library 60 6e-06
268dbj|AK212197.1| Mus musculus cDNA, clone:Y2G0124C21, strand:plus... 60 6e-06
269dbj|AK204226.1| Mus musculus cDNA, clone:Y1G0147K22, strand:minu... 60 6e-06
270dbj|AK203603.1| Mus musculus cDNA, clone:Y1G0145I03, strand:minu... 60 6e-06
271dbj|AK190420.1| Mus musculus cDNA, clone:Y1G0102L05, strand:minu... 60 6e-06
272gb|AY888467.1| Synthetic construct Homo sapiens clone FLH007749.... 60 6e-06
273gb|AY888466.1| Synthetic construct Homo sapiens clone FLH007748.... 60 6e-06
274gb|AY891107.1| Synthetic construct Homo sapiens clone FLH007745.... 60 6e-06
275gb|AY891106.1| Synthetic construct Homo sapiens clone FLH007744.... 60 6e-06
276dbj|AK130082.1| Homo sapiens cDNA FLJ26572 fis, clone LNF05779, ... 60 6e-06
277gb|BC009585.1| Homo sapiens eukaryotic translation initiation fa... 60 6e-06
278dbj|D13748.1|HUM4AI Homo sapiens mRNA for eukaryotic initiation ... 60 6e-06
279gb|BC049915.1| Mus musculus eukaryotic translation initiation fa... 60 6e-06
280ref|XM_386034.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 58 2e-05
281ref|XM_567112.1| Cryptococcus neoformans var. neoformans JEC21 t... 58 2e-05
282gb|U13876.3| Caenorhabditis elegans cosmid F57B9, complete sequence 58 2e-05
283emb|BX060628.1|CNS09IY0 Single read from an extremity of a full-... 58 2e-05
284emb|BX026857.1|CNS08SVX Single read from an extremity of a full-... 58 2e-05
285gb|DQ443290.1| Bombyx mori eukaryotic translation initiation fac... 56 9e-05
286ref|XM_953328.1| Neurospora crassa OR74A EUKARYOTIC INITIATION F... 56 9e-05
287ref|XM_327705.1| Neurospora crassa OR74A EUKARYOTIC INITIATION F... 56 9e-05
288emb|CR733641.2|CNS0GSUW Tetraodon nigroviridis full-length cDNA 56 9e-05
289emb|CR727356.2|CNS0GO6A Tetraodon nigroviridis full-length cDNA 56 9e-05
290emb|CR723240.2|CNS0GKZY Tetraodon nigroviridis full-length cDNA 56 9e-05
291emb|CR704662.1|CNS0G6O2 Tetraodon nigroviridis full-length cDNA 56 9e-05
292emb|CR695759.2|CNS0FZSR Tetraodon nigroviridis full-length cDNA 56 9e-05
293emb|CR694040.2|CNS0FYH0 Tetraodon nigroviridis full-length cDNA 56 9e-05
294emb|CR685642.2|CNS0FRZQ Tetraodon nigroviridis full-length cDNA 56 9e-05
295emb|CR680509.2|CNS0FO15 Tetraodon nigroviridis full-length cDNA 56 9e-05
296emb|CR674054.2|CNS0FJ2K Tetraodon nigroviridis full-length cDNA 56 9e-05
297emb|CR670075.2|CNS0FG01 Tetraodon nigroviridis full-length cDNA 56 9e-05
298emb|CR667409.2|CNS0FDXZ Tetraodon nigroviridis full-length cDNA 56 9e-05
299emb|CR644829.2|CNS0EWIR Tetraodon nigroviridis full-length cDNA 56 9e-05
300emb|AL138822.13| Human DNA sequence from clone RP11-57H24 on chr... 56 9e-05
301emb|BX017199.1|CNS08LFN Single read from an extremity of a full-... 56 9e-05
302ref|NM_204549.1| Gallus gallus eukaryotic translation initiation... 56 9e-05
303emb|AJ720280.1| Gallus gallus mRNA for hypothetical protein, clo... 56 9e-05
304gb|AF515726.1| Gallus gallus translational eukaryotic inititatio... 56 9e-05
305gb|DQ150250.1| Bombyx mori translation initiation factor 4A mRNA... 56 9e-05
306ref|NG_002809.1| Homo sapiens eukaryotic translation initiation ... 56 9e-05
307gb|AC010129.3|AC010129 Homo sapiens BAC clone RP11-59N9 from Y, ... 56 9e-05
308ref|XM_459136.1| Debaryomyces hansenii CBS767 hypothetical prote... 54 3e-04
309gb|BC041252.1| Xenopus laevis eukaryotic translation initiation ... 54 3e-04
310emb|BX071863.1|CNS09RM3 Single read from an extremity of a full-... 54 3e-04
311emb|BX065078.1|CNS09MDM Single read from an extremity of a full-... 54 3e-04
312emb|BX061964.1|CNS09JZ4 Single read from an extremity of a full-... 54 3e-04
313emb|BX059730.1|CNS09I92 Single read from an extremity of a full-... 54 3e-04
314emb|BX057997.1|CNS09GWX Single read from an extremity of a full-... 54 3e-04
315emb|BX050558.1|CNS09B6A Single read from an extremity of a full-... 54 3e-04
316emb|BX045527.1|CNS097AJ Single read from an extremity of a full-... 54 3e-04
317emb|BX041914.1|CNS094I6 Single read from an extremity of a full-... 54 3e-04
318emb|BX041312.1|CNS0941G Single read from an extremity of a full-... 54 3e-04
319emb|BX036786.1|CNS090JQ Single read from an extremity of a full-... 54 3e-04
320emb|BX034607.1|CNS08YV7 Single read from an extremity of a full-... 54 3e-04
321emb|BX034343.1|CNS08YNV Single read from an extremity of a full-... 54 3e-04
322emb|BX029056.1|CNS08UL0 Single read from an extremity of a full-... 54 3e-04
323emb|BX025947.1|CNS08S6N Single read from an extremity of a full-... 54 3e-04
324emb|BX021158.1|CNS08OHM Single read from an extremity of a full-... 54 3e-04
325emb|BX012074.1|CNS08HHA Single read from an extremity of a full-... 54 3e-04
326emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 54 3e-04
327ref|XM_846759.1| PREDICTED: Canis familiaris similar to eukaryot... 52 0.001
328ref|XM_536623.2| PREDICTED: Canis familiaris similar to eukaryot... 52 0.001
329ref|XM_859411.1| PREDICTED: Canis familiaris similar to eukaryot... 52 0.001
330emb|BX063091.1|CNS09KUF Single read from an extremity of a full-... 52 0.001
331emb|BX062000.1|CNS09K04 Single read from an extremity of a full-... 52 0.001
332emb|BX046371.1|CNS097XZ Single read from an extremity of a full-... 52 0.001
333emb|BX045526.1|CNS097AI Single read from an extremity of a full-... 52 0.001
334emb|BX042603.1|CNS0951B Single read from an extremity of a full-... 52 0.001
335emb|BX041311.1|CNS0941F Single read from an extremity of a full-... 52 0.001
336emb|BX029879.1|CNS08V7V Single read from an extremity of a full-... 52 0.001
337emb|BX028052.1|CNS08TT4 Single read from an extremity of a full-... 52 0.001
338emb|BX026858.1|CNS08SVY Single read from an extremity of a full-... 52 0.001
339emb|BX025018.1|CNS08RGU Single read from an extremity of a full-... 52 0.001
340emb|BX020449.1|CNS08NXX Single read from an extremity of a full-... 52 0.001
341emb|BX019527.1|CNS08N8B Single read from an extremity of a full-... 52 0.001
342emb|BX010575.1|CNS08GBN Single read from an extremity of a full-... 52 0.001
343emb|BX006954.1|CNS08DJ2 Single read from an extremity of a full-... 52 0.001
344emb|AL603707.5| Mouse DNA sequence from clone RP23-422L16 on chr... 52 0.001
345dbj|AK135752.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 52 0.001
346dbj|AK202341.1| Mus musculus cDNA, clone:Y1G0141C22, strand:minu... 52 0.001
347dbj|AK191339.1| Mus musculus cDNA, clone:Y1G0105J02, strand:plus... 52 0.001
348ref|XM_553747.1| Anopheles gambiae str. PEST ENSANGP00000026980 ... 52 0.001
349gb|L36611.1|MUSELF4A5 Mus musculus protein synthesis initiation ... 52 0.001
350dbj|AB011595.1| Mus musculus gene for eIF4A, complete cds 52 0.001
351gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 50 0.005
352gb|AC161127.3| Pan troglodytes BAC clone CH251-452P2 from chromo... 50 0.005
353gb|AC002069.2| Homo sapiens BAC clone CTA-326K9 from 7, complete... 50 0.005
354emb|BX069141.1|CNS09PIH Single read from an extremity of a full-... 50 0.005
355emb|BX062173.1|CNS09K4X Single read from an extremity of a full-... 50 0.005
356emb|BX022817.1|CNS08PRP Single read from an extremity of a full-... 50 0.005
357emb|BX016787.1|CNS08L47 Single read from an extremity of a full-... 50 0.005
358emb|X69045.1|DMEIF4A D.melanogaster gene for eIF-4A eukaryotic t... 50 0.005
359gb|AY121623.1| Drosophila melanogaster GH17619 full insert cDNA 50 0.005
360dbj|AB224769.1| Aspergillus oryzae cDNA, contig sequence: AoEST1619 50 0.005
361ref|NM_164670.1| Drosophila melanogaster Eukaryotic initiation f... 50 0.005
362ref|NM_164669.1| Drosophila melanogaster Eukaryotic initiation f... 50 0.005
363ref|NM_164668.1| Drosophila melanogaster Eukaryotic initiation f... 50 0.005
364ref|NM_057247.3| Drosophila melanogaster Eukaryotic initiation f... 50 0.005
365gb|AY069283.1| Drosophila melanogaster GM14109 full length cDNA 50 0.005
366gb|AC092239.1|AC092239 Drosophila melanogaster, chromosome 2L, r... 50 0.005
367gb|AC092216.1|AC092216 Drosophila melanogaster, chromosome 2L, r... 50 0.005
368gb|AF145621.1|AF145621 Drosophila melanogaster clone GH03937 euk... 50 0.005
369gb|AE003612.2| Drosophila melanogaster chromosome 2L, section 21... 50 0.005
370gb|AC004758.1|AC004758 Drosophila melanogaster DNA sequence (P1s... 50 0.005
371ref|XM_522646.1| PREDICTED: Pan troglodytes similar to eukaryoti... 48 0.021
372gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, co... 48 0.021
373ref|XM_798681.1| Trypanosoma brucei TREU927 eukaryotic initiatio... 48 0.021
374ref|XM_815030.1| Trypanosoma cruzi strain CL Brener eukaryotic i... 48 0.021
375ref|XM_815285.1| Trypanosoma cruzi strain CL Brener eukaryotic i... 48 0.021
376emb|AJ245475.1|PCY245475 Plasmodium cynomolgi gene for RNA helic... 48 0.021
377emb|CR729762.2|CNS0GQ14 Tetraodon nigroviridis full-length cDNA 48 0.021
378emb|CR726855.2|CNS0GNSD Tetraodon nigroviridis full-length cDNA 48 0.021
379emb|CR680074.2|CNS0FNP2 Tetraodon nigroviridis full-length cDNA 48 0.021
380ref|XM_775814.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
381ref|XM_797009.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
382ref|XM_797001.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
383ref|XM_796988.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
384ref|XM_796975.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
385ref|XM_796963.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
386ref|XM_796944.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
387ref|XM_796927.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
388ref|XM_796901.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
389ref|XM_796869.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
390ref|XM_796828.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
391ref|XM_796778.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
392ref|XM_796720.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
393ref|XM_796654.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.021
394emb|BX071180.1|CNS09R34 Single read from an extremity of a full-... 48 0.021
395emb|BX066432.1|CNS09NF8 Single read from an extremity of a full-... 48 0.021
396emb|BX032724.1|CNS08XEW Single read from an extremity of a full-... 48 0.021
397emb|Y17288.1|PFA17288 Plasmodium falciparum gene encoding RNA he... 48 0.021
398gb|AY067670.1| Schmidtea mediterranea clone HB.14.9c unknown mRN... 48 0.021
399ref|XM_640825.1| Dictyostelium discoideum hypothetical protein (... 46 0.084
400ref|XM_713323.1| Candida albicans SC5314 putative translation in... 46 0.084
401ref|XM_713054.1| Candida albicans SC5314 putative translation in... 46 0.084
402gb|AY814786.1| Schistosoma japonicum SJCHGC06278 protein mRNA, c... 46 0.084
403ref|XM_756536.1| Ustilago maydis 521 hypothetical protein (UM054... 46 0.084
404ref|XM_504915.1| Yarrowia lipolytica CLIB122, YALI0F02695g predi... 46 0.084
405emb|BX059812.1|CNS09IBC Single read from an extremity of a full-... 46 0.084
406emb|BX059458.1|CNS09I1I Single read from an extremity of a full-... 46 0.084
407emb|BX057426.1|CNS09GH2 Single read from an extremity of a full-... 46 0.084
408emb|BX055630.1|CNS09F36 Single read from an extremity of a full-... 46 0.084
409emb|BX052194.1|CNS09CFQ Single read from an extremity of a full-... 46 0.084
410emb|BX047039.1|CNS098GJ Single read from an extremity of a full-... 46 0.084
411emb|BX044775.1|CNS096PN Single read from an extremity of a full-... 46 0.084
412emb|BX039496.1|CNS092N0 Single read from an extremity of a full-... 46 0.084
413emb|BX034459.1|CNS08YR3 Single read from an extremity of a full-... 46 0.084
414emb|BX034458.1|CNS08YR2 Single read from an extremity of a full-... 46 0.084
415emb|BX027282.1|CNS08T7Q Single read from an extremity of a full-... 46 0.084
416emb|BX022178.1|CNS08P9Y Single read from an extremity of a full-... 46 0.084
417emb|BX016260.1|CNS08KPK Single read from an extremity of a full-... 46 0.084
418emb|BX012352.1|CNS08HP0 Single read from an extremity of a full-... 46 0.084
419emb|BX008147.1|CNS08EG7 Single read from an extremity of a full-... 46 0.084
420emb|BX007853.1|CNS08E81 Single read from an extremity of a full-... 46 0.084
421emb|BX005626.1|CNS08CI6 Single read from an extremity of a full-... 46 0.084
422emb|Z99124.2|BSUB0021 Bacillus subtilis complete genome (section... 46 0.084
423emb|X80796.1|SPEIF4A S.pombe eIF-4A mRNA for translation initiat... 46 0.084
424emb|AL132828.1|SPAC1006 S.pombe chromosome I cosmid c1006 46 0.084
425ref|NM_001020283.1| Schizosaccharomyces pombe 972h- hypothetical... 46 0.084
426dbj|AK196626.1| Mus musculus cDNA, clone:Y1G0122G17, strand:plus... 46 0.084
427gb|L40627.1|YSPTIF1A Schizosaccharomyces pombe cell cycle contro... 46 0.084
428emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 46 0.084
429gb|U78759.1|DDU78759 Dictyostelium discoideum IfdA (ifdA) mRNA, ... 46 0.084
430dbj|D84472.1| Candida albicans DNA for translation initiation fa... 46 0.084
431dbj|D83026.1| Bacillus subtilis genome sequence covering lic-cel... 46 0.084
432ref|NM_112866.2| Arabidopsis thaliana ATP binding / ATP-dependen... 44 0.33
433ref|XM_956433.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.33
434ref|XM_326652.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.33
435ref|XM_675836.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 0.33
436ref|XM_447438.1| Candida glabrata CBS138 hypothetical protein (C... 44 0.33
437emb|CR732658.2|CNS0GS9J Tetraodon nigroviridis full-length cDNA 44 0.33
438emb|CR723590.2|CNS0GL9O Tetraodon nigroviridis full-length cDNA 44 0.33
439emb|CR717586.2|CNS0GGMW Tetraodon nigroviridis full-length cDNA 44 0.33
440ref|XM_773746.1| Giardia lamblia ATCC 50803 hypothetical protein... 44 0.33
441emb|AL512326.25| Human DNA sequence from clone RP11-345I18 on ch... 44 0.33
442gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 44 0.33
443emb|BX007972.1|CNS08EBC Single read from an extremity of a full-... 44 0.33
444emb|CR380955.1| Candida glabrata strain CBS138 chromosome I comp... 44 0.33
445emb|AL670009.1|NC123A4 Neurospora crassa DNA linkage group V cos... 44 0.33
446emb|AJ010456.1|ATH010456 Arabidopsis thaliana mRNA for DEAD box ... 44 0.33
447dbj|AB195137.1| Nasutitermes takasagoensis Nts9-1 mRNA for hypot... 44 0.33
448emb|CR602367.1| full-length cDNA clone CS0DF022YP15 of Fetal bra... 44 0.33
449gb|AE012157.1| Xanthomonas campestris pv. campestris str. ATCC 3... 44 0.33
450dbj|AK167906.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 44 0.33
451dbj|AK221050.1| Arabidopsis thaliana mRNA for RNA helicase, part... 44 0.33
452gb|AY050367.1| Arabidopsis thaliana AT3g19760/MMB12_21 mRNA, com... 44 0.33
453gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 44 0.33
454emb|BX823305.1|CNS0A4NP Arabidopsis thaliana Full-length cDNA Co... 44 0.33
455gb|DQ009672.1| Homo sapiens v-abl Abelson murine leukemia viral ... 44 0.33
456gb|AC073573.27| Homo sapiens 12 BAC RP11-1136G11 (Roswell Park C... 44 0.33
457gb|BT002207.1| Arabidopsis thaliana At3g19760/MMB12_21 mRNA, com... 44 0.33
458gb|AC007421.12|AC007421 Homo sapiens chromosome 17, clone hRPC.1... 44 0.33
459dbj|AB209593.1| Homo sapiens mRNA for CD68 antigen variant protein 44 0.33
460dbj|AP006691.1| Lotus japonicus genomic DNA, chromosome 3, clone... 44 0.33
461gb|AC016876.10| Homo sapiens chromosome 17, clone RP11-186B7, co... 44 0.33
462ref|NM_001034044.1| Bos taurus eukaryotic translation initiation... 42 1.3
463gb|BC049427.1| Danio rerio eukaryotic translation initiation fac... 42 1.3
464ref|XR_003578.1| PREDICTED: Mus musculus similar to eukaryotic t... 42 1.3
465ref|XR_003364.1| PREDICTED: Mus musculus similar to eukaryotic t... 42 1.3
466ref|XM_916144.2| PREDICTED: Mus musculus similar to eukaryotic t... 42 1.3
467ref|XM_484782.3| PREDICTED: Mus musculus similar to eukaryotic t... 42 1.3
468ref|XR_001969.1| PREDICTED: Mus musculus similar to eukaryotic t... 42 1.3
469gb|AC129773.4| Mus musculus BAC clone RP24-73D4 from chromosome ... 42 1.3
470gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 42 1.3
471gb|AC116999.2| Mus musculus BAC clone RP23-28L10 from 19, comple... 42 1.3
472ref|NM_201510.1| Danio rerio eukaryotic translation initiation f... 42 1.3
473emb|X87371.1|SCX731 S.cerevisiae DNA from chromosome X (cosmids ... 42 1.3
474emb|X58099.1|SCYURI S.cerevisiae YURI gene (3' end), TIF2 gene f... 42 1.3
475gb|BC103106.1| Bos taurus eukaryotic translation initiation fact... 42 1.3
476ref|NM_141531.2| Drosophila melanogaster eIF4AIII CG7483-RA (eIF... 42 1.3
477gb|AY089635.1| Drosophila melanogaster RE50350 full insert cDNA 42 1.3
478ref|XM_704278.1| PREDICTED: Danio rerio similar to Eukaryotic tr... 42 1.3
479gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.3
480ref|XM_623282.1| PREDICTED: Apis mellifera similar to translatio... 42 1.3
481ref|XM_395455.2| PREDICTED: Apis mellifera similar to Eukaryotic... 42 1.3
482ref|XM_623100.1| PREDICTED: Apis mellifera similar to Eukaryotic... 42 1.3
483gb|AC009539.6|AC009539 Drosophila melanogaster, chromosome 3R, r... 42 1.3
484ref|NM_209008.1| Eremothecium gossypii ACR253Cp (ACR253C), mRNA 42 1.3
485emb|Z49413.1|SCYJL138C S.cerevisiae chromosome X reading frame O... 42 1.3
486emb|Z28284.1|SCYKR059W S.cerevisiae chromosome XI reading frame ... 42 1.3
487emb|X12814.1|SCTIF2 Yeast TIF2 gene 42 1.3
488emb|X12813.1|SCTIF1 Yeast TIF1 gene 42 1.3
489gb|AE003678.3| Drosophila melanogaster chromosome 3R, section 16... 42 1.3
490gb|DQ331786.1| Synthetic construct Saccharomyces cerevisiae clon... 42 1.3
491gb|AY432777.1| Aedes aegypti ASAP ID: 34063 translation initiati... 40 5.2
492gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 5.2
493gb|AC139621.4| Artibeus jamaicensis clone 47H5, complete sequence 40 5.2
494gb|DQ440212.1| Aedes aegypti clone AET-2104 initiation factor EI... 40 5.2
495ref|XM_451255.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A05731g ... 40 5.2
496ref|XM_849758.1| PREDICTED: Canis familiaris similar to eukaryot... 40 5.2
497ref|XM_383816.1| Gibberella zeae PH-1 chromosome 2 predicted pro... 40 5.2
498ref|XM_569893.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 5.2
499emb|CR696590.1|CNS0G0FU Tetraodon nigroviridis full-length cDNA 40 5.2
500emb|AL158826.23| Human DNA sequence from clone RP11-244N20 on ch... 40 5.2

>emb|Z21510.1|TATRINF4A T.aestivum translation initiation factor 4A
          Length = 1715

 Score =  309 bits (156), Expect = 4e-81
 Identities = 223/246 (90%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            ||||||||| || ||||| |||||||| ||||| ||||||||||| ||||||||||||||
Sbjct: 1374 aaggtcggcaacgttggctgggagctcttcaatcaccacgttgtagaacttctggatgtc 1315

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             |||||||||||||||||||||||||| || ||||||||||| || ||||||||||||||
Sbjct: 1314 aaacagcatcctctcatcttcacgggtcacaaagttgatggccacacccttcctcccgaa 1255

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
            |||||||||||| || ||||||||  |||||||||| |||||||| || |||||||||||
Sbjct: 1254 ccgaccactacgcccgatgcgatgctggtagttctctggctgggttgggaggtcatagtt 1195

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| |||||||| |||||||||||||| || |||||||| |||||||||||
Sbjct: 1194 gatgacaagggacacttgctggacatcaataccacgagcaagcaggtcagtggtgatgag 1135

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1134 cacacg 1129



to top

>ref|XM_464146.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1715

 Score =  307 bits (155), Expect = 1e-80
 Identities = 231/257 (89%)
 Strand = Plus / Minus

                                                                        
Query: 130  ataatctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaac 189
            |||||||||| |||||| ||||| |||||||| |||||||| |||  ||| ||||| |||
Sbjct: 1444 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 1385

                                                                        
Query: 190  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 249
             |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 1384 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 1325

                                                                        
Query: 250  ttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggc 309
            ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1324 ttcctgccaaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtgggc 1265

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||||| || 
Sbjct: 1264 aggtcgtagttgatgacaagggagacttgctggacatcgataccacgagcaagcagatca 1205

                             
Query: 370  gtggtgatgagcacacg 386
            |||||||| ||||||||
Sbjct: 1204 gtggtgataagcacacg 1188



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  307 bits (155), Expect = 1e-80
 Identities = 231/257 (89%)
 Strand = Plus / Minus

                                                                           
Query: 130     ataatctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaac 189
               |||||||||| |||||| ||||| |||||||| |||||||| |||  ||| ||||| |||
Sbjct: 2560740 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 2560681

                                                                           
Query: 190     ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 249
                |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 2560680 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 2560621

                                                                           
Query: 250     ttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggc 309
               ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2560620 ttcctgccaaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtgggc 2560561

                                                                           
Query: 310     aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
               ||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||||| || 
Sbjct: 2560560 aggtcgtagttgatgacaagggagacttgctggacatcgataccacgagcaagcagatca 2560501

                                
Query: 370     gtggtgatgagcacacg 386
               |||||||| ||||||||
Sbjct: 2560500 gtggtgataagcacacg 2560484



to top

>dbj|AP005288.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1008_C03
          Length = 103297

 Score =  307 bits (155), Expect = 1e-80
 Identities = 231/257 (89%)
 Strand = Plus / Minus

                                                                         
Query: 130   ataatctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaac 189
             |||||||||| |||||| ||||| |||||||| |||||||| |||  ||| ||||| |||
Sbjct: 39523 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 39464

                                                                         
Query: 190   ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 249
              |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 39463 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 39404

                                                                         
Query: 250   ttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggc 309
             ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 39403 ttcctgccaaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtgggc 39344

                                                                         
Query: 310   aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
             ||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||||| || 
Sbjct: 39343 aggtcgtagttgatgacaagggagacttgctggacatcgataccacgagcaagcagatca 39284

                              
Query: 370   gtggtgatgagcacacg 386
             |||||||| ||||||||
Sbjct: 39283 gtggtgataagcacacg 39267



to top

>dbj|AK073620.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048E24, full
            insert sequence
          Length = 1714

 Score =  307 bits (155), Expect = 1e-80
 Identities = 231/257 (89%)
 Strand = Plus / Minus

                                                                        
Query: 130  ataatctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaac 189
            |||||||||| |||||| ||||| |||||||| |||||||| |||  ||| ||||| |||
Sbjct: 1443 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtcacattgtagaac 1384

                                                                        
Query: 190  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 249
             |||||||||||||||||||||||||||| || |||||||| ||||| ||||||||||||
Sbjct: 1383 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagttaatggcaactccc 1324

                                                                        
Query: 250  ttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggc 309
            ||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1323 ttcctgccaaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtgggc 1264

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||| ||||||||||||||||| |||||||| ||||| |||||||| || ||||| || 
Sbjct: 1263 aggtcgtagttgatgacaagggagacttgctggacatcgataccacgagcaagcagatca 1204

                             
Query: 370  gtggtgatgagcacacg 386
            |||||||| ||||||||
Sbjct: 1203 gtggtgataagcacacg 1187



to top

>gb|AY109160.1| Zea mays PCO074340 mRNA sequence
          Length = 1609

 Score =  285 bits (144), Expect = 5e-74
 Identities = 226/254 (88%)
 Strand = Plus / Minus

                                                                        
Query: 133  atctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttc 192
            ||||||| ||||||||||||||||||||| |||||||||| |  ||||||||| ||| ||
Sbjct: 1351 atctagagaaggtcggcgacattggccggcagctcctcaacggtcacgttgtagaacctc 1292

                                                                        
Query: 193  tggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttc 252
            |||||||| |||||||| | ||| || || ||||||||||||||||||||||| ||||||
Sbjct: 1291 tggatgtcaaacagcattcgctcgtcgtcgcgggtgacgaagttgatggcaacacccttc 1232

                                                                        
Query: 253  ctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcagg 312
            || || |||||||||||||| || ||||| |||||||||||||| |||||||||||||||
Sbjct: 1231 cttccaaaccgaccactacggccgatgcggtggaggtagttctctggctgggtcggcagg 1172

                                                                        
Query: 313  tcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtg 372
            || |||||||||||||| || || ||||| || || ||||||||||| ||||||||||||
Sbjct: 1171 tcgtagttgatgacaagtgagacctgctggacgtcgataccacgggcgagcaggtcggtg 1112

                          
Query: 373  gtgatgagcacacg 386
            ||||||||||||||
Sbjct: 1111 gtgatgagcacacg 1098



to top

>gb|BT017457.1| Zea mays clone EL01N0407C01.c mRNA sequence
          Length = 645

 Score =  278 bits (140), Expect = 1e-71
 Identities = 225/254 (88%)
 Strand = Plus / Minus

                                                                       
Query: 133 atctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttc 192
           ||||||| ||||||||||||||||||||| |||||||||| |  ||||||||| ||| ||
Sbjct: 416 atctagagaaggtcggcgacattggccggcagctcctcaacggtcacgttgtagaacctc 357

                                                                       
Query: 193 tggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttc 252
           |||||||| |||||||||| ||  || || ||||||||||||||||||||||| || |||
Sbjct: 356 tggatgtcaaacagcatccgcttgtcgtcgcgggtgacgaagttgatggcaacacctttc 297

                                                                       
Query: 253 ctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcagg 312
           || || |||||||||||||| || ||||| |||||||||||||| |||||||||||||||
Sbjct: 296 cttccaaaccgaccactacggccgatgcggtggaggtagttctctggctgggtcggcagg 237

                                                                       
Query: 313 tcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtg 372
           || |||||||||||||| || || ||||| || || ||||||||||| ||||||||||||
Sbjct: 236 tcgtagttgatgacaagtgagacctgctggacgtcgataccacgggcgagcaggtcggtg 177

                         
Query: 373 gtgatgagcacacg 386
           ||||||||||||||
Sbjct: 176 gtgatgagcacacg 163



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Plus

                                                                            
Query: 141      aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
                |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 28988293 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 28988352

                                                                            
Query: 201      gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
                 ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 28988353 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 28988412

                                                                            
Query: 261      ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
                 ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 28988413 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 28988472

                                                                            
Query: 321      gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
                |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 28988473 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 28988532

                      
Query: 381      cacacg 386
                ||||||
Sbjct: 28988533 cacacg 28988538



to top

>dbj|AP003726.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0596H10
          Length = 166570

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Plus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 3280 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 3339

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 3340 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 3399

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 3400 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 3459

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 3460 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 3519

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 3520 cacacg 3525



to top

>dbj|AP004278.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0468G03
          Length = 143918

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Plus

                                                                          
Query: 141    aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
              |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 138337 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 138396

                                                                          
Query: 201    gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
               ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 138397 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 138456

                                                                          
Query: 261    ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
               ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 138457 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 138516

                                                                          
Query: 321    gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
              |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 138517 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 138576

                    
Query: 381    cacacg 386
              ||||||
Sbjct: 138577 cacacg 138582



to top

>dbj|AK119234.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-H08, full
            insert sequence
          Length = 1754

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 1376 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 1317

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 1316 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 1257

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 1256 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 1197

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 1196 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 1137

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1136 cacacg 1131



to top

>dbj|AK105454.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-D03, full
            insert sequence
          Length = 1677

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 1378 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 1319

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 1318 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 1259

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 1258 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 1199

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 1198 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 1139

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1138 cacacg 1133



to top

>dbj|AK099927.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O09, full
            insert sequence
          Length = 1672

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 1372 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 1313

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 1312 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 1253

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 1252 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 1193

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 1192 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 1133

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1132 cacacg 1127



to top

>dbj|AK065230.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H10, full
            insert sequence
          Length = 1676

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 1377 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 1318

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 1317 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 1258

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 1257 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 1198

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 1197 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 1138

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1137 cacacg 1132



to top

>dbj|AK061696.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C12, full
            insert sequence
          Length = 1498

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 1199 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 1140

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 1139 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 1080

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 1079 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 1020

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 1019 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 960

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 959  cacacg 954



to top

>dbj|D12627.1|RICEIF4A Oryza sativa (japonica cultivar-group) mRNA for eukaryotic initiation
            factor 4A, complete cds
          Length = 1549

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 1247 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 1188

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 1187 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 1128

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 1127 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 1068

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 1067 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 1008

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1007 cacacg 1002



to top

>dbj|AB046416.1| Oryza sativa eIF4A-1 gene for eukaryotic initiation factor 4A,
            complete cds
          Length = 6250

 Score =  278 bits (140), Expect = 1e-71
 Identities = 219/246 (89%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| |||||||| ||||||||||| ||||| ||||| ||| ||||||||||
Sbjct: 5868 aaggtcagcgacgttggccggcagctcctcaatcaccacattgtagaacctctggatgtc 5809

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||||||||||||||||| |||||||| || ||||| |||||||| || ||||| || ||
Sbjct: 5808 aaacagcatcctctcatcgtcacgggtcacaaagttaatggcaacacctttcctaccaaa 5749

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 5748 acgaccactacgaccaatgcgatgcaggtagttctcaggttgggtcggcagatcatagtt 5689

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||||||||| || ||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 5688 gatgacaagggacacctgctggacatcaataccacgggcaagaaggtccgtggtaatgag 5629

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 5628 cacacg 5623



to top

>gb|BT016643.1| Zea mays clone Contig476 mRNA sequence
          Length = 1758

 Score =  270 bits (136), Expect = 3e-69
 Identities = 218/246 (88%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| ||||| || ||||||||||| | ||||||||| ||||||||||||||
Sbjct: 1358 aaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatgtc 1299

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
            ||||||||||| ||| || || ||||| || |||||||||||||| |||||||| |||||
Sbjct: 1298 gaacagcatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccgaa 1239

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| ||||| ||||| |||||||| || || ||||||||
Sbjct: 1238 acgaccactacgaccaatgcgatgcaggtaattctctggctgggtggggagatcatagtt 1179

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||| ||||| || ||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 1178 gatgaccagggacacctgctgaacatcaataccacgagcaagcaggtcggtggtgatgag 1119

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1118 cacacg 1113



to top

>gb|AY104966.1| Zea mays PCO149753 mRNA sequence
          Length = 1929

 Score =  270 bits (136), Expect = 3e-69
 Identities = 218/246 (88%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| ||||| || ||||||||||| | ||||||||| ||||||||||||||
Sbjct: 1515 aaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatgtc 1456

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
            ||||||||||| ||| || || ||||| || |||||||||||||| |||||||| |||||
Sbjct: 1455 gaacagcatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccgaa 1396

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| ||||| ||||| |||||||| || || ||||||||
Sbjct: 1395 acgaccactacgaccaatgcgatgcaggtaattctctggctgggtggggagatcatagtt 1336

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||| ||||| || ||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 1335 gatgaccagggacacctgctgaacatcaataccacgagcaagcaggtcggtggtgatgag 1276

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1275 cacacg 1270



to top

>gb|DQ013263.1| Pennisetum glaucum eukaryotic initiation factor 4A (eIF4A) mRNA,
            complete cds
          Length = 1245

 Score =  262 bits (132), Expect = 8e-67
 Identities = 217/246 (88%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| || || |||| ||| ||||||||||| |||||| |||| ||| ||||||||||
Sbjct: 1239 aaggtcagcaacgttggtcggcagctcctcaatcaccacgctgtagaacctctggatgtc 1180

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             ||| ||||||| ||||| |||||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1179 aaactgcatcctgtcatcatcacgggtcacaaagtttatggcaacacccttcctaccgaa 1120

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| |||||||||||||||||||| || || ||||||||
Sbjct: 1119 acgaccactacgaccaatgcgatgaaggtagttctcaggctgggtggggagatcatagtt 1060

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||| ||||| || ||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 1059 gatgaccagggacacctgctgaacatcaataccacgggcaagcaggtcggtggtgatgag 1000

                  
Query: 381  cacacg 386
             |||||
Sbjct: 999  aacacg 994



to top

>gb|AF079782.1|AF079782 Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial
           cds
          Length = 844

 Score =  262 bits (132), Expect = 8e-67
 Identities = 217/246 (88%)
 Strand = Plus / Minus

                                                                       
Query: 141 aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
           |||||| ||||| ||||| || ||||||||||| | ||||||||| ||||||||||||||
Sbjct: 642 aaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatgtc 583

                                                                       
Query: 201 gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
           ||||||||||| ||| || || ||||| || |||||||||||||| |||||||| |||||
Sbjct: 582 gaacagcatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccgaa 523

                                                                       
Query: 261 ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
            ||||||||||||||||| ||||| ||||| ||||| |||||||| || || ||||||||
Sbjct: 522 acgaccactacgaccaattcgatgcaggtaattctctggctgggtggggagatcatagtt 463

                                                                       
Query: 321 gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
           |||||| ||||| || ||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 462 gatgaccagggacacctgctgaacatcaataccacgagcaagcaggtcggtggtgatgag 403

                 
Query: 381 cacacg 386
           ||||||
Sbjct: 402 cacacg 397



to top

>gb|U17979.1|ZMU17979 Zea mays translation initiation factor eIF-4A mRNA, complete cds
          Length = 1441

 Score =  262 bits (132), Expect = 8e-67
 Identities = 223/254 (87%)
 Strand = Plus / Minus

                                                                        
Query: 133  atctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttc 192
            ||||||| ||||||||||||||||||||| |||||||||| |  ||||||||| ||| ||
Sbjct: 1312 atctagagaaggtcggcgacattggccggcagctcctcaacggtcacgttgtagaacctc 1253

                                                                        
Query: 193  tggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttc 252
            |||| ||| ||||  || | ||| || || ||||||||||||||||||||||| ||||||
Sbjct: 1252 tggacgtcaaacacgattcgctcgtcgtcgcgggtgacgaagttgatggcaacacccttc 1193

                                                                        
Query: 253  ctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcagg 312
            || || |||||||||||||| || ||||| |||||||||||||| |||||||||||||||
Sbjct: 1192 cttccaaaccgaccactacggccgatgcggtggaggtagttctctggctgggtcggcagg 1133

                                                                        
Query: 313  tcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtg 372
            || |||||||||||||| || || ||||| || || ||||||||||| ||||||||||||
Sbjct: 1132 tcgtagttgatgacaagtgagacctgctggacgtcgataccacgggcgagcaggtcggtg 1073

                          
Query: 373  gtgatgagcacacg 386
            ||||||||||||||
Sbjct: 1072 gtgatgagcacacg 1059



to top

>gb|AF007580.1|AF007580 Zea mays translation initiation factor (eIF-4A) mRNA, complete cds
          Length = 1752

 Score =  254 bits (128), Expect = 2e-64
 Identities = 216/246 (87%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| ||||| ||||| || ||||||||||| | ||||||||| ||||||||||||||
Sbjct: 1351 aaggtcagcgacgttggcaggcagctcctcaatcaacacgttgtagaacttctggatgtc 1292

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
            |||||  |||| ||| || || ||||| || |||||||||||||| |||||||| |||||
Sbjct: 1291 gaacacgatccgctcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccgaa 1232

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||||||||| ||||| ||||| |||||||| || || ||||||||
Sbjct: 1231 acgaccactacgaccaatgcgatgcaggtaattctctggctgggtggggagatcatagtt 1172

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||| ||||| || ||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 1171 gatgaccagggacacctgctgaacatcaataccacgagcaagcaggtcggtggtgatgag 1112

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1111 cacacg 1106



to top

>dbj|AB046415.1| Oryza sativa eIF4A-2 gene for eukaryotic initiation factor 4A,
            complete cds
          Length = 6767

 Score =  244 bits (123), Expect = 2e-61
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                        
Query: 130  ataatctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaac 189
            |||||||||| |||||| ||||| |||||||| |||||||| |||    | ||||| |||
Sbjct: 5558 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtgccattgtagaac 5499

                                                                        
Query: 190  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 249
             |||||||||||||||||||||||||||| || |||||||| ||| | ||||||||||||
Sbjct: 5498 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagataatggcaactccc 5439

                                                                        
Query: 250  ttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggc 309
            ||||| || |||||||||||||||||||||||||||||||||||||||| |||||| | |
Sbjct: 5438 ttcctgccaaaccgaccactacgaccaatgcgatggaggtagttctcagtctgggtggac 5379

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            || || |||||||||||||| || |||||||| ||||| ||||||||  | ||||| || 
Sbjct: 5378 agatcgtagttgatgacaagagagacttgctggacatcgataccacgatcaagcagatca 5319

                             
Query: 370  gtggtgatgagcacacg 386
            |||||||| ||||||||
Sbjct: 5318 gtggtgataagcacacg 5302



to top

>dbj|AB046414.1| Oryza sativa eIF4A-2 mRNA for eukaryotic initiation factor 4A,
            complete cds
          Length = 1705

 Score =  244 bits (123), Expect = 2e-61
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                        
Query: 130  ataatctagaaaaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaac 189
            |||||||||| |||||| ||||| |||||||| |||||||| |||    | ||||| |||
Sbjct: 1438 ataatctagagaaggtcagcgacgttggccggcagctcctcgatggtgccattgtagaac 1379

                                                                        
Query: 190  ttctggatgtcgaacagcatcctctcatcttcacgggtgacgaagttgatggcaactccc 249
             |||||||||||||||||||||||||||| || |||||||| ||| | ||||||||||||
Sbjct: 1378 ctctggatgtcgaacagcatcctctcatcatcgcgggtgacaaagataatggcaactccc 1319

                                                                        
Query: 250  ttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggc 309
            ||||| || |||||||||||||||||||||||||||||||||||||||| |||||| | |
Sbjct: 1318 ttcctgccaaaccgaccactacgaccaatgcgatggaggtagttctcagtctgggtggac 1259

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            || || |||||||||||||| || |||||||| ||||| ||||||||  | ||||| || 
Sbjct: 1258 agatcgtagttgatgacaagagagacttgctggacatcgataccacgatcaagcagatca 1199

                             
Query: 370  gtggtgatgagcacacg 386
            |||||||| ||||||||
Sbjct: 1198 gtggtgataagcacacg 1182



to top

>gb|BT016640.1| Zea mays clone Contig473 mRNA sequence
          Length = 1804

 Score =  222 bits (112), Expect = 6e-55
 Identities = 212/246 (86%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| || |||||||| || ||||||||||| | ||||||||| |||||||| |||||
Sbjct: 1367 aaggtcagcaacattggcaggcagctcctcaatcaacacgttgtagaacttctgaatgtc 1308

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             |||||||| |  || || || ||||| || |||||||||||||| |||||||| || ||
Sbjct: 1307 aaacagcatacgttcgtcgtcgcgggtcacaaagttgatggcaacacccttcctaccaaa 1248

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||| ||||| ||||||||||| |||||||| || || ||||||||
Sbjct: 1247 acgaccactacgaccaatacgatgcaggtagttctctggctgggtgggaagatcatagtt 1188

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||| ||||| || ||||| |||||||||||||| || |||||||| |||||||||||
Sbjct: 1187 gatgaccagggacacctgctgaacatcaataccacgagcaagcaggtcagtggtgatgag 1128

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1127 cacacg 1122



to top

>gb|U73459.1|ZMU73459 Zea mays translational initiation factor eIF-4A (tif-4A3) mRNA,
            complete cds
          Length = 1714

 Score =  214 bits (108), Expect = 2e-52
 Identities = 211/246 (85%)
 Strand = Plus / Minus

                                                                        
Query: 141  aaggtcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtc 200
            |||||| || |||||||| || ||||||||||| | ||||||||| |||||||| |||||
Sbjct: 1347 aaggtcagcaacattggcaggcagctcctcaatcaacacgttgtagaacttctgaatgtc 1288

                                                                        
Query: 201  gaacagcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaa 260
             |||||||| |  || |  || ||||| || |||||||||||||| |||||||| || ||
Sbjct: 1287 aaacagcatacgttcgttgtcgcgggtcacaaagttgatggcaacacccttcctaccaaa 1228

                                                                        
Query: 261  ccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagtt 320
             ||||||||||||||||| ||||| ||||||||||| |||||||| || || ||||||||
Sbjct: 1227 acgaccactacgaccaatacgatgcaggtagttctctggctgggtgggaagatcatagtt 1168

                                                                        
Query: 321  gatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgag 380
            |||||| ||||| || ||||| |||||||||||||| || |||||||| |||||||||||
Sbjct: 1167 gatgaccagggacacctgctgaacatcaataccacgagcaagcaggtcagtggtgatgag 1108

                  
Query: 381  cacacg 386
            ||||||
Sbjct: 1107 cacacg 1102



to top

>gb|AY158704.1| Apium graveolens var. dulce translation initition factor eIF4A
           mRNA, partial cds
          Length = 539

 Score =  178 bits (90), Expect = 9e-42
 Identities = 199/236 (84%)
 Strand = Plus / Minus

                                                                       
Query: 151 acattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatc 210
           |||||||| || | ||||||||  || || ||||| |||||||| ||||| |||||||||
Sbjct: 536 acattggctggcaactcctcaactactacattgtaaaacttctgtatgtcaaacagcatc 477

                                                                       
Query: 211 ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 270
           || ||||| ||   ||| || || || || ||||| || ||||| || || |||||||||
Sbjct: 476 ctatcatcatccttggtcacaaaattaattgcaacacctttccttccaaatcgaccacta 417

                                                                       
Query: 271 cgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatgacaagg 330
           || ||||| ||||| ||||| ||||| || ||||| || || ||||||||||||||||| 
Sbjct: 416 cgcccaatacgatgaaggtaattctctggttgggttgggagatcatagttgatgacaagt 357

                                                                   
Query: 331 ganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           || ||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 356 gacacttgctgcacatcaataccacgggccagcaggtcagtggtgatgagcacacg 301



to top

>gb|BT013166.1| Lycopersicon esculentum clone 134229F, mRNA sequence
          Length = 1603

 Score =  170 bits (86), Expect = 2e-39
 Identities = 198/236 (83%)
 Strand = Plus / Minus

                                                                        
Query: 151  acattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatc 210
            |||||||| ||||||||||| || || |||||||| ||||| || ||||| || ||||||
Sbjct: 1363 acattggctgggagctcctcgattacgacgttgtaaaacttttgaatgtcaaaaagcatc 1304

                                                                        
Query: 211  ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 270
            || ||||| ||   ||| || |||||||| ||||| |||||||| || || || ||||||
Sbjct: 1303 ctttcatcatccttggtaacaaagttgatagcaacacccttccttccaaatcgtccacta 1244

                                                                        
Query: 271  cgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatgacaagg 330
            |||||||| ||||| |||||||| || || || || ||||||||||||||||||||||||
Sbjct: 1243 cgaccaatacgatgcaggtagttttctggttgagttggcaggtcatagttgatgacaagg 1184

                                                                    
Query: 331  ganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            || ||||| || || ||||||||||| || || || ||||||||||| ||||||||
Sbjct: 1183 gagacttgttggacgtcaataccacgagcaaggagatcggtggtgataagcacacg 1128



to top

>emb|X61205.1|NPNEIF4A2 N. plumbaginifolia NeIF-4A2 mRNA for nicotiana eukaryotic translation
            initiation factor 4A
          Length = 1368

 Score =  157 bits (79), Expect = 3e-35
 Identities = 135/154 (87%)
 Strand = Plus / Minus

                                                                        
Query: 233  agttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagt 292
            ||||||| ||||| |||||||| || || || |||||||||||||| ||||| | |||||
Sbjct: 1260 agttgatagcaacacccttccttccaaaacgtccactacgaccaatacgatgcaagtagt 1201

                                                                        
Query: 293  tctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatac 352
            |||| ||||| ||||| ||||||||||| || |||||||| |||||||||||||||||||
Sbjct: 1200 tctctggctgagtcggaaggtcatagttaatcacaagggaaacttgctgcacatcaatac 1141

                                              
Query: 353  cacgggccagcaggtcggtggtgatgagcacacg 386
            |||| ||||| || || |||||||||||||||||
Sbjct: 1140 cacgtgccagaagatcagtggtgatgagcacacg 1107



to top

>emb|X79137.1|NT4A7 N.tabacum NeIF-4A7 mRNA
          Length = 1634

 Score =  153 bits (77), Expect = 5e-34
 Identities = 139/160 (86%)
 Strand = Plus / Minus

                                                                        
Query: 227  tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 286
            |||| |||||||| ||||| |||||||| || || || |||||||||||||| ||||| |
Sbjct: 1255 tgacaaagttgatagcaacacccttccttccaaatcgtccactacgaccaatacgatgca 1196

                                                                        
Query: 287  ggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacat 346
            |||||||||| ||||| || || ||||||||||| || |||||||| ||||||||||| |
Sbjct: 1195 ggtagttctctggctgagttggaaggtcatagttaatcacaagggaaacttgctgcacgt 1136

                                                    
Query: 347  caataccacgggccagcaggtcggtggtgatgagcacacg 386
            |||||||||| ||||| || || |||||||||||||||||
Sbjct: 1135 caataccacgtgccagaagatcagtggtgatgagcacacg 1096



to top

>emb|X79009.1|NTEIF4A1 N.tabacum eIF-4A10 mRNA
          Length = 1622

 Score =  151 bits (76), Expect = 2e-33
 Identities = 200/242 (82%)
 Strand = Plus / Minus

                                                                        
Query: 145  tcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaac 204
            ||||| |||||||| || | |||||| ||||| || || || |||||||| |||||  | 
Sbjct: 1328 tcggccacattggctggcaactcctcgatgacaacattataaaacttctgaatgtcagaa 1269

                                                                        
Query: 205  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccga 264
            |||||||| ||||| ||    ||||| |||||||| ||||| |||||||| || || || 
Sbjct: 1268 agcatcctttcatcatcctttgtgacaaagttgatagcaacacccttccttccaaaacgt 1209

                                                                        
Query: 265  ccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatg 324
            |||||||||||||| ||||| || |||||||| ||||| || || ||||| ||||| || 
Sbjct: 1208 ccactacgaccaatacgatgcagatagttctctggctgagttggaaggtcgtagttaatc 1149

                                                                        
Query: 325  acaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcaca 384
            |||||||| ||||||||||| ||||||||||| ||||| || || |||||||||||||||
Sbjct: 1148 acaagggaaacttgctgcacgtcaataccacgcgccagaagatcagtggtgatgagcaca 1089

              
Query: 385  cg 386
            ||
Sbjct: 1088 cg 1087



to top

>emb|X79141.1|NT4A14 N.tabacum NeIF-4A14 mRNA
          Length = 1677

 Score =  151 bits (76), Expect = 2e-33
 Identities = 200/242 (82%)
 Strand = Plus / Minus

                                                                        
Query: 145  tcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaac 204
            ||||| |||||||| || | |||||| || || || ||||| ||||| || ||||| || 
Sbjct: 1399 tcggccacattggctggcaactcctcgattacaacattgtaaaacttttgaatgtcaaaa 1340

                                                                        
Query: 205  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccga 264
            |||||||| || || ||    ||||| |||||||| ||||| ||||| || || || || 
Sbjct: 1339 agcatcctttcgtcatcctttgtgacaaagttgatagcaacaccctttcttccaaatcgt 1280

                                                                        
Query: 265  ccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatg 324
            ||||||||||| || ||||| ||||||||||| ||||| || || ||||||||||| || 
Sbjct: 1279 ccactacgaccgatacgatgcaggtagttctctggctgagtaggaaggtcatagttaatc 1220

                                                                        
Query: 325  acaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcaca 384
            |||||||| ||||||||||||||||||||||||||||  || || |||||||||||||||
Sbjct: 1219 acaagggaaacttgctgcacatcaataccacgggccaaaagatcagtggtgatgagcaca 1160

              
Query: 385  cg 386
            ||
Sbjct: 1159 cg 1158



to top

>emb|X79008.1|NTEIF4A1D N.tabacum eIF-4A10 gene
          Length = 4217

 Score =  151 bits (76), Expect = 2e-33
 Identities = 200/242 (82%)
 Strand = Plus / Minus

                                                                        
Query: 145  tcggcgacattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaac 204
            ||||| |||||||| || | |||||| ||||| || || || |||||||| |||||  | 
Sbjct: 3951 tcggccacattggctggcaactcctcgatgacaacattataaaacttctgaatgtcagaa 3892

                                                                        
Query: 205  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccga 264
            |||||||| ||||| ||    ||||| |||||||| ||||| |||||||| || || || 
Sbjct: 3891 agcatcctttcatcatcctttgtgacaaagttgatagcaacacccttccttccaaaacgt 3832

                                                                        
Query: 265  ccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatg 324
            |||||||||||||| ||||| || |||||||| ||||| || || ||||| ||||| || 
Sbjct: 3831 ccactacgaccaatacgatgcagatagttctctggctgagttggaaggtcgtagttaatc 3772

                                                                        
Query: 325  acaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcaca 384
            |||||||| ||||||||||| ||||||||||| ||||| || || |||||||||||||||
Sbjct: 3771 acaagggaaacttgctgcacgtcaataccacgcgccagaagatcagtggtgatgagcaca 3712

              
Query: 385  cg 386
            ||
Sbjct: 3711 cg 3710



to top

>emb|X79135.1|NT4A9 N.tabacum NeIF-4A9 mRNA
          Length = 1598

 Score =  139 bits (70), Expect = 7e-30
 Identities = 194/236 (82%)
 Strand = Plus / Minus

                                                                        
Query: 151  acattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatc 210
            ||||| || |||||||||||||| ||||| ||||| ||| |||| |||||  ||||||| 
Sbjct: 1314 acatttgctgggagctcctcaatcaccacattgtaaaacctctgaatgtcagacagcatt 1255

                                                                        
Query: 211  ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 270
            |||||||| || | ||| ||||||||||| | ||| |||||||| || ||||  ||||||
Sbjct: 1254 ctctcatcgtcgctggttacgaagttgattgaaacacccttcctaccaaacctcccacta 1195

                                                                        
Query: 271  cgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatgacaagg 330
            || ||||| ||||| ||||| |||||||| || || || || ||||| || |||||||||
Sbjct: 1194 cgtccaatacgatgaaggtaattctcaggttgagtggggagatcataatttatgacaagg 1135

                                                                    
Query: 331  ganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            || ||||| || |||||||| || | |||||  || |||||||||||||| |||||
Sbjct: 1134 gaaacttgttggacatcaattcctctggccaaaagatcggtggtgatgagaacacg 1079



to top

>gb|DQ122921.1| Chlamydomonas incerta eukaryotic translation initiation factor
           mRNA, partial cds
          Length = 823

 Score =  125 bits (63), Expect = 1e-25
 Identities = 134/158 (84%)
 Strand = Plus / Minus

                                                                       
Query: 229 acgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggagg 288
           ||||||||||||||||| ||||| |  ||||| || ||    ||||| ||||| || |||
Sbjct: 353 acgaagttgatggcaacacccttgcggccgaagcggcccgagcgaccgatgcggtgcagg 294

                                                                       
Query: 289 tagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatca 348
           |||||||| |||||||| |||||||| ||||||||||| || || || |||||||| |||
Sbjct: 293 tagttctcgggctgggtgggcaggtcgtagttgatgaccagcgacacctgctgcacgtca 234

                                                 
Query: 349 ataccacgggccagcaggtcggtggtgatgagcacacg 386
           || || ||||||||||||||||||||||| ||||||||
Sbjct: 233 atgccgcgggccagcaggtcggtggtgatcagcacacg 196



to top

>gb|AY040227.1| Elaeis oleifera eukaryotic translation initiation factor 4A-1 mRNA,
           partial cds
          Length = 785

 Score =  121 bits (61), Expect = 2e-24
 Identities = 185/227 (81%)
 Strand = Plus / Minus

                                                                       
Query: 160 gggagctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatct 219
           ||||||||||| || ||||||||||| ||| |||| || || |||| |||||| ||||| 
Sbjct: 499 gggagctcctcgatcaccacgttgtaaaacctctgaatatcaaacaacatcctttcatca 440

                                                                       
Query: 220 tcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatg 279
           ||||| ||||| |||||||| || || |||||||| || || || ||||| || ||||| 
Sbjct: 439 tcacgagtgacaaagttgatcgccacacccttccttccaaaacgtccacttcgtccaatt 380

                                                                       
Query: 280 cgatggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgc 339
           || || || |||||||| || ||||| ||||| ||||| || ||||| || || ||||||
Sbjct: 379 cggtgaagatagttctctggttgggttggcagatcataatttatgaccagcgagacttgc 320

                                                          
Query: 340 tgcacatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           || |||||||||||||| || || || || |||||||| || |||||
Sbjct: 319 tgaacatcaataccacgagcaaggagatcagtggtgataagaacacg 273



to top

>gb|AF180356.1|AF180356 Brassica oleracea isolate B265 EIF4A protein (EIF4A) gene, partial
            cds; putative protein gene, complete cds; and casein
            kinase I-like protein (CK1b) gene, partial cds
          Length = 6639

 Score =  119 bits (60), Expect = 7e-24
 Identities = 178/218 (81%)
 Strand = Plus / Minus

                                                                        
Query: 169  tcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtg 228
            |||| |||||| ||||| |||||||| || ||  ||| |||||||||||| |||   || 
Sbjct: 1326 tcaacgaccacattgtaaaacttctgaatatccgacaacatcctctcatcatcagttgtc 1267

                                                                        
Query: 229  acgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggagg 288
            | ||||||||| || |||||||||||||| ||||  ||||| |  ||||| || || |||
Sbjct: 1266 atgaagttgatcgccactcccttcctcccaaaccttccacttcttccaatacggtgaagg 1207

                                                                        
Query: 289  tagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatca 348
            ||||||||||| ||||| || |||||| |||| || || || || |||||||| ||||||
Sbjct: 1206 tagttctcaggttgggttgggaggtcaaagttaatcaccagagacacttgctgaacatca 1147

                                                  
Query: 349  ataccacgggccagcaggtcggtggtgatgagcacacg 386
            |||||||| || || ||||| ||||||||||| |||||
Sbjct: 1146 ataccacgtgcaaggaggtcagtggtgatgagtacacg 1109



to top

>ref|NM_112246.2| Arabidopsis thaliana EIF4A1; ATP-dependent helicase AT3G13920
            (EIF4A1) transcript variant AT3G13920.1 mRNA, complete
            cds
          Length = 1761

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1223

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1222 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1163

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1162 cgagctaagaggtcagtggtgatgagaacacg 1131



to top

>emb|X65052.1|ATTIF4A1 A.thaliana mRNA for eukaryotic translation initiation factor 4A-1
          Length = 1736

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1348 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1289

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1288 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1229

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1228 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1169

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1168 cgagctaagaggtcagtggtgatgagaacacg 1137



to top

>gb|BT000655.1| Arabidopsis thaliana clone RAFL07-07-D14 (R10830) putative eukaryotic
            initiation factor 4A (At3g13920) mRNA, complete cds
          Length = 1702

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1223

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1222 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1163

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1162 cgagctaagaggtcagtggtgatgagaacacg 1131



to top

>emb|X79138.1|NT4A15 N.tabacum NeIF-4A15 mRNA
          Length = 1644

 Score =  115 bits (58), Expect = 1e-22
 Identities = 182/224 (81%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||| || |||||||| ||| |||| || ||  |||||||||||||||| || 
Sbjct: 1293 agctcctcaataacaacgttgtaaaacctctgaatatcagacagcatcctctcatcatcc 1234

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
               || |||||||||||||| || |||||||| || ||||| |||||||| |||||||||
Sbjct: 1233 tttgtaacgaagttgatggccacacccttcctaccaaaccgtccactacgtccaatgcga 1174

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || || || ||||||||||| || || || ||| |||| || || ||||| ||||| || 
Sbjct: 1173 tgaagataattctcaggctgcgtgggaagatcaaagtttataactagggagacttgttgg 1114

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            |||||||| || |||||||  || || || |||||||| |||||
Sbjct: 1113 acatcaattcctcgggccaaaagatcagtagtgatgagaacacg 1070



to top

>emb|X79139.1|NT4A6 N.tabacum NeIF-4A6 mRNA
          Length = 760

 Score =  115 bits (58), Expect = 1e-22
 Identities = 191/236 (80%)
 Strand = Plus / Minus

                                                                       
Query: 151 acattggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatc 210
           |||||||| || ||||||||||| || || || || ||||| || ||||| || ||||||
Sbjct: 749 acattggctggcagctcctcaatcacgacattataaaacttttgtatgtcaaaaagcatc 690

                                                                       
Query: 211 ctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccacta 270
           || || || ||   |||||| |||||||| | ||| |||||||| || || || ||||||
Sbjct: 689 ctttcgtcatccttggtgacaaagttgatagaaacacccttccttccaaatcggccacta 630

                                                                       
Query: 271 cgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatgacaagg 330
           |||||||| ||||| | |||||| || || || |||||||| || ||||| || ||||||
Sbjct: 629 cgaccaatacgatgcaagtagttttctggttgagtcggcagatcgtagttaataacaagg 570

                                                                   
Query: 331 ganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           || |||||||| |||||||||||||| || || || || || ||||| ||||||||
Sbjct: 569 gagacttgctgaacatcaataccacgagcaaggagatcagtagtgataagcacacg 514



to top

>gb|AY091304.1| Arabidopsis thaliana putative eukaryotic initiation factor 4A
            (At3g13920) mRNA, complete cds
          Length = 1270

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1199 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1140

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1139 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1080

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1079 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1020

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1019 cgagctaagaggtcagtggtgatgagaacacg 988



to top

>gb|AY050957.1| Arabidopsis thaliana putative Eukaryotic initiation factor 4A
            (At3g13920) mRNA, complete cds
          Length = 1713

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1335 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1276

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1275 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1216

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1215 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1156

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1155 cgagctaagaggtcagtggtgatgagaacacg 1124



to top

>emb|AJ298137.1|ATH298137 Arabidopsis thaliana eIF-4A1 gene for translation initiation factor
            eIF-4A1, exons 1-5 and gus gene for beta-glucuronidase
          Length = 11509

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 3171 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 3112

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 3111 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 3052

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 3051 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 2992

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 2991 cgagctaagaggtcagtggtgatgagaacacg 2960



to top

>gb|AY139981.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1713

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1341 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1282

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1281 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1222

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1221 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1162

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1161 cgagctaagaggtcagtggtgatgagaacacg 1130



to top

>gb|AY098962.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, complete cds
          Length = 1239

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1199 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1140

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1139 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1080

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1079 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1020

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1019 cgagctaagaggtcagtggtgatgagaacacg 988



to top

>gb|AY081287.1| Arabidopsis thaliana eukaryotic translation initiation factor
            (At3g13920) mRNA, complete cds
          Length = 1611

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1223

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1222 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1163

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1162 cgagctaagaggtcagtggtgatgagaacacg 1131



to top

>gb|AY052344.1| Arabidopsis thaliana AT3g13920/MDC16_4 mRNA, complete cds
          Length = 1620

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1331 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1272

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1271 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1212

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1211 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1152

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1151 cgagctaagaggtcagtggtgatgagaacacg 1120



to top

>emb|BX826218.1|CNS0A6AB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL91ZF06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 965

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 175 accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
           ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 594 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 535

                                                                       
Query: 235 ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
           ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 534 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 475

                                                                       
Query: 295 tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
           || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 474 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 415

                                           
Query: 355 cgggccagcaggtcggtggtgatgagcacacg 386
           || || |  ||||| ||||||||||| |||||
Sbjct: 414 cgagctaagaggtcagtggtgatgagaacacg 383



to top

>gb|AY086907.1| Arabidopsis thaliana clone 29310 mRNA, complete sequence
          Length = 1613

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1342 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1283

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1282 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1223

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1222 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1163

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1162 cgagctaagaggtcagtggtgatgagaacacg 1131



to top

>dbj|AB019229.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MDC16
          Length = 84294

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Plus

                                                                         
Query: 175   accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
             ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 17985 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 18044

                                                                         
Query: 235   ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
             ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 18045 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 18104

                                                                         
Query: 295   tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
             || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 18105 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 18164

                                             
Query: 355   cgggccagcaggtcggtggtgatgagcacacg 386
             || || |  ||||| ||||||||||| |||||
Sbjct: 18165 cgagctaagaggtcagtggtgatgagaacacg 18196



to top

>emb|AJ298138.1|ATH298138 Arabidopsis thaliana mRNA for translation initiation factor eIF-4A1
            (eIF-4A1 gene)
          Length = 1709

 Score =  115 bits (58), Expect = 1e-22
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                        
Query: 175  accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
            ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 1325 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 1266

                                                                        
Query: 235  ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
            ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||||
Sbjct: 1265 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagttc 1206

                                                                        
Query: 295  tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
            || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 1205 tctggctgagttgggagatcgaagttgataaccagggagacttgttggacatcaatacca 1146

                                            
Query: 355  cgggccagcaggtcggtggtgatgagcacacg 386
            || || |  ||||| ||||||||||| |||||
Sbjct: 1145 cgagctaagaggtcagtggtgatgagaacacg 1114



to top

>emb|X79136.1|NT4A11 N.tabacum NeIF-4A11 mRNA
          Length = 1573

 Score =  107 bits (54), Expect = 3e-20
 Identities = 181/224 (80%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||| || || || || ||||| || ||||| || |||||||| ||||| || 
Sbjct: 1235 agctcctcaatcacgacattataaaacttttgtatgtcaaaaagcatcctttcatcatcc 1176

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
              |||||| |||||||| | ||| |||||||| || || || |||||| ||||||| |||
Sbjct: 1175 ttggtgacaaagttgatagaaacacccttccttccaaatcggccactatgaccaatacga 1116

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || |||||||| || || || |||||||| || || || || |||||||| |||||||| 
Sbjct: 1115 tgcaggtagttttctggttgagtcggcagatcgtaattaataacaagggagacttgctgg 1056

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            |||||||||||||| || || || || || ||||| ||||||||
Sbjct: 1055 acatcaataccacgagcaaggagatcagtagtgataagcacacg 1012



to top

>emb|BX825413.1|CNS0A6HS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL35ZD12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 620

 Score =  107 bits (54), Expect = 3e-20
 Identities = 172/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 175 accacgttgtanaacttctggatgtcgaacagcatcctctcatcttcacgggtgacgaag 234
           ||||| ||||| || ||||| || || ||||||||||||||||| |||||||| ||||| 
Sbjct: 273 accacattgtagaatttctgaatatcaaacagcatcctctcatcatcacgggtcacgaaa 214

                                                                       
Query: 235 ttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttc 294
           ||||| ||||| ||||| ||||||||||  ||||| |  || || || || |||||||| 
Sbjct: 213 ttgatcgcaacaccctttctcccgaaccttccacttcttccgatacggtgaaggtagtta 154

                                                                       
Query: 295 tcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaatacca 354
           || ||||| || || || ||  ||||||| || ||||| ||||| || ||||||||||||
Sbjct: 153 tctggctgagttgggagatcgaagttgataaccagggagacttgttgtacatcaatacca 94

                                           
Query: 355 cgggccagcaggtcggtggtgatgagcacacg 386
           || || |  ||||| ||||||||||| |||||
Sbjct: 93  cgagctaagaggtcagtggtgatgagaacacg 62



to top

>ref|NM_001035616.1| Arabidopsis thaliana EIF4A1; ATP-dependent helicase AT3G13920
            (EIF4A1) transcript variant AT3G13920.2 mRNA, complete
            cds
          Length = 1764

 Score =  101 bits (51), Expect = 2e-18
 Identities = 149/182 (81%)
 Strand = Plus / Minus

                                                                        
Query: 205  agcatcctctcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccga 264
            |||||||||||||| |||||||| ||||| ||||| ||||| ||||| ||||||||||  
Sbjct: 1355 agcatcctctcatcatcacgggtcacgaaattgatcgcaacaccctttctcccgaacctt 1296

                                                                        
Query: 265  ccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatg 324
            ||||| |  || || || || ||||||||||| ||||| || || || ||  ||||||| 
Sbjct: 1295 ccacttcttccgatacggtgaaggtagttctctggctgagttgggagatcgaagttgata 1236

                                                                        
Query: 325  acaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcaca 384
            || ||||| ||||| || |||||||||||||| || |  ||||| ||||||||||| |||
Sbjct: 1235 accagggagacttgttggacatcaataccacgagctaagaggtcagtggtgatgagaaca 1176

              
Query: 385  cg 386
            ||
Sbjct: 1175 cg 1174



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                           
Query: 226     gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgg 285
               |||||||||||||||||||| ||||| |  ||||| ||||||| |||||| || || || 
Sbjct: 3870276 gtgacgaagttgatggcaacacccttacgaccgaaacgaccaccacgaccgatacggtga 3870217

                                                                           
Query: 286     aggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcaca 345
               | |||||||||| | | ||  |||||||| ||||||||||||||||| || ||||| || 
Sbjct: 3870216 atgtagttctcacggttggcaggcaggtcgtagttgatgacaagggacacctgctggacg 3870157

                                                        
Query: 346     tcaataccacgggccagcaggtcggtggtgatgagcacacg 386
               || |||||||||||||  ||||| |||| ||| || |||||
Sbjct: 3870156 tcgataccacgggccaaaaggtcagtggcgatcaggacacg 3870116



to top

>dbj|AB224877.1| Aspergillus oryzae cDNA, contig sequence: AoEST1727
          Length = 791

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 114/136 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgg 285
           |||||||||||||||||||| ||||| |  ||||| ||||||| |||||| || || || 
Sbjct: 178 gtgacgaagttgatggcaacacccttacgaccgaaacgaccaccacgaccgatacggtga 119

                                                                       
Query: 286 aggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcaca 345
           | |||||||||| | | ||  |||||||| ||||||||||||||||| || ||||| || 
Sbjct: 118 atgtagttctcacggttggcaggcaggtcgtagttgatgacaagggacacctgctggacg 59

                           
Query: 346 tcaataccacgggcca 361
           || |||||||||||||
Sbjct: 58  tcgataccacgggcca 43



to top

>ref|XM_743008.1| Aspergillus fumigatus Af293 DEAD/DEAH box helicase (Afu5g02410)
            partial mRNA
          Length = 1518

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                        
Query: 226  gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgg 285
            ||||||||||||||||| || ||||| || ||||| |||||||| |||||||| || |||
Sbjct: 1361 gtgacgaagttgatggcgacaccctttcttccgaaacgaccacttcgaccaatacggtgg 1302

                                                                        
Query: 286  aggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcaca 345
            |  ||||||||| | | ||| || ||||| |||||||||||||| || |||||||| || 
Sbjct: 1301 atatagttctcacggttggtgggtaggtcgtagttgatgacaagcgagacttgctgaacg 1242

                       
Query: 346  tcaataccacg 356
            || ||||||||
Sbjct: 1241 tcgataccacg 1231



to top

>gb|AY428601.1| Helianthus annuus clone HA24-15A initiation factor eIF4A-15 mRNA,
            complete cds
          Length = 1525

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 186/233 (79%)
 Strand = Plus / Minus

                                                                        
Query: 154  ttggccgggagctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctc 213
            |||| ||| |||||||||| ||| || ||||| ||||||||||||||    |||||| ||
Sbjct: 1333 ttggacggcagctcctcaacgacaacattgtaaaacttctggatgtcaccaagcatcttc 1274

                                                                        
Query: 214  tcatcttcacgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacga 273
            ||||| ||| | || || ||||| || || || || || || || || || |||||||| 
Sbjct: 1273 tcatcgtcaagtgtcacaaagttaatcgccacaccttttcttccaaatcgtccactacgc 1214

                                                                        
Query: 274  ccaatgcgatggaggtagttctcaggctgggtcggcaggtcatagttgatgacaagggan 333
            || || ||||| ||||| || || || |||||||| || |||||||| || ||||| || 
Sbjct: 1213 ccgatacgatgaaggtaattttccggttgggtcggaagatcatagtttataacaagtgaa 1154

                                                                 
Query: 334  acttgctgcacatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| || |||||||||||||| |||||||  || ||||||||||| |||||
Sbjct: 1153 acttgttgaacatcaataccacgcgccagcaaatcagtggtgatgagaacacg 1101



to top

>gb|AC166553.2| Nectria haematococca clone JGIAYWI-9O2, complete sequence
          Length = 38247

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 133/162 (82%)
 Strand = Plus / Minus

                                                                         
Query: 225   ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
             |||||| |||||||||||||| ||||| |  ||||| ||||||| ||||||||| || ||
Sbjct: 11563 ggtgacaaagttgatggcaacgccctttcggccgaaacgaccaccacgaccaattcggtg 11504

                                                                         
Query: 285   gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
             || |||||||||| | | ||  || || || ||||||||||| ||||| || ||||| ||
Sbjct: 11503 gatgtagttctcacggttggcggggagatcgtagttgatgaccagggaaacctgctggac 11444

                                                       
Query: 345   atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
             ||| |||||||| ||||| || ||||||| ||| || |||||
Sbjct: 11443 atcgataccacgagccagaagatcggtggcgatcaggacacg 11402



to top

>ref|XM_387017.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG06841.1)
           partial mRNA
          Length = 750

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 123/149 (82%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           |||||||||||| ||||| || ||||| |  ||||| ||||||| ||||||||| || ||
Sbjct: 660 ggtgacgaagttaatggcgacaccctttcggccgaaacgaccaccacgaccaattcggtg 601

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
           || |||||||||| | | ||  || || || ||||||||||| ||||| || ||||| ||
Sbjct: 600 gatgtagttctcacggttggcggggagatcgtagttgatgaccagggacacctgctggac 541

                                        
Query: 345 atcaataccacgggccagcaggtcggtgg 373
           ||| |||||||||||||| ||||| ||||
Sbjct: 540 atcgataccacgggccagaaggtcagtgg 512



to top

>ref|XM_501158.1| Yarrowia lipolytica CLIB122, YALI0B20922g predicted mRNA
          Length = 1188

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 128/156 (82%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||||||||| ||||| |  ||||| || ||||  |||||||| |||||
Sbjct: 1098 ggtgacgaagttgatggcaacaccctttcggccgaatcgtccacctcgaccaattcgatg 1039

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            || |||||||||  | | ||  ||||||||  |||||||||| || || || ||||| ||
Sbjct: 1038 gatgtagttctctcggttggagggcaggtcgaagttgatgaccagagaaacctgctggac 979

                                                
Query: 345  atcaataccacgggccagcaggtcggtggtgatgag 380
            ||| ||||| ||||| ||||| ||||| ||||||||
Sbjct: 978  atcgatacctcgggcaagcagatcggtagtgatgag 943



to top

>emb|X79140.1|NT4A13 N.tabacum NeIF-4A13 mRNA
          Length = 1213

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 68/76 (89%)
 Strand = Plus / Minus

                                                                        
Query: 311  ggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcgg 370
            |||| ||||| || |||||||| ||||||||||||||||||||||| ||||| || || |
Sbjct: 1213 ggtcgtagttaatcacaagggaaacttgctgcacatcaataccacgcgccagaagatcag 1154

                            
Query: 371  tggtgatgagcacacg 386
            ||||||||||||||||
Sbjct: 1153 tggtgatgagcacacg 1138



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 128/156 (82%)
 Strand = Plus / Minus

                                                                           
Query: 225     ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
               ||||||||||||||||||||| ||||| |  ||||| || ||||  |||||||| |||||
Sbjct: 2754636 ggtgacgaagttgatggcaacaccctttcggccgaatcgtccacctcgaccaattcgatg 2754577

                                                                           
Query: 285     gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
               || |||||||||  | | ||  ||||||||  |||||||||| || || || ||||| ||
Sbjct: 2754576 gatgtagttctctcggttggagggcaggtcgaagttgatgaccagagaaacctgctggac 2754517

                                                   
Query: 345     atcaataccacgggccagcaggtcggtggtgatgag 380
               ||| ||||| ||||| ||||| ||||| ||||||||
Sbjct: 2754516 atcgatacctcgggcaagcagatcggtagtgatgag 2754481



to top

>gb|AC137554.15| Medicago truncatula clone mth2-17j18, complete sequence
          Length = 121248

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 127/155 (81%)
 Strand = Plus / Plus

                                                                         
Query: 226   gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgg 285
             ||||| |||||||| ||||| || || || || || || ||||| || ||||| ||||||
Sbjct: 30549 gtgacaaagttgatagcaacaccttttcttccaaaacgcccacttcgcccaatacgatgg 30608

                                                                         
Query: 286   aggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcaca 345
             || ||||| ||||| ||||| ||||  ||||| || ||||| || || |||||||| |||
Sbjct: 30609 agatagttttcaggttgggtaggcaaatcataatttatgaccagagacacttgctgaaca 30668

                                                
Query: 346   tcaataccacgggccagcaggtcggtggtgatgag 380
             ||||||||||||||||  ||||| ||||| |||||
Sbjct: 30669 tcaataccacgggccaaaaggtcagtggtaatgag 30703



to top

>gb|AC136955.20| Medicago truncatula clone mth2-10p1, complete sequence
          Length = 107635

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                         
Query: 226   gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgg 285
             ||||| |||||||| ||||| || || || || || || ||||| || ||||| ||||||
Sbjct: 14957 gtgacaaagttgatagcaacaccttttcttccaaaacgcccacttcgcccaatacgatgg 14898

                                                                         
Query: 286   aggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcaca 345
             || ||||| ||||| ||||| ||||  ||||| || ||||| || || |||||||| |||
Sbjct: 14897 agatagttttcaggttgggtaggcaaatcataatttatgaccagagacacttgctgaaca 14838

                                                
Query: 346   tcaataccacgggccagcaggtcggtggtgatgag 380
             ||||||||||||||||  ||||| ||||| |||||
Sbjct: 14837 tcaataccacgggccaaaaggtcagtggtaatgag 14803



to top

>emb|X79004.1|NTEIF4A8 N.tabacum eIF-4A8 mRNA
          Length = 1497

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                        
Query: 232  aagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtag 291
            |||||||| |||||||| ||||| || ||||  ||||| |  ||||| |||||||| || 
Sbjct: 1193 aagttgatagcaactcctttccttccaaaccttccacttcttccaatacgatggagataa 1134

                                                                        
Query: 292  ttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaata 351
            ||||| ||||| ||||| || ||||||||||| ||||| || ||||| || ||||| |||
Sbjct: 1133 ttctctggctgagtcgggagatcatagttgatcacaagtgatacttgttgtacatctata 1074

                                               
Query: 352  ccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||| ||| ||||| ||||| || |||||
Sbjct: 1073 ccacgagccaacagatcggttgtgataaggacacg 1039



to top

>emb|X79005.1|NTEIF4A8D N.tabacum eIF-4A8 gene
          Length = 4912

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                        
Query: 232  aagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtag 291
            |||||||| |||||||| ||||| || ||||  ||||| |  ||||| |||||||| || 
Sbjct: 4432 aagttgatagcaactcctttccttccaaaccttccacttcttccaatacgatggagataa 4373

                                                                        
Query: 292  ttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaata 351
            ||||| ||||| ||||| || ||||||||||| ||||| || ||||| || ||||| |||
Sbjct: 4372 ttctctggctgagtcgggagatcatagttgatcacaagtgatacttgttgtacatctata 4313

                                               
Query: 352  ccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||| ||| ||||| ||||| || |||||
Sbjct: 4312 ccacgagccaacagatcggttgtgataaggacacg 4278



to top

>gb|AC174465.2| Medicago truncatula chromosome 2 BAC clone mth2-189f20, complete
             sequence
          Length = 90320

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 156/194 (80%)
 Strand = Plus / Plus

                                                                         
Query: 163   agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
             ||||||||||| | ||| ||||| ||||||||||||||   |||||| || || || |||
Sbjct: 36810 agctcctcaatcaacacattgtagaacttctggatgtcactcagcattctttcgtcatca 36869

                                                                         
Query: 223   cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
                ||||| ||||| || ||||| || ||||| || ||||  |||||||||||||| |||
Sbjct: 36870 gttgtgacaaagttaatagcaacacctttccttccaaaccttccactacgaccaatacga 36929

                                                                         
Query: 283   tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
             || || |||||||||||||| || || || ||||| || || || |  || |||||||| 
Sbjct: 36930 tgcagatagttctcaggctgtgttgggagatcataatttataactaaagacacttgctga 36989

                           
Query: 343   acatcaataccacg 356
             ||||||||||||||
Sbjct: 36990 acatcaataccacg 37003



to top

>gb|AY347787.1| Malus x domestica clone 31-4 translation initiation factor eIF-4A
           mRNA, partial cds
          Length = 162

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 120/146 (82%)
 Strand = Plus / Minus

                                                                       
Query: 241 gcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtagttctcaggc 300
           ||||| |||||||| || || | |||||| || ||||| ||||| | |||||| ||||| 
Sbjct: 161 gcaacacccttccttccaaatctaccacttcgtccaatacgatgaaagtagttttcaggt 102

                                                                       
Query: 301 tgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaataccacgggcc 360
           || |||||||  ||||||||||| || || || || |||||||||||||||||||| |||
Sbjct: 101 tgagtcggcaaatcatagttgattacgagagatacctgctgcacatcaataccacgagcc 42

                                     
Query: 361 agcaggtcggtggtgatgagcacacg 386
           |  || || ||||||||||| |||||
Sbjct: 41  aagagatcagtggtgatgagaacacg 16



to top

>ref|XM_749705.1| Aspergillus fumigatus Af293 eukaryotic translation initiation factor
            eIF4A (Afu3g08160) partial mRNA
          Length = 1221

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 131/161 (81%)
 Strand = Plus / Minus

                                                                        
Query: 226  gtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgg 285
            |||||||||||||||||||| ||||| |  ||||| ||||||| |||||| || || || 
Sbjct: 1106 gtgacgaagttgatggcaacacccttacgaccgaaacgaccaccacgaccgatacggtga 1047

                                                                        
Query: 286  aggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcaca 345
            | |||||||||| | | ||  |||| ||| ||||||||||| ||||| || ||||| || 
Sbjct: 1046 atgtagttctcacggttggcgggcaagtcgtagttgatgaccagggaaacctgctgaacg 987

                                                     
Query: 346  tcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            || |||||||| ||||| || ||||||| ||| || |||||
Sbjct: 986  tcgataccacgagccagaagatcggtggcgatcaggacacg 946



to top

>gb|AY167670.1| Pisum sativum DEAD box RNA helicase mRNA, complete cds
          Length = 1646

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 160/200 (80%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||| | ||| ||||| ||||||||||||||   |||||| || ||||| || 
Sbjct: 1361 agctcctcaatcaacacattgtagaacttctggatgtcacccagcattctttcatcatcc 1302

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
               ||||| ||||| || ||||| || ||||| || ||||  |||||||||||||| |||
Sbjct: 1301 ttcgtgacaaagttaattgcaacacctttcctaccaaaccttccactacgaccaatacga 1242

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            ||||| ||||| || || || || || || ||||| || || || |  || |||||||||
Sbjct: 1241 tggagatagttttcgggttgtgtggggagatcataatttataactaaagacacttgctgc 1182

                                
Query: 343  acatcaataccacgggccag 362
            |||||||||||||| |||||
Sbjct: 1181 acatcaataccacgagccag 1162



to top

>gb|AY513583.1| Pisum sativum DEAD box RNA helicase gene, complete cds
          Length = 2216

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 160/200 (80%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||| | ||| ||||| ||||||||||||||   |||||| || ||||| || 
Sbjct: 2188 agctcctcaatcaacacattgtagaacttctggatgtcacccagcattctttcatcatcc 2129

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
               ||||| ||||| || ||||| || ||||| || ||||  |||||||||||||| |||
Sbjct: 2128 ttcgtgacaaagttaattgcaacacctttcctaccaaaccttccactacgaccaatacga 2069

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            ||||| ||||| || || || || || || ||||| || || || |  || |||||||||
Sbjct: 2068 tggagatagttttcgggttgtgtggggagatcataatttataactaaagacacttgctgc 2009

                                
Query: 343  acatcaataccacgggccag 362
            |||||||||||||| |||||
Sbjct: 2008 acatcaataccacgagccag 1989



to top

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 109/132 (82%)
 Strand = Plus / Plus

                                                                          
Query: 229    acgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggagg 288
              |||||||||||||| || |||||||| ||||| ||||| |||||||| || || |||| |
Sbjct: 974129 acgaagttgatggcgacacccttccttccgaaacgaccgctacgaccgatacggtggatg 974188

                                                                          
Query: 289    tagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatca 348
              ||||| ||| | | ||| || || |||||||||||||| ||||| || || || || || 
Sbjct: 974189 tagttttcacggttggtggggagatcatagttgatgaccagggagacctgttggacgtcg 974248

                          
Query: 349    ataccacgggcc 360
              ||||||||||||
Sbjct: 974249 ataccacgggcc 974260



to top

>emb|AJ320155.1|TGO320155 Toxoplasma gondii mRNA for eukaryotic translation initiation factor
            4A (toif4A gene)
          Length = 2346

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 126/155 (81%)
 Strand = Plus / Minus

                                                                        
Query: 232  aagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatggaggtag 291
            |||||||||||||| |||||||| ||||| ||||||  ||||||||| || || | ||||
Sbjct: 1412 aagttgatggcaacacccttcctaccgaaacgaccagaacgaccaatacggtgaatgtag 1353

                                                                        
Query: 292  ttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacatcaata 351
            |||||       | ||||| ||| |||||||||||||| || |||||||| || ||||||
Sbjct: 1352 ttctcctttgtcgccggcaagtcgtagttgatgacaagcgacacttgctggacgtcaata 1293

                                               
Query: 352  ccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| ||||  || || ||||||||||| |||||
Sbjct: 1292 ccacgagccaaaagatctgtggtgatgagaacacg 1258



to top

>gb|AY140659.1| Carabus solieri microsatellite 1122 sequence
          Length = 468

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 313 tcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtg 372
           ||||||||||| || | ||| || || |||||||| ||||||||||||| ||||||||||
Sbjct: 381 tcatagttgataactaaggagacctgttgcacatcgataccacgggccaacaggtcggtg 440

                         
Query: 373 gtgatgagcacacg 386
           |||||||| |||||
Sbjct: 441 gtgatgagtacacg 454



to top

>ref|XM_361955.1| Magnaporthe grisea 70-15 hypothetical protein (MG04400.4) partial cds
          Length = 1278

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            |||||||||||| ||||| || ||||| |  ||||| ||||||| ||||||||| |  ||
Sbjct: 1188 ggtgacgaagttaatggcgacaccctttcggccgaaacgaccaccacgaccaatcctgtg 1129

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            || |||||||||| | | ||  |||||||| ||||||||||| || || || ||||| ||
Sbjct: 1128 gatgtagttctcacggttggcgggcaggtcgtagttgatgaccagcgatacctgctggac 1069

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
             || |||||||| || |||| ||||||||  || ||||||||
Sbjct: 1068 gtcgataccacgagcgagcaagtcggtggcaataagcacacg 1027



to top

>ref|XM_655444.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2932.2), mRNA
          Length = 1266

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||| ||||| ||||| |  ||||| ||||| | |||||| || || ||
Sbjct: 1176 ggtgacgaagttgatagcaacacccttacgaccgaaacgaccgccacgaccgatacggtg 1117

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
             | |||||||||| | | ||  || || || ||||||||||| ||||| || ||||| ||
Sbjct: 1116 aatgtagttctcacggttggcggggagatcgtagttgatgaccagggaaacctgctggac 1057

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||| |||||||||||||| ||||| ||||  ||||| |||||
Sbjct: 1056 atcgataccacgggccagaaggtcagtggcaatgaggacacg 1015



to top

>emb|Z12116.1|CEEIF4AM C.elegans mRNA for eIF-4A homologue
          Length = 1611

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||||||||||||||| |  ||||| || |||  ||| || || |||||
Sbjct: 1183 ggtgacgaagttgatggcaactcccttacgaccgaaacgtccagaacgtccgatacgatg 1124

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            || |||||||||| | | ||  || || ||||||||||| ||||| || || || || ||
Sbjct: 1123 gatgtagttctcacgattggatgggagatcatagttgataacaagtgagacctgttgtac 1064

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
             ||||||||||| ||||  | ||| ||||||||||| |||||
Sbjct: 1063 gtcaataccacgagccaagatgtctgtggtgatgagaacacg 1022



to top

>gb|DQ086181.1| Ictalurus punctatus eukaryotic translation initiation factor 4A
           mRNA, partial cds
          Length = 896

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 313 tcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtg 372
           ||||| |||||||| ||||| || || |||||||||||||| || ||||||||||| |||
Sbjct: 653 tcataattgatgaccagggaaacctgttgcacatcaatacctcgagccagcaggtcagtg 594

                         
Query: 373 gtgatgagcacacg 386
           |||||||| |||||
Sbjct: 593 gtgatgaggacacg 580



to top

>ref|NM_001027453.1| Caenorhabditis elegans INitiation Factor family member (inf-1)
            (inf-1) mRNA, complete cds
          Length = 1584

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||||||||||||||| |  ||||| || |||  ||| || || |||||
Sbjct: 1171 ggtgacgaagttgatggcaactcccttacgaccgaaacgtccagaacgtccgatacgatg 1112

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            || |||||||||| | | ||  || || ||||||||||| ||||| || || || || ||
Sbjct: 1111 gatgtagttctcacgattggatgggagatcatagttgataacaagtgagacctgttgtac 1052

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
             ||||||||||| ||||  | ||| ||||||||||| |||||
Sbjct: 1051 gtcaataccacgagccaagatgtctgtggtgatgagaacacg 1010



to top

>ref|NM_001027452.1| Caenorhabditis elegans INitiation Factor family member (inf-1)
            (inf-1) mRNA, complete cds
          Length = 1675

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 131/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||||||||||||||| |  ||||| || |||  ||| || || |||||
Sbjct: 1217 ggtgacgaagttgatggcaactcccttacgaccgaaacgtccagaacgtccgatacgatg 1158

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            || |||||||||| | | ||  || || ||||||||||| ||||| || || || || ||
Sbjct: 1157 gatgtagttctcacgattggatgggagatcatagttgataacaagtgagacctgttgtac 1098

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
             ||||||||||| ||||  | ||| ||||||||||| |||||
Sbjct: 1097 gtcaataccacgagccaagatgtctgtggtgatgagaacacg 1056



to top

>ref|NM_104305.3| Arabidopsis thaliana EIF4A-2; ATP-dependent helicase AT1G54270
            (EIF4A-2) mRNA, complete cds
          Length = 1759

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 1483 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 1424

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
             | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 1423 agagtcacaaagttaatcgccacaccctttctcccgaaccttccacttcttccgatacgg 1364

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 1363 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 1304

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 1303 acatcgataccacgagccaagagatcggttgtgattagaacacg 1260



to top

>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete
             sequence
          Length = 143186

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                         
Query: 163   agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
             ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 33488 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 33429

                                                                         
Query: 223   cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
              | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 33428 agagtcacaaagttaatcgccacaccctttctcccgaaccttccacttcttccgatacgg 33369

                                                                         
Query: 283   tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
             || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 33368 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 33309

                                                         
Query: 343   acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
             ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 33308 acatcgataccacgagccaagagatcggttgtgattagaacacg 33265



to top

>emb|X65053.1|ATTIF4A2 A.thaliana mRNA for eukaryotic translation initiation factor 4A-2
          Length = 1694

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 1361 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 1302

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
             | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 1301 agagtcacaaagttaatcgcgacaccctttctcccgaaccttccacttcttccgatacgg 1242

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 1241 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 1182

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 1181 acatcgataccacgagccaagagatcggttgtgattagaacacg 1138



to top

>gb|BT008504.1| Arabidopsis thaliana At1g54270 gene, complete cds
          Length = 1239

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 1211 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 1152

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
             | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 1151 agagtcacaaagttaatcgccacaccctttctcccgaaccttccacttcttccgatacgg 1092

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 1091 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 1032

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 1031 acatcgataccacgagccaagagatcggttgtgattagaacacg 988



to top

>gb|AF428462.1|AF428462 Arabidopsis thaliana At1g54270/F20D21_52 mRNA, complete cds
          Length = 1575

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 1353 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 1294

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
             | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 1293 agagtcacaaagttaatcgccacaccctttctcccgaaccttccacttcttccgatacgg 1234

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 1233 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 1174

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 1173 acatcgataccacgagccaagagatcggttgtgattagaacacg 1130



to top

>gb|AF386923.1|AF386923 Arabidopsis thaliana Eukaryotic Initiation Factor 4A-2 (F20D21.9)
            mRNA, complete cds
          Length = 1632

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 1356 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 1297

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
             | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 1296 agagtcacaaagttaatcgccacaccctttctcccgaaccttccacttcttccgatacgg 1237

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 1236 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 1177

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 1176 acatcgataccacgagccaagagatcggttgtgattagaacacg 1133



to top

>gb|AY087965.1| Arabidopsis thaliana clone 3997 mRNA, complete sequence
          Length = 1577

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 177/224 (79%)
 Strand = Plus / Minus

                                                                        
Query: 163  agctcctcaatgaccacgttgtanaacttctggatgtcgaacagcatcctctcatcttca 222
            ||||||||||  ||||| ||||| || ||||| || || |||||||| |||| ||| |||
Sbjct: 1355 agctcctcaacaaccacattgtagaatttctgaatatcaaacagcattctctgatcatca 1296

                                                                        
Query: 223  cgggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcga 282
             | || || ||||| || || || ||||| ||||||||||  ||||| |  || || || 
Sbjct: 1295 agagtcacaaagttaatcgccacaccctttctcccgaaccttccacttcttccgatacgg 1236

                                                                        
Query: 283  tggaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgc 342
            || ||||| ||||| ||||| || || |||||| |||| ||||| || || |||||||||
Sbjct: 1235 tgaaggtaattctctggctgagttgggaggtcaaagtttatgactagagagacttgctgc 1176

                                                        
Query: 343  acatcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||||| |||||||| ||||  || ||||| ||||| || |||||
Sbjct: 1175 acatcgataccacgagccaagagatcggttgtgattagaacacg 1132



to top

>emb|BX053338.1|CNS09DBI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 194 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 253

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 254 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 313

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 314 atcgataccacgggcgagcagatccgtggtgatcaggacacg 355



to top

>emb|BX020719.1|CNS08O5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 379 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 320

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 319 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 260

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 259 atcgataccacgggcgagcagatccgtggtgatcaggacacg 218



to top

>emb|BX072009.1|CNS09RQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 211 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 270

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 271 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 330

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 331 atcgataccacgggcgagcagatccgtggtgatcaggacacg 372



to top

>emb|BX068966.1|CNS09PDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 244 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 303

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 304 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 363

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 364 atcgataccacgggcgagcagatccgtggtgatcaggacacg 405



to top

>emb|BX065544.1|CNS09MQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 201 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 260

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 261 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 320

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 321 atcgataccacgggcgagcagatccgtggtgatcaggacacg 362



to top

>emb|BX065406.1|CNS09MMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 189 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 248

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 249 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 308

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 309 atcgataccacgggcgagcagatccgtggtgatcaggacacg 350



to top

>emb|BX064751.1|CNS09M4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 416 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 357

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 356 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 297

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 296 atcgataccacgggcgagcagatccgtggtgatcaggacacg 255



to top

>emb|BX063777.1|CNS09LDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 753 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 812

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 813 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 872

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 873 atcgataccacgggcgagcagatccgtggtgatcaggacacg 914



to top

>emb|BX063717.1|CNS09LBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 149 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 208

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 209 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 268

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 269 atcgataccacgggcgagcagatccgtggtgatcaggacacg 310



to top

>emb|BX062174.1|CNS09K4Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 197 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 256

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 257 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 316

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 317 atcgataccacgggcgagcagatccgtggtgatcaggacacg 358



to top

>emb|BX060629.1|CNS09IY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 196 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 255

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 256 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 315

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 316 atcgataccacgggcgagcagatccgtggtgatcaggacacg 357



to top

>emb|BX059457.1|CNS09I1H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 484 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 425

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 424 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 365

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 364 atcgataccacgggcgagcagatccgtggtgatcaggacacg 323



to top

>emb|BX059385.1|CNS09HZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 210 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 269

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 270 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 329

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 330 atcgataccacgggcgagcagatccgtggtgatcaggacacg 371



to top

>emb|BX056724.1|CNS09FXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 411

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 226 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 285

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 286 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 345

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 346 atcgataccacgggcgagcagatccgtggtgatcaggacacg 387



to top

>emb|BX057122.1|CNS09G8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 485

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 202 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 261

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 262 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 321

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 322 atcgataccacgggcgagcagatccgtggtgatcaggacacg 363



to top

>emb|BX056400.1|CNS09FOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 225 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 284

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 285 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 344

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 345 atcgataccacgggcgagcagatccgtggtgatcaggacacg 386



to top

>emb|BX053169.1|CNS09D6T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 197 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 256

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 257 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 316

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 317 atcgataccacgggcgagcagatccgtggtgatcaggacacg 358



to top

>emb|BX053903.1|CNS09DR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 224 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 283

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 284 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 343

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 344 atcgataccacgggcgagcagatccgtggtgatcaggacacg 385



to top

>emb|BX031051.1|CNS08W4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 216 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 275

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 276 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 335

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 336 atcgataccacgggcgagcagatccgtggtgatcaggacacg 377



to top

>emb|BX048647.1|CNS099P7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 606

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 194 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 253

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 254 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 313

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 314 atcgataccacgggcgagcagatccgtggtgatcaggacacg 355



to top

>emb|BX046370.1|CNS097XY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 485 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 426

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 425 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 366

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 365 atcgataccacgggcgagcagatccgtggtgatcaggacacg 324



to top

>emb|BX043299.1|CNS095KN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 760 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 819

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 820 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 879

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 880 atcgataccacgggcgagcagatccgtggtgatcaggacacg 921



to top

>emb|BX042604.1|CNS0951C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 190 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 249

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 250 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 309

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 310 atcgataccacgggcgagcagatccgtggtgatcaggacacg 351



to top

>emb|BX042533.1|CNS094ZD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 562

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 208 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 267

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 268 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 327

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 328 atcgataccacgggcgagcagatccgtggtgatcaggacacg 369



to top

>emb|BX037324.1|CNS090YO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 190 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 249

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 250 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 309

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 310 atcgataccacgggcgagcagatccgtggtgatcaggacacg 351



to top

>emb|BX037318.1|CNS090YI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 213 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 272

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 273 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 332

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 333 atcgataccacgggcgagcagatccgtggtgatcaggacacg 374



to top

>emb|BX036647.1|CNS090FV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 204 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 263

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 264 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 323

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 324 atcgataccacgggcgagcagatccgtggtgatcaggacacg 365



to top

>emb|BX036646.1|CNS090FU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 827 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 768

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 767 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 708

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 707 atcgataccacgggcgagcagatccgtggtgatcaggacacg 666



to top

>emb|BX036940.1|CNS090O0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 199 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 258

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 259 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 318

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 319 atcgataccacgggcgagcagatccgtggtgatcaggacacg 360



to top

>emb|BX036785.1|CNS090JP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 825 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 766

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 765 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 706

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 705 atcgataccacgggcgagcagatccgtggtgatcaggacacg 664



to top

>emb|BX036205.1|CNS0903L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 220 ggtgacgaagttgatagcaactcccttacggccgaaacgtccaccacgtccaattctatg 279

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 280 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 339

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 340 atcgataccacgggcgagcagatccgtggtgatcaggacacg 381



to top

>emb|BX033621.1|CNS08Y3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 195 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 254

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 255 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 314

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 315 atcgataccacgggcgagcagatccgtggtgatcaggacacg 356



to top

>emb|BX033102.1|CNS08XPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 199 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 258

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 259 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 318

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 319 atcgataccacgggcgagcagatccgtggtgatcaggacacg 360



to top

>emb|BX032924.1|CNS08XKG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 205 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 264

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 265 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 324

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 325 atcgataccacgggcgagcagatccgtggtgatcaggacacg 366



to top

>emb|BX032131.1|CNS08WYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 701

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 187 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 246

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 247 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 306

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 307 atcgataccacgggcgagcagatccgtggtgatcaggacacg 348



to top

>emb|BX031809.1|CNS08WPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 757 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 816

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 817 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 876

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 877 atcgataccacgggcgagcagatccgtggtgatcaggacacg 918



to top

>emb|BX031808.1|CNS08WPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 700 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 641

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 640 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 581

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 580 atcgataccacgggcgagcagatccgtggtgatcaggacacg 539



to top

>emb|BX030042.1|CNS08VCE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 199 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 258

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 259 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 318

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 319 atcgataccacgggcgagcagatccgtggtgatcaggacacg 360



to top

>emb|BX029861.1|CNS08V7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 203 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 262

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 263 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 322

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 323 atcgataccacgggcgagcagatccgtggtgatcaggacacg 364



to top

>emb|BX029784.1|CNS08V58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 196 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 255

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 256 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 315

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 316 atcgataccacgggcgagcagatccgtggtgatcaggacacg 357



to top

>emb|BX028816.1|CNS08UEC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 194 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 253

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 254 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 313

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 314 atcgataccacgggcgagcagatccgtggtgatcaggacacg 355



to top

>emb|BX022396.1|CNS08PG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 199 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 258

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 259 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 318

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 319 atcgataccacgggcgagcagatccgtggtgatcaggacacg 360



to top

>emb|BX027810.1|CNS08TME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 804 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 863

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 864 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 923

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 924 atcgataccacgggcgagcagatccgtggtgatcaggacacg 965



to top

>emb|BX027601.1|CNS08TGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 204 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 263

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 264 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 323

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 324 atcgataccacgggcgagcagatccgtggtgatcaggacacg 365



to top

>emb|BX027600.1|CNS08TGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 901 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 842

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 841 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 782

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 781 atcgataccacgggcgagcagatccgtggtgatcaggacacg 740



to top

>emb|BX027436.1|CNS08TC0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 422

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 211 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 270

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 271 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 330

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 331 atcgataccacgggcgagcagatccgtggtgatcaggacacg 372



to top

>emb|BX027281.1|CNS08T7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 779 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 720

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 719 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 660

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 659 atcgataccacgggcgagcagatccgtggtgatcaggacacg 618



to top

>emb|BX026427.1|CNS08SJZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 183 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 242

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 243 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 302

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 303 atcgataccacgggcgagcagatccgtggtgatcaggacacg 344



to top

>emb|BX025946.1|CNS08S6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 456 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 397

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 396 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 337

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 336 atcgataccacgggcgagcagatccgtggtgatcaggacacg 295



to top

>emb|BX025156.1|CNS08RKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 206 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 265

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 266 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 325

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 326 atcgataccacgggcgagcagatccgtggtgatcaggacacg 367



to top

>emb|BX022818.1|CNS08PRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 192 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 251

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 252 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 311

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 312 atcgataccacgggcgagcagatccgtggtgatcaggacacg 353



to top

>emb|BX022573.1|CNS08PKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 528

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 207 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 266

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 267 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 326

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 327 atcgataccacgggcgagcagatccgtggtgatcaggacacg 368



to top

>emb|BX021274.1|CNS08OKU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 463 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 404

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 403 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 344

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 343 atcgataccacgggcgagcagatccgtggtgatcaggacacg 302



to top

>emb|BX020936.1|CNS08OBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 116 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 175

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 176 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 235

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 236 atcgataccacgggcgagcagatccgtggtgatcaggacacg 277



to top

>emb|BX020450.1|CNS08NXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 192 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 251

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 252 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 311

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 312 atcgataccacgggcgagcagatccgtggtgatcaggacacg 353



to top

>emb|BX020352.1|CNS08NV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 200 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 259

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 260 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 319

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 320 atcgataccacgggcgagcagatccgtggtgatcaggacacg 361



to top

>emb|BX019825.1|CNS08NGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 206 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 265

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 266 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 325

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 326 atcgataccacgggcgagcagatccgtggtgatcaggacacg 367



to top

>emb|BX018864.1|CNS08MPW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 197 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 256

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 257 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 316

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 317 atcgataccacgggcgagcagatccgtggtgatcaggacacg 358



to top

>emb|BX016088.1|CNS08KKS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 531 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 590

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 591 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 650

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 651 atcgataccacgggcgagcagatccgtggtgatcaggacacg 692



to top

>emb|BX014705.1|CNS08JID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 806 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 865

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 866 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 925

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 926 atcgataccacgggcgagcagatccgtggtgatcaggacacg 967



to top

>emb|BX014550.1|CNS08JE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 531 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 590

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 591 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 650

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 651 atcgataccacgggcgagcagatccgtggtgatcaggacacg 692



to top

>emb|BX014495.1|CNS08JCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 212 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 271

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 272 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 331

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 332 atcgataccacgggcgagcagatccgtggtgatcaggacacg 373



to top

>emb|BX013937.1|CNS08IX1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 207 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 266

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 267 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 326

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 327 atcgataccacgggcgagcagatccgtggtgatcaggacacg 368



to top

>emb|BX010574.1|CNS08GBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 929 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 870

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 869 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 810

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 809 atcgataccacgggcgagcagatccgtggtgatcaggacacg 768



to top

>emb|BX008146.1|CNS08EG6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 879 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 820

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 819 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 760

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 759 atcgataccacgggcgagcagatccgtggtgatcaggacacg 718



to top

>emb|BX006955.1|CNS08DJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 202 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 261

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 262 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 321

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 322 atcgataccacgggcgagcagatccgtggtgatcaggacacg 363



to top

>emb|BX006592.1|CNS08D90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 202 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 261

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 262 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 321

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 322 atcgataccacgggcgagcagatccgtggtgatcaggacacg 363



to top

>emb|BX005821.1|CNS08CNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 191 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 250

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 251 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 310

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 311 atcgataccacgggcgagcagatccgtggtgatcaggacacg 352



to top

>ref|XM_318978.2| Anopheles gambiae str. PEST ENSANGP00000014802 (ENSANGG00000012313),
            mRNA
          Length = 2046

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 1168 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 1109

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
             | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 1108 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 1049

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 1048 atcgataccacgggcgagcagatccgtggtgatcaggacacg 1007



to top

>ref|XM_318977.2| Anopheles gambiae str. PEST ENSANGP00000023201 (ENSANGG00000012313),
            mRNA
          Length = 2088

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 1210 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 1151

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
             | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 1150 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 1091

                                                      
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
            ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 1090 atcgataccacgggcgagcagatccgtggtgatcaggacacg 1049



to top

>gb|BC103130.1| Bos taurus eukaryotic translation initiation factor 4A, isoform 1,
            mRNA (cDNA clone MGC:128124 IMAGE:7989604), complete cds
          Length = 1771

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| |||||||| ||||||||||| | |||||| ||||| 
Sbjct: 1061 aggtcatagttgatgactaaggaaacttgctgtacatcaatacctctggccagtaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>ref|NM_001034228.1| Bos taurus eukaryotic translation initiation factor 4A, isoform 1
            (EIF4A1), mRNA
          Length = 1771

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| |||||||| ||||||||||| | |||||| ||||| 
Sbjct: 1061 aggtcatagttgatgactaaggaaacttgctgtacatcaatacctctggccagtaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>ref|NM_198366.1| Danio rerio eukaryotic translation initiation factor 4A, isoform 1A
            (eif4a1a), mRNA
          Length = 2390

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 256  ccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtca 315
            ||||| ||||||| ||||||||| |||||||  ||||||||    | ||| || ||||||
Sbjct: 1111 ccgaaacgaccaccacgaccaattcgatggatatagttctctctgttggttggaaggtca 1052

                                                                        
Query: 316  tagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtg 375
            ||||| ||||| ||||| || ||||| |||||||| || |  |||||||| || ||||||
Sbjct: 1051 tagttaatgaccagggaaacctgctgtacatcaatgcctcttgccagcagatcagtggtg 992

                    
Query: 376  atgagcac 383
            || |||||
Sbjct: 991  ataagcac 984



to top

>emb|BX028053.1|CNS08TT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 128/160 (80%)
 Strand = Plus / Plus

                                                                       
Query: 227 tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 286
           ||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | ||| |
Sbjct: 193 tgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatgaa 252

                                                                       
Query: 287 ggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacat 346
            ||| |||||  || | || || |||||||| || || || || || || ||||||||||
Sbjct: 253 tgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcacat 312

                                                   
Query: 347 caataccacgggccagcaggtcggtggtgatgagcacacg 386
           | ||||||||||| ||||| || |||||||| || |||||
Sbjct: 313 cgataccacgggcgagcagatccgtggtgatcaggacacg 352



to top

>gb|BC048899.1| Danio rerio eukaryotic translation initiation factor 4A, isoform 1A,
            mRNA (cDNA clone MGC:55961 IMAGE:3819402), complete cds
          Length = 2390

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 256  ccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtca 315
            ||||| ||||||| ||||||||| |||||||  ||||||||    | ||| || ||||||
Sbjct: 1111 ccgaaacgaccaccacgaccaattcgatggatatagttctctctgttggttggaaggtca 1052

                                                                        
Query: 316  tagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtg 375
            ||||| ||||| ||||| || ||||| |||||||| || |  |||||||| || ||||||
Sbjct: 1051 tagttaatgaccagggaaacctgctgtacatcaatgcctcttgccagcagatcagtggtg 992

                    
Query: 376  atgagcac 383
            || |||||
Sbjct: 991  ataagcac 984



to top

>ref|XM_684934.1| PREDICTED: Danio rerio similar to Eukaryotic translation initiation
            factor 4A, isoform 1A, transcript variant 1 (LOC564228),
            mRNA
          Length = 2630

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 256  ccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtca 315
            ||||| ||||||| ||||||||| |||||||  ||||||||    | ||| || ||||||
Sbjct: 1115 ccgaaacgaccaccacgaccaattcgatggatatagttctctctgttggttggaaggtca 1056

                                                                        
Query: 316  tagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcggtggtg 375
            ||||| ||||| ||||| || ||||| |||||||| || |  |||||||| || ||||||
Sbjct: 1055 tagttaatgaccagggaaacctgctgtacatcaatgcctcttgccagcagatcagtggtg 996

                    
Query: 376  atgagcac 383
            || |||||
Sbjct: 995  ataagcac 988



to top

>gb|BC055242.1| Danio rerio zgc:63783, mRNA (cDNA clone MGC:63783 IMAGE:2643605),
            complete cds
          Length = 1842

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 307  ggcaggtcatagttgatgacaaggganacttgctgcacatcaataccacgggcca 361
            |||| |||||||||||||||||| || |||||||| |||||||| ||||| ||||
Sbjct: 1098 ggcaagtcatagttgatgacaagcgaaacttgctgaacatcaattccacgagcca 1044



to top

>emb|CR717504.2|CNS0GGKM Tetraodon nigroviridis full-length cDNA
          Length = 1432

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 127/159 (79%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
            ||||||||||||||| ||||| || || || || || ||||||| ||||||||| |  ||
Sbjct: 1049 ggtgacgaagttgatagcaacgccttttctgccaaaacgaccaccacgaccaattctgtg 990

                                                                        
Query: 285  gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
             | |||||||||  | |  || || ||||||||||| ||||| ||||| || ||||| ||
Sbjct: 989  aatgtagttctcccggtttgtaggaaggtcatagttaatgaccagggacacctgctggac 930

                                                   
Query: 345  atcaataccacgggccagcaggtcggtggtgatgagcac 383
             || || ||||| ||||| ||||| |||||||| |||||
Sbjct: 929  gtcgatgccacgagccaggaggtcagtggtgatcagcac 891



to top

>gb|AY167671.1| Pisum sativum DEAD box RNA helicase mRNA, complete cds
          Length = 1638

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 109/135 (80%)
 Strand = Plus / Minus

                                                                        
Query: 227  tgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatgga 286
            |||| ||||| |||||||| || || || || ||||  |||||||||||||| || ||||
Sbjct: 1232 tgacaaagttaatggcaacaccttttctaccaaaccttccactacgaccaatacggtgga 1173

                                                                        
Query: 287  ggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcacat 346
            | |||||||||||||| || || || ||| | ||||| || || || || || || ||||
Sbjct: 1172 gatagttctcaggctgtgtagggagatcaaaattgataaccagagacacctgttgtacat 1113

                           
Query: 347  caataccacgggcca 361
            |||||||||| ||||
Sbjct: 1112 caataccacgtgcca 1098



to top

>ref|NM_213451.1| Danio rerio zgc:63783 (zgc:63783), mRNA
          Length = 1842

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 307  ggcaggtcatagttgatgacaaggganacttgctgcacatcaataccacgggcca 361
            |||| |||||||||||||||||| || |||||||| |||||||| ||||| ||||
Sbjct: 1098 ggcaagtcatagttgatgacaagcgaaacttgctgaacatcaattccacgagcca 1044



to top

>ref|XM_697557.1| PREDICTED: Danio rerio hypothetical protein LOC554540 (LOC554540),
            mRNA
          Length = 1823

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 307  ggcaggtcatagttgatgacaaggganacttgctgcacatcaataccacgggcca 361
            |||| |||||||||||||||||| || |||||||| |||||||| ||||| ||||
Sbjct: 1096 ggcaagtcatagttgatgacaagcgaaacttgctgaacatcaattccacgagcca 1042



to top

>emb|CR717967.2|CNS0GGXH Tetraodon nigroviridis full-length cDNA
          Length = 1513

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            |||||||||||||| || |  || |||||||| ||||| || || | |||||||||||||
Sbjct: 1111 aggtcatagttgatcaccattgacacttgctgaacatcgatgcctctggccagcaggtcg 1052

                          
Query: 370  gtggtgatgagcac 383
            |||||||| |||||
Sbjct: 1051 gtggtgatcagcac 1038



to top

>emb|BX069140.1|CNS09PIG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 129/162 (79%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 716 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 657

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || ||  |||||||
Sbjct: 656 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacccgctgcac 597

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 596 atcgataccacgggcgagcagatccgtggtgatcaggacacg 555



to top

>emb|BX059694.1|CNS09I82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 129/162 (79%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 747 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 806

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || |  ||||||||
Sbjct: 807 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatagctgctgcac 866

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 867 atcgataccacgggcgagcagatccgtggtgatcaggacacg 908



to top

>emb|BX051892.1|CNS09C7C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 130/162 (80%), Gaps = 1/162 (0%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||| ||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 100 ggtgacgaa-ttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 158

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || ||||||||||| || || || || || ||||||||
Sbjct: 159 aatgtaattctcccgcagcgttggaaggtcatagttaataactagtgatacctgctgcac 218

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 219 atcgataccacgggcgagcagatccgtggtgatcaggacacg 260



to top

>emb|BX027400.1|CNS08TB0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 129/162 (79%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||  ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 420 ggtgacgaagttgaaagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 479

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 480 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 539

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 540 atcgataccacgggcgagcagatccgtggtgatcaggacacg 581



to top

>emb|BX019528.1|CNS08N8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 129/162 (79%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  || || || |||| ||| ||||| | |||
Sbjct: 211 ggtgacgaagttgatagcaactcccttacgaccaaaacgtccaccacgtccaattctatg 270

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 271 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 330

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 331 atcgataccacgggcgagcagatccgtggtgatcaggacacg 372



to top

>emb|BX011160.1|CNS08GRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17DD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 129/162 (79%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| | | ||||| | |||
Sbjct: 212 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccatgtccaattctatg 271

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 272 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 331

                                                     
Query: 345 atcaataccacgggccagcaggtcggtggtgatgagcacacg 386
           ||| ||||||||||| ||||| || |||||||| || |||||
Sbjct: 332 atcgataccacgggcgagcagatccgtggtgatcaggacacg 373



to top

>ref|XM_521164.1| PREDICTED: Pan troglodytes similar to eukaryotic translation
           initiation factor 4A, isoform 1 (LOC465743), mRNA
          Length = 757

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 526 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 467

                
Query: 370 gtggt 374
           |||||
Sbjct: 466 gtggt 462



to top

>ref|XM_511961.1| PREDICTED: Pan troglodytes LOC455218 (LOC455218), mRNA
          Length = 1161

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 986 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 927

                
Query: 370 gtggt 374
           |||||
Sbjct: 926 gtggt 922



to top

>ref|NM_001416.1| Homo sapiens eukaryotic translation initiation factor 4A, isoform 1
            (EIF4A1), mRNA
          Length = 1383

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1062 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 1003

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1002 gtggt 998



to top

>gb|BT019881.1| Homo sapiens eukaryotic translation initiation factor 4A, isoform 1
            mRNA, complete cds
          Length = 1221

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1046 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 987

                 
Query: 370  gtggt 374
            |||||
Sbjct: 986  gtggt 982



to top

>gb|BT019880.1| Homo sapiens eukaryotic translation initiation factor 4A, isoform 1
            mRNA, complete cds
          Length = 1221

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1046 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 987

                 
Query: 370  gtggt 374
            |||||
Sbjct: 986  gtggt 982



to top

>gb|BT019879.1| Synthetic construct Homo sapiens eukaryotic translation initiation
            factor 4A, isoform 1 mRNA, partial cds
          Length = 1221

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1046 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 987

                 
Query: 370  gtggt 374
            |||||
Sbjct: 986  gtggt 982



to top

>gb|BC073752.1| Homo sapiens eukaryotic translation initiation factor 4A, isoform 1,
            mRNA (cDNA clone MGC:88756 IMAGE:6371531), complete cds
          Length = 1394

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1049 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 990

                 
Query: 370  gtggt 374
            |||||
Sbjct: 989  gtggt 985



to top

>ref|NM_144958.2| Mus musculus eukaryotic translation initiation factor 4A1 (Eif4a1),
            mRNA
          Length = 1772

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>ref|XM_676193.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8016.2), mRNA
          Length = 1200

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 256  ccgaaccgaccactacgaccaatgcgatggaggtagttctcaggctgggtcggcaggtca 315
            ||||| ||||| || ||||| ||||| |||| |||||| ||| | | ||| || || || 
Sbjct: 1076 ccgaatcgaccgcttcgaccgatgcggtggatgtagttttcacggttggtggggagatcg 1017

                                                     
Query: 316  tagttgatgacaaggganacttgctgcacatcaataccacg 356
            |||||||||||||| || |||||||| ||||| ||||||||
Sbjct: 1016 tagttgatgacaagagaaacttgctggacatctataccacg 976



to top

>gb|BC032613.1| Homo sapiens cDNA clone IMAGE:5555330, **** WARNING: chimeric clone
            ****
          Length = 3530

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 3126 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 3067

                 
Query: 370  gtggt 374
            |||||
Sbjct: 3066 gtggt 3062



to top

>gb|BC032078.1| Homo sapiens eukaryotic translation initiation factor 4A, isoform 1,
            mRNA (cDNA clone IMAGE:3880019)
          Length = 1393

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1044 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 985

                 
Query: 370  gtggt 374
            |||||
Sbjct: 984  gtggt 980



to top

>gb|BC012282.1| Mus musculus eukaryotic translation initiation factor 4A1, mRNA (cDNA
            clone IMAGE:3662193), with apparent retained intron
          Length = 1793

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1050 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 991

                 
Query: 370  gtggt 374
            |||||
Sbjct: 990  gtggt 986



to top

>gb|BC006380.1| Homo sapiens cDNA clone IMAGE:4099962, partial cds
          Length = 1598

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1248 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 1189

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1188 gtggt 1184



to top

>emb|AL136362.10| Human DNA sequence from clone RP13-136L2 on chromosome X Contains a
             eukaryotic translation initiation factor 4A, isoform 1
             (EIF4A1) pseudogene, complete sequence
          Length = 135240

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                         
Query: 310   aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
             ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 82046 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 82105

                  
Query: 370   gtggt 374
             |||||
Sbjct: 82106 gtggt 82110



to top

>emb|BX012572.1|CNS08HV4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 113/141 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtgacgaagttgatggcaactcccttcctcccgaaccgaccactacgaccaatgcgatg 284
           ||||||||||||||| ||||||||||| |  ||||| || |||| ||| ||||| | |||
Sbjct: 209 ggtgacgaagttgatagcaactcccttacgaccgaaacgtccaccacgtccaattctatg 268

                                                                       
Query: 285 gaggtagttctcaggctgggtcggcaggtcatagttgatgacaaggganacttgctgcac 344
            | ||| |||||  || | || || |||||||| || || || || || || ||||||||
Sbjct: 269 aatgtaattctcccgcagcgttggaaggtcataattaataactagtgatacctgctgcac 328

                                
Query: 345 atcaataccacgggccagcag 365
           ||| ||||||||||| |||||
Sbjct: 329 atcgataccacgggcgagcag 349



to top

>emb|X03040.1|MMEIF4AL Mouse mRNA for initiation factor eIF-4A long form
          Length = 1778

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>emb|X03039.1|MMEIF4AI Mouse mRNA for initiation factor eIF-4AI
          Length = 1407

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1058 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 999

                 
Query: 370  gtggt 374
            |||||
Sbjct: 998  gtggt 994



to top

>gb|BC063812.1| Rattus norvegicus eukaryotic translation initiation factor 4A1, mRNA
            (cDNA clone MGC:72964 IMAGE:6921521), complete cds
          Length = 1805

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            |||||||| |||||||| ||||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1064 aggtcataattgatgactagggagacctgctgcacatcaatgcctctggccaacaggtca 1005

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1004 gtggt 1000



to top

>gb|BC099392.1| Mus musculus eukaryotic translation initiation factor 4A1, mRNA (cDNA
            clone IMAGE:30848668), partial cds
          Length = 1421

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1044 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 985

                 
Query: 370  gtggt 374
            |||||
Sbjct: 984  gtggt 980



to top

>emb|AL646054.20| Mouse DNA sequence from clone RP23-157N11 on chromosome 1 Contains the
             Cd28 gene for CD28 antigen, a lactate dehydrogenase
             pseudogene, a ribosomal protein S6 (Rps6) pseudogene,  a
             mortality factor 4 (MORF4) pseudogene, a eukaryotic
             translation initiation factor 4A1 (Eif4a1) pseudogene, the
             3' end of a variant of the Ctla4 gene for cytotoxic
             T-lymphocyte-associated protein 4 and two novel genes,
             complete sequence
          Length = 202305

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 310   aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
             ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 17935 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 17876

                  
Query: 370   gtggt 374
             |||||
Sbjct: 17875 gtggt 17871



to top

>ref|NM_199372.1| Rattus norvegicus eukaryotic translation initiation factor 4A1
            (Eif4a1), mRNA
          Length = 1805

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            |||||||| |||||||| ||||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1064 aggtcataattgatgactagggagacctgctgcacatcaatgcctctggccaacaggtca 1005

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1004 gtggt 1000



to top

>emb|CR860906.1| Pongo pygmaeus mRNA; cDNA DKFZp470B2433 (from clone DKFZp470B2433)
          Length = 1791

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1077 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 1018

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1017 gtggt 1013



to top

>emb|CR626851.1| full-length cDNA clone CS0DF019YF06 of Fetal brain of Homo sapiens
            (human)
          Length = 1685

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR624603.1| full-length cDNA clone CS0DM001YP05 of Fetal liver of Homo sapiens
            (human)
          Length = 1669

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1017 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 958

                 
Query: 370  gtggt 374
            |||||
Sbjct: 957  gtggt 953



to top

>emb|CR623219.1| full-length cDNA clone CL0BB009ZA08 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1718

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR623095.1| full-length cDNA clone CS0DF003YE17 of Fetal brain of Homo sapiens
            (human)
          Length = 1704

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR622601.1| full-length cDNA clone CS0DF032YG04 of Fetal brain of Homo sapiens
            (human)
          Length = 1688

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR621511.1| full-length cDNA clone CS0DH007YM23 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1298

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR621238.1| full-length cDNA clone CS0DA004YK05 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1290

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR620740.1| full-length cDNA clone CS0DA006YA19 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1713

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1049 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 990

                 
Query: 370  gtggt 374
            |||||
Sbjct: 989  gtggt 985



to top

>emb|CR619465.1| full-length cDNA clone CS0DH002YB19 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1298

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR619751.1| full-length cDNA clone CS0DF001YB06 of Fetal brain of Homo sapiens
            (human)
          Length = 1704

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR618674.1| full-length cDNA clone CS0DK008YE05 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1124

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 842 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 783

                
Query: 370 gtggt 374
           |||||
Sbjct: 782 gtggt 778



to top

>emb|CR617051.1| full-length cDNA clone CS0DH001YG02 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1313

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR614903.1| full-length cDNA clone CS0DF007YF10 of Fetal brain of Homo sapiens
            (human)
          Length = 1340

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1051 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 992

                 
Query: 370  gtggt 374
            |||||
Sbjct: 991  gtggt 987



to top

>emb|CR612440.1| full-length cDNA clone CS0DA006YH16 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1296

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR610019.1| full-length cDNA clone CS0DA009YG22 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1684

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR608998.1| full-length cDNA clone CS0DI002YI16 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1703

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR607537.1| full-length cDNA clone CS0DI058YE08 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1686

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR605465.1| full-length cDNA clone CS0DF002YB24 of Fetal brain of Homo sapiens
            (human)
          Length = 1698

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR604267.1| full-length cDNA clone CS0DH002YN10 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1678

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR603854.1| full-length cDNA clone CS0DH004YM20 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 670

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 340 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 281

                
Query: 370 gtggt 374
           |||||
Sbjct: 280 gtggt 276



to top

>emb|CR603368.1| full-length cDNA clone CS0DI020YH17 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1340

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR602368.1| full-length cDNA clone CS0DF036YA10 of Fetal brain of Homo sapiens
            (human)
          Length = 1722

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1046 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 987

                 
Query: 370  gtggt 374
            |||||
Sbjct: 986  gtggt 982



to top

>emb|CR600480.1| full-length cDNA clone CS0DA009YG09 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1326

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR600142.1| full-length cDNA clone CS0CAP004YH19 of Thymus of Homo sapiens
            (human)
          Length = 1331

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR599522.1| full-length cDNA clone CS0DE008YL11 of Placenta of Homo sapiens
            (human)
          Length = 1319

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR599489.1| full-length cDNA clone CS0DI057YL14 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1695

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR598780.1| full-length cDNA clone CS0DH005YE18 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1320

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR598002.1| full-length cDNA clone CS0DI068YH02 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1687

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR596028.1| full-length cDNA clone CL0BA005ZH08 of Placenta of Homo sapiens
            (human)
          Length = 1300

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1024 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 965

                 
Query: 370  gtggt 374
            |||||
Sbjct: 964  gtggt 960



to top

>emb|CR592725.1| full-length cDNA clone CS0DI009YB15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1140

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 821 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 762

                
Query: 370 gtggt 374
           |||||
Sbjct: 761 gtggt 757



to top

>dbj|AK135994.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
            enriched library, clone:7420444J20 product:eukaryotic
            translation initiation factor 4A1, full insert sequence
          Length = 1408

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1062 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1003

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1002 gtggt 998



to top

>dbj|AK145508.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0008N17 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1775

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1063 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1004

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1003 gtggt 999



to top

>dbj|AK145375.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:I0C0028O22 product:eukaryotic
            translation initiation factor 4A1, full insert sequence
          Length = 1776

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1063 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1004

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1003 gtggt 999



to top

>dbj|AK146424.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
            clone:I730086G01 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1780

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1063 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1004

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1003 gtggt 999



to top

>dbj|AK144850.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
            library, clone:G730041P21 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>dbj|AK146464.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920008N24 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1771

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>dbj|AK152694.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830082M01 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1774

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1063 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1004

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1003 gtggt 999



to top

>ref|XM_937591.1| PREDICTED: Homo sapiens similar to eukaryotic translation initiation
            factor 4A, isoform 1, transcript variant 1 (LOC648024),
            mRNA
          Length = 1401

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1067 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 1008

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1007 gtggt 1003



to top

>ref|XM_943353.1| PREDICTED: Homo sapiens similar to eukaryotic translation
           initiation factor 4A, isoform 1, transcript variant 2
           (LOC648024), mRNA
          Length = 1302

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 968 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 909

                
Query: 370 gtggt 374
           |||||
Sbjct: 908 gtggt 904



to top

>ref|XM_926537.1| PREDICTED: Homo sapiens similar to eukaryotic translation initiation
            factor 4A, isoform 1, transcript variant 1 (LOC642784),
            mRNA
          Length = 1401

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 1067 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 1008

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1007 gtggt 1003



to top

>ref|XM_931371.1| PREDICTED: Homo sapiens similar to eukaryotic translation
           initiation factor 4A, isoform 1, transcript variant 2
           (LOC642784), mRNA
          Length = 1302

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| |  || || |||||||||||||| || | |||||||||||| 
Sbjct: 968 aggtcatagttgatgactaaagaaacctgctgcacatcaatgcctctggccagcaggtca 909

                
Query: 370 gtggt 374
           |||||
Sbjct: 908 gtggt 904



to top

>dbj|AK166674.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:I0C0049P03 product:eukaryotic
            translation initiation factor 4A1, full insert sequence
          Length = 1773

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1063 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1004

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1003 gtggt 999



to top

>dbj|AK152210.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830055B02 product:eukaryotic
           translation initiation factor 4A1, full insert sequence
          Length = 1555

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
           ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 844 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 785

                
Query: 370 gtggt 374
           |||||
Sbjct: 784 gtggt 780



to top

>dbj|AK168780.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920054E16 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1772

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>dbj|AK168697.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:I920046E13 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1772

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1062 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1003

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1002 gtggt 998



to top

>dbj|AK166572.1| Mus musculus 4 cells embryo 4 cells cDNA, RIKEN full-length enriched
            library, clone:I0C0030E09 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1775

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1063 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1004

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1003 gtggt 999



to top

>dbj|AK166527.1| Mus musculus 4 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:I0C0001J18 product:eukaryotic
            translation initiation factor 4A1, full insert sequence
          Length = 1772

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>dbj|AK166439.1| Mus musculus mammary gland RCB-0527 Jyg-MC(B) cDNA, RIKEN full-length
            enriched library, clone:G930019J01 product:eukaryotic
            translation initiation factor 4A1, full insert sequence
          Length = 1760

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1061 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 1002

                 
Query: 370  gtggt 374
            |||||
Sbjct: 1001 gtggt 997



to top

>dbj|AK162017.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
            region cDNA, RIKEN full-length enriched library,
            clone:6720488M12 product:eukaryotic translation
            initiation factor 4A1, full insert sequence
          Length = 1704

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 310  aggtcatagttgatgacaaggganacttgctgcacatcaataccacgggccagcaggtcg 369
            ||||||||||||||||| | ||| || |||||||||||||| || | ||||| |||||| 
Sbjct: 1017 aggtcatagttgatgactaaggagacctgctgcacatcaatgcctctggccaacaggtca 958

                 
Query: 370  gtggt 374
            |||||
Sbjct: 957  gtggt 953


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,518,928
Number of Sequences: 3902068
Number of extensions: 2518928
Number of successful extensions: 47284
Number of sequences better than 10.0: 517
Number of HSP's better than 10.0 without gapping: 513
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 46433
Number of HSP's gapped (non-prelim): 738
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top