Clone Information

BLAST Search Result

Clone Name	rbags6f22
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AF542969.2\| Triticum aestivum ribosomal protein L19 mRNA, com...	88	7e-15
2	emb\|CR730601.2\|CNS0GQOE Tetraodon nigroviridis full-length cDNA	44	0.100
3	emb\|CR725565.1\|CNS0GMSJ Tetraodon nigroviridis full-length cDNA	44	0.100
4	emb\|CR701659.2\|CNS0G4CN Tetraodon nigroviridis full-length cDNA	44	0.100
5	emb\|CR670272.2\|CNS0FG5I Tetraodon nigroviridis full-length cDNA	44	0.100
6	emb\|CR666708.2\|CNS0FDEI Tetraodon nigroviridis full-length cDNA	44	0.100
7	emb\|CR666702.1\|CNS0FDEC Tetraodon nigroviridis full-length cDNA	44	0.100
8	emb\|CR665691.2\|CNS0FCM9 Tetraodon nigroviridis full-length cDNA	44	0.100
9	emb\|CR663076.2\|CNS0FALM Tetraodon nigroviridis full-length cDNA	44	0.100
10	emb\|CR674700.2\|CNS0FJKI Tetraodon nigroviridis full-length cDNA	42	0.39
11	gb\|AY104244.1\| Zea mays PCO075323 mRNA sequence	42	0.39
12	ref\|XM_534494.2\| PREDICTED: Canis familiaris similar to cyclin A...	40	1.6
13	emb\|CR734938.2\|CNS0GTUX Tetraodon nigroviridis full-length cDNA	40	1.6
14	emb\|CR734860.2\|CNS0GTSR Tetraodon nigroviridis full-length cDNA	40	1.6
15	emb\|CR734745.2\|CNS0GTPK Tetraodon nigroviridis full-length cDNA	40	1.6
16	emb\|CR734619.2\|CNS0GTM2 Tetraodon nigroviridis full-length cDNA	40	1.6
17	emb\|CR734317.2\|CNS0GTDO Tetraodon nigroviridis full-length cDNA	40	1.6
18	emb\|CR734201.2\|CNS0GTAG Tetraodon nigroviridis full-length cDNA	40	1.6
19	emb\|CR674675.2\|CNS0FJJT Tetraodon nigroviridis full-length cDNA	40	1.6
20	emb\|CR669989.2\|CNS0FFXN Tetraodon nigroviridis full-length cDNA	40	1.6
21	emb\|CR665304.2\|CNS0FCBI Tetraodon nigroviridis full-length cDNA	40	1.6
22	emb\|CR663336.2\|CNS0FASU Tetraodon nigroviridis full-length cDNA	40	1.6
23	emb\|CR679070.2\|CNS0FMX6 Tetraodon nigroviridis full-length cDNA	40	1.6
24	emb\|CR678868.2\|CNS0FMRK Tetraodon nigroviridis full-length cDNA	40	1.6
25	emb\|CR675606.2\|CNS0FK9O Tetraodon nigroviridis full-length cDNA	40	1.6
26	emb\|CR733921.2\|CNS0GT2O Tetraodon nigroviridis full-length cDNA	40	1.6
27	emb\|CR733890.2\|CNS0GT1T Tetraodon nigroviridis full-length cDNA	40	1.6
28	emb\|CR733527.2\|CNS0GSRQ Tetraodon nigroviridis full-length cDNA	40	1.6
29	emb\|CR733521.2\|CNS0GSRK Tetraodon nigroviridis full-length cDNA	40	1.6
30	emb\|CR733736.2\|CNS0GSXJ Tetraodon nigroviridis full-length cDNA	40	1.6
31	emb\|CR733705.2\|CNS0GSWO Tetraodon nigroviridis full-length cDNA	40	1.6
32	emb\|CR733407.2\|CNS0GSOO Tetraodon nigroviridis full-length cDNA	40	1.6
33	emb\|CR733171.2\|CNS0GSL0 Tetraodon nigroviridis full-length cDNA	40	1.6
34	emb\|CR733146.2\|CNS0GSKM Tetraodon nigroviridis full-length cDNA	40	1.6
35	emb\|CR732834.2\|CNS0GSDY Tetraodon nigroviridis full-length cDNA	40	1.6
36	emb\|CR732787.2\|CNS0GSCU Tetraodon nigroviridis full-length cDNA	40	1.6
37	emb\|CR733017.1\|CNS0GSI9 Tetraodon nigroviridis full-length cDNA	40	1.6
38	emb\|CR733000.1\|CNS0GSHV Tetraodon nigroviridis full-length cDNA	40	1.6
39	emb\|CR732678.2\|CNS0GSA2 Tetraodon nigroviridis full-length cDNA	40	1.6
40	emb\|CR732624.2\|CNS0GS8L Tetraodon nigroviridis full-length cDNA	40	1.6
41	emb\|CR732541.2\|CNS0GS6A Tetraodon nigroviridis full-length cDNA	40	1.6
42	emb\|CR732527.2\|CNS0GS5W Tetraodon nigroviridis full-length cDNA	40	1.6
43	emb\|CR732475.2\|CNS0GS4G Tetraodon nigroviridis full-length cDNA	40	1.6
44	emb\|CR732352.2\|CNS0GS11 Tetraodon nigroviridis full-length cDNA	40	1.6
45	emb\|CR732285.2\|CNS0GRZ6 Tetraodon nigroviridis full-length cDNA	40	1.6
46	emb\|CR732550.1\|CNS0GS6J Tetraodon nigroviridis full-length cDNA	40	1.6
47	emb\|CR732516.1\|CNS0GS5L Tetraodon nigroviridis full-length cDNA	40	1.6
48	emb\|CR732234.2\|CNS0GRXR Tetraodon nigroviridis full-length cDNA	40	1.6
49	emb\|CR732116.2\|CNS0GRUH Tetraodon nigroviridis full-length cDNA	40	1.6
50	emb\|CR732086.2\|CNS0GRTN Tetraodon nigroviridis full-length cDNA	40	1.6
51	emb\|CR732006.2\|CNS0GRRF Tetraodon nigroviridis full-length cDNA	40	1.6
52	emb\|CR731943.2\|CNS0GRPO Tetraodon nigroviridis full-length cDNA	40	1.6
53	emb\|CR731942.2\|CNS0GRPN Tetraodon nigroviridis full-length cDNA	40	1.6
54	emb\|CR731863.2\|CNS0GRNG Tetraodon nigroviridis full-length cDNA	40	1.6
55	emb\|CR731768.2\|CNS0GRKT Tetraodon nigroviridis full-length cDNA	40	1.6
56	emb\|CR731748.2\|CNS0GRK9 Tetraodon nigroviridis full-length cDNA	40	1.6
57	emb\|CR731913.1\|CNS0GROU Tetraodon nigroviridis full-length cDNA	40	1.6
58	emb\|CR731709.2\|CNS0GRJ6 Tetraodon nigroviridis full-length cDNA	40	1.6
59	emb\|CR731490.2\|CNS0GRD3 Tetraodon nigroviridis full-length cDNA	40	1.6
60	emb\|CR731489.2\|CNS0GRD2 Tetraodon nigroviridis full-length cDNA	40	1.6
61	emb\|CR731487.2\|CNS0GRD0 Tetraodon nigroviridis full-length cDNA	40	1.6
62	emb\|CR731350.2\|CNS0GR97 Tetraodon nigroviridis full-length cDNA	40	1.6
63	emb\|CR731274.2\|CNS0GR73 Tetraodon nigroviridis full-length cDNA	40	1.6
64	emb\|CR731259.2\|CNS0GR6O Tetraodon nigroviridis full-length cDNA	40	1.6
65	emb\|CR731697.1\|CNS0GRIU Tetraodon nigroviridis full-length cDNA	40	1.6
66	emb\|CR731209.2\|CNS0GR5A Tetraodon nigroviridis full-length cDNA	40	1.6
67	emb\|CR731161.2\|CNS0GR3Y Tetraodon nigroviridis full-length cDNA	40	1.6
68	emb\|CR731122.2\|CNS0GR2V Tetraodon nigroviridis full-length cDNA	40	1.6
69	emb\|CR731059.2\|CNS0GR14 Tetraodon nigroviridis full-length cDNA	40	1.6
70	emb\|CR730764.2\|CNS0GQSX Tetraodon nigroviridis full-length cDNA	40	1.6
71	emb\|CR730736.2\|CNS0GQS5 Tetraodon nigroviridis full-length cDNA	40	1.6
72	emb\|CR730730.2\|CNS0GQRZ Tetraodon nigroviridis full-length cDNA	40	1.6
73	emb\|CR730636.2\|CNS0GQPD Tetraodon nigroviridis full-length cDNA	40	1.6
74	emb\|CR730453.2\|CNS0GQKA Tetraodon nigroviridis full-length cDNA	40	1.6
75	emb\|CR730445.2\|CNS0GQK2 Tetraodon nigroviridis full-length cDNA	40	1.6
76	emb\|CR730400.2\|CNS0GQIT Tetraodon nigroviridis full-length cDNA	40	1.6
77	emb\|CR730359.2\|CNS0GQHO Tetraodon nigroviridis full-length cDNA	40	1.6
78	emb\|CR730352.2\|CNS0GQHH Tetraodon nigroviridis full-length cDNA	40	1.6
79	emb\|CR730543.1\|CNS0GQMS Tetraodon nigroviridis full-length cDNA	40	1.6
80	emb\|CR730350.1\|CNS0GQHF Tetraodon nigroviridis full-length cDNA	40	1.6
81	emb\|CR730237.1\|CNS0GQEB Tetraodon nigroviridis full-length cDNA	40	1.6
82	emb\|CR730101.2\|CNS0GQAJ Tetraodon nigroviridis full-length cDNA	40	1.6
83	emb\|CR730023.2\|CNS0GQ8D Tetraodon nigroviridis full-length cDNA	40	1.6
84	emb\|CR729895.2\|CNS0GQ4T Tetraodon nigroviridis full-length cDNA	40	1.6
85	emb\|CR729802.2\|CNS0GQ28 Tetraodon nigroviridis full-length cDNA	40	1.6
86	emb\|CR729759.2\|CNS0GQ11 Tetraodon nigroviridis full-length cDNA	40	1.6
87	emb\|CR730008.1\|CNS0GQ7Y Tetraodon nigroviridis full-length cDNA	40	1.6
88	emb\|CR729595.2\|CNS0GPWH Tetraodon nigroviridis full-length cDNA	40	1.6
89	emb\|CR729540.2\|CNS0GPUY Tetraodon nigroviridis full-length cDNA	40	1.6
90	emb\|CR729523.2\|CNS0GPUH Tetraodon nigroviridis full-length cDNA	40	1.6
91	emb\|CR729479.2\|CNS0GPT9 Tetraodon nigroviridis full-length cDNA	40	1.6
92	emb\|CR729476.2\|CNS0GPT6 Tetraodon nigroviridis full-length cDNA	40	1.6
93	emb\|CR729461.2\|CNS0GPSR Tetraodon nigroviridis full-length cDNA	40	1.6
94	emb\|CR729392.2\|CNS0GPQU Tetraodon nigroviridis full-length cDNA	40	1.6
95	emb\|CR729384.2\|CNS0GPQM Tetraodon nigroviridis full-length cDNA	40	1.6
96	emb\|CR729353.2\|CNS0GPPR Tetraodon nigroviridis full-length cDNA	40	1.6
97	emb\|CR729321.2\|CNS0GPOV Tetraodon nigroviridis full-length cDNA	40	1.6
98	emb\|CR729208.2\|CNS0GPLQ Tetraodon nigroviridis full-length cDNA	40	1.6
99	emb\|CR729126.2\|CNS0GPJG Tetraodon nigroviridis full-length cDNA	40	1.6
100	emb\|CR729048.2\|CNS0GPHA Tetraodon nigroviridis full-length cDNA	40	1.6
101	emb\|CR728810.2\|CNS0GPAO Tetraodon nigroviridis full-length cDNA	40	1.6
102	emb\|CR728802.2\|CNS0GPAG Tetraodon nigroviridis full-length cDNA	40	1.6
103	emb\|CR728751.2\|CNS0GP91 Tetraodon nigroviridis full-length cDNA	40	1.6
104	emb\|CR728744.2\|CNS0GP8U Tetraodon nigroviridis full-length cDNA	40	1.6
105	emb\|CR728704.2\|CNS0GP7Q Tetraodon nigroviridis full-length cDNA	40	1.6
106	emb\|CR728853.1\|CNS0GPBV Tetraodon nigroviridis full-length cDNA	40	1.6
107	emb\|CR728729.1\|CNS0GP8F Tetraodon nigroviridis full-length cDNA	40	1.6
108	emb\|CR728599.2\|CNS0GP4T Tetraodon nigroviridis full-length cDNA	40	1.6
109	emb\|CR728477.2\|CNS0GP1F Tetraodon nigroviridis full-length cDNA	40	1.6
110	emb\|CR728401.2\|CNS0GOZB Tetraodon nigroviridis full-length cDNA	40	1.6
111	emb\|CR728366.2\|CNS0GOYC Tetraodon nigroviridis full-length cDNA	40	1.6
112	emb\|CR728355.2\|CNS0GOY1 Tetraodon nigroviridis full-length cDNA	40	1.6
113	emb\|CR728273.2\|CNS0GOVR Tetraodon nigroviridis full-length cDNA	40	1.6
114	emb\|CR728246.2\|CNS0GOV0 Tetraodon nigroviridis full-length cDNA	40	1.6
115	emb\|CR728233.2\|CNS0GOUN Tetraodon nigroviridis full-length cDNA	40	1.6
116	emb\|CR728363.1\|CNS0GOY9 Tetraodon nigroviridis full-length cDNA	40	1.6
117	emb\|CR728131.2\|CNS0GORT Tetraodon nigroviridis full-length cDNA	40	1.6
118	emb\|CR728120.2\|CNS0GORI Tetraodon nigroviridis full-length cDNA	40	1.6
119	emb\|CR728090.2\|CNS0GOQO Tetraodon nigroviridis full-length cDNA	40	1.6
120	emb\|CR728077.2\|CNS0GOQB Tetraodon nigroviridis full-length cDNA	40	1.6
121	emb\|CR727845.2\|CNS0GOJV Tetraodon nigroviridis full-length cDNA	40	1.6
122	emb\|CR727809.2\|CNS0GOIV Tetraodon nigroviridis full-length cDNA	40	1.6
123	emb\|CR727774.2\|CNS0GOHW Tetraodon nigroviridis full-length cDNA	40	1.6
124	emb\|CR727770.2\|CNS0GOHS Tetraodon nigroviridis full-length cDNA	40	1.6
125	emb\|CR727768.2\|CNS0GOHQ Tetraodon nigroviridis full-length cDNA	40	1.6
126	emb\|CR727700.2\|CNS0GOFU Tetraodon nigroviridis full-length cDNA	40	1.6
127	emb\|CR727698.2\|CNS0GOFS Tetraodon nigroviridis full-length cDNA	40	1.6
128	emb\|CR727855.1\|CNS0GOK5 Tetraodon nigroviridis full-length cDNA	40	1.6
129	emb\|CR727511.2\|CNS0GOAL Tetraodon nigroviridis full-length cDNA	40	1.6
130	emb\|CR727452.2\|CNS0GO8Y Tetraodon nigroviridis full-length cDNA	40	1.6
131	emb\|CR727328.2\|CNS0GO5I Tetraodon nigroviridis full-length cDNA	40	1.6
132	emb\|CR727264.2\|CNS0GO3Q Tetraodon nigroviridis full-length cDNA	40	1.6
133	emb\|CR727230.2\|CNS0GO2S Tetraodon nigroviridis full-length cDNA	40	1.6
134	emb\|CR727197.2\|CNS0GO1V Tetraodon nigroviridis full-length cDNA	40	1.6
135	emb\|CR727468.1\|CNS0GO9E Tetraodon nigroviridis full-length cDNA	40	1.6
136	emb\|CR727082.2\|CNS0GNYO Tetraodon nigroviridis full-length cDNA	40	1.6
137	emb\|CR727060.2\|CNS0GNY2 Tetraodon nigroviridis full-length cDNA	40	1.6
138	emb\|CR726968.2\|CNS0GNVI Tetraodon nigroviridis full-length cDNA	40	1.6
139	emb\|CR726930.2\|CNS0GNUG Tetraodon nigroviridis full-length cDNA	40	1.6
140	emb\|CR726905.2\|CNS0GNTR Tetraodon nigroviridis full-length cDNA	40	1.6
141	emb\|CR726785.2\|CNS0GNQF Tetraodon nigroviridis full-length cDNA	40	1.6
142	emb\|CR726748.2\|CNS0GNPE Tetraodon nigroviridis full-length cDNA	40	1.6
143	emb\|CR726769.1\|CNS0GNPZ Tetraodon nigroviridis full-length cDNA	40	1.6
144	emb\|CR726597.2\|CNS0GNL7 Tetraodon nigroviridis full-length cDNA	40	1.6
145	emb\|CR726514.2\|CNS0GNIW Tetraodon nigroviridis full-length cDNA	40	1.6
146	emb\|CR726461.2\|CNS0GNHF Tetraodon nigroviridis full-length cDNA	40	1.6
147	emb\|CR726437.2\|CNS0GNGR Tetraodon nigroviridis full-length cDNA	40	1.6
148	emb\|CR726399.2\|CNS0GNFP Tetraodon nigroviridis full-length cDNA	40	1.6
149	emb\|CR726381.2\|CNS0GNF7 Tetraodon nigroviridis full-length cDNA	40	1.6
150	emb\|CR726309.2\|CNS0GND7 Tetraodon nigroviridis full-length cDNA	40	1.6
151	emb\|CR726206.2\|CNS0GNAC Tetraodon nigroviridis full-length cDNA	40	1.6
152	emb\|CR726196.2\|CNS0GNA2 Tetraodon nigroviridis full-length cDNA	40	1.6
153	emb\|CR726132.2\|CNS0GN8A Tetraodon nigroviridis full-length cDNA	40	1.6
154	emb\|CR726077.2\|CNS0GN6R Tetraodon nigroviridis full-length cDNA	40	1.6
155	emb\|CR725958.2\|CNS0GN3G Tetraodon nigroviridis full-length cDNA	40	1.6
156	emb\|CR725938.2\|CNS0GN2W Tetraodon nigroviridis full-length cDNA	40	1.6
157	emb\|CR725897.2\|CNS0GN1R Tetraodon nigroviridis full-length cDNA	40	1.6
158	emb\|CR725343.2\|CNS0GMMD Tetraodon nigroviridis full-length cDNA	40	1.6
159	emb\|CR725771.2\|CNS0GMY9 Tetraodon nigroviridis full-length cDNA	40	1.6
160	emb\|CR725738.2\|CNS0GMXC Tetraodon nigroviridis full-length cDNA	40	1.6
161	emb\|CR725654.2\|CNS0GMV0 Tetraodon nigroviridis full-length cDNA	40	1.6
162	emb\|CR725159.2\|CNS0GMH9 Tetraodon nigroviridis full-length cDNA	40	1.6
163	emb\|CR725155.2\|CNS0GMH5 Tetraodon nigroviridis full-length cDNA	40	1.6
164	emb\|CR725112.2\|CNS0GMFY Tetraodon nigroviridis full-length cDNA	40	1.6
165	emb\|CR725078.2\|CNS0GMF0 Tetraodon nigroviridis full-length cDNA	40	1.6
166	emb\|CR725138.1\|CNS0GMGO Tetraodon nigroviridis full-length cDNA	40	1.6
167	emb\|CR725006.2\|CNS0GMD0 Tetraodon nigroviridis full-length cDNA	40	1.6
168	emb\|CR724070.2\|CNS0GLN0 Tetraodon nigroviridis full-length cDNA	40	1.6
169	emb\|CR724338.1\|CNS0GLUG Tetraodon nigroviridis full-length cDNA	40	1.6
170	emb\|CR724015.2\|CNS0GLLH Tetraodon nigroviridis full-length cDNA	40	1.6
171	emb\|CR724596.2\|CNS0GM1M Tetraodon nigroviridis full-length cDNA	40	1.6
172	emb\|CR724667.1\|CNS0GM3L Tetraodon nigroviridis full-length cDNA	40	1.6
173	emb\|CR724565.1\|CNS0GM0R Tetraodon nigroviridis full-length cDNA	40	1.6
174	emb\|CR724528.2\|CNS0GLZQ Tetraodon nigroviridis full-length cDNA	40	1.6
175	emb\|CR724360.2\|CNS0GLV2 Tetraodon nigroviridis full-length cDNA	40	1.6
176	emb\|CR724300.2\|CNS0GLTE Tetraodon nigroviridis full-length cDNA	40	1.6
177	emb\|CR724282.2\|CNS0GLSW Tetraodon nigroviridis full-length cDNA	40	1.6
178	emb\|CR724280.2\|CNS0GLSU Tetraodon nigroviridis full-length cDNA	40	1.6
179	emb\|CR724253.2\|CNS0GLS3 Tetraodon nigroviridis full-length cDNA	40	1.6
180	emb\|CR724251.2\|CNS0GLS1 Tetraodon nigroviridis full-length cDNA	40	1.6
181	emb\|CR724205.2\|CNS0GLQR Tetraodon nigroviridis full-length cDNA	40	1.6
182	emb\|CR724188.2\|CNS0GLQA Tetraodon nigroviridis full-length cDNA	40	1.6
183	emb\|CR724181.2\|CNS0GLQ3 Tetraodon nigroviridis full-length cDNA	40	1.6
184	emb\|CR724168.2\|CNS0GLPQ Tetraodon nigroviridis full-length cDNA	40	1.6
185	emb\|CR723912.2\|CNS0GLIM Tetraodon nigroviridis full-length cDNA	40	1.6
186	emb\|CR723911.2\|CNS0GLIL Tetraodon nigroviridis full-length cDNA	40	1.6
187	emb\|CR723764.2\|CNS0GLEI Tetraodon nigroviridis full-length cDNA	40	1.6
188	emb\|CR723745.2\|CNS0GLDZ Tetraodon nigroviridis full-length cDNA	40	1.6
189	emb\|CR723671.2\|CNS0GLBX Tetraodon nigroviridis full-length cDNA	40	1.6
190	emb\|CR723564.2\|CNS0GL8Y Tetraodon nigroviridis full-length cDNA	40	1.6
191	emb\|CR723560.2\|CNS0GL8U Tetraodon nigroviridis full-length cDNA	40	1.6
192	emb\|CR723534.2\|CNS0GL84 Tetraodon nigroviridis full-length cDNA	40	1.6
193	emb\|CR723422.2\|CNS0GL50 Tetraodon nigroviridis full-length cDNA	40	1.6
194	emb\|CR723376.2\|CNS0GL3Q Tetraodon nigroviridis full-length cDNA	40	1.6
195	emb\|CR723358.2\|CNS0GL38 Tetraodon nigroviridis full-length cDNA	40	1.6
196	emb\|CR723250.2\|CNS0GL08 Tetraodon nigroviridis full-length cDNA	40	1.6
197	emb\|CR723440.1\|CNS0GL5I Tetraodon nigroviridis full-length cDNA	40	1.6
198	emb\|CR704785.2\|CNS0G6RH Tetraodon nigroviridis full-length cDNA	40	1.6
199	emb\|CR704638.2\|CNS0G6NE Tetraodon nigroviridis full-length cDNA	40	1.6
200	emb\|CR704437.2\|CNS0G6HT Tetraodon nigroviridis full-length cDNA	40	1.6
201	emb\|CR704152.2\|CNS0G69W Tetraodon nigroviridis full-length cDNA	40	1.6
202	emb\|CR704013.2\|CNS0G661 Tetraodon nigroviridis full-length cDNA	40	1.6
203	emb\|CR703966.2\|CNS0G64Q Tetraodon nigroviridis full-length cDNA	40	1.6
204	emb\|CR703408.2\|CNS0G5P8 Tetraodon nigroviridis full-length cDNA	40	1.6
205	emb\|CR702969.2\|CNS0G5D1 Tetraodon nigroviridis full-length cDNA	40	1.6
206	emb\|CR702718.2\|CNS0G562 Tetraodon nigroviridis full-length cDNA	40	1.6
207	emb\|CR701374.2\|CNS0G44Q Tetraodon nigroviridis full-length cDNA	40	1.6
208	emb\|CR699783.2\|CNS0G2WJ Tetraodon nigroviridis full-length cDNA	40	1.6
209	emb\|CR700355.1\|CNS0G3CF Tetraodon nigroviridis full-length cDNA	40	1.6
210	emb\|CR699574.2\|CNS0G2QQ Tetraodon nigroviridis full-length cDNA	40	1.6
211	emb\|CR699486.2\|CNS0G2OA Tetraodon nigroviridis full-length cDNA	40	1.6
212	emb\|CR699308.2\|CNS0G2JC Tetraodon nigroviridis full-length cDNA	40	1.6
213	emb\|CR699110.2\|CNS0G2DU Tetraodon nigroviridis full-length cDNA	40	1.6
214	emb\|CR699082.2\|CNS0G2D2 Tetraodon nigroviridis full-length cDNA	40	1.6
215	emb\|CR698802.2\|CNS0G25A Tetraodon nigroviridis full-length cDNA	40	1.6
216	emb\|CR698139.2\|CNS0G1MV Tetraodon nigroviridis full-length cDNA	40	1.6
217	emb\|CR697716.2\|CNS0G1B4 Tetraodon nigroviridis full-length cDNA	40	1.6
218	emb\|CR696613.2\|CNS0G0GH Tetraodon nigroviridis full-length cDNA	40	1.6
219	emb\|CR696489.2\|CNS0G0D1 Tetraodon nigroviridis full-length cDNA	40	1.6
220	emb\|CR696377.2\|CNS0G09X Tetraodon nigroviridis full-length cDNA	40	1.6
221	emb\|CR696169.2\|CNS0G045 Tetraodon nigroviridis full-length cDNA	40	1.6
222	emb\|CR695863.2\|CNS0FZVN Tetraodon nigroviridis full-length cDNA	40	1.6
223	emb\|CR695350.2\|CNS0FZHE Tetraodon nigroviridis full-length cDNA	40	1.6
224	emb\|CR692024.2\|CNS0FWX0 Tetraodon nigroviridis full-length cDNA	40	1.6
225	emb\|CR695077.2\|CNS0FZ9T Tetraodon nigroviridis full-length cDNA	40	1.6
226	emb\|CR694910.2\|CNS0FZ56 Tetraodon nigroviridis full-length cDNA	40	1.6
227	emb\|CR694798.2\|CNS0FZ22 Tetraodon nigroviridis full-length cDNA	40	1.6
228	emb\|CR694700.2\|CNS0FYZC Tetraodon nigroviridis full-length cDNA	40	1.6
229	emb\|CR694477.2\|CNS0FYT5 Tetraodon nigroviridis full-length cDNA	40	1.6
230	emb\|CR694091.2\|CNS0FYIF Tetraodon nigroviridis full-length cDNA	40	1.6
231	emb\|CR694048.2\|CNS0FYH8 Tetraodon nigroviridis full-length cDNA	40	1.6
232	emb\|CR693278.2\|CNS0FXVU Tetraodon nigroviridis full-length cDNA	40	1.6
233	emb\|CR693275.1\|CNS0FXVR Tetraodon nigroviridis full-length cDNA	40	1.6
234	emb\|CR693057.2\|CNS0FXPP Tetraodon nigroviridis full-length cDNA	40	1.6
235	emb\|CR692936.2\|CNS0FXMC Tetraodon nigroviridis full-length cDNA	40	1.6
236	emb\|CR692775.2\|CNS0FXHV Tetraodon nigroviridis full-length cDNA	40	1.6
237	emb\|CR692006.2\|CNS0FWWI Tetraodon nigroviridis full-length cDNA	40	1.6
238	emb\|CR691739.2\|CNS0FWP3 Tetraodon nigroviridis full-length cDNA	40	1.6
239	emb\|CR691469.1\|CNS0FWHL Tetraodon nigroviridis full-length cDNA	40	1.6
240	emb\|CR685948.2\|CNS0FS88 Tetraodon nigroviridis full-length cDNA	40	1.6
241	emb\|CR690788.2\|CNS0FVYO Tetraodon nigroviridis full-length cDNA	40	1.6
242	emb\|CR690630.2\|CNS0FVUA Tetraodon nigroviridis full-length cDNA	40	1.6
243	emb\|CR690305.2\|CNS0FVL9 Tetraodon nigroviridis full-length cDNA	40	1.6
244	emb\|CR688034.2\|CNS0FTU6 Tetraodon nigroviridis full-length cDNA	40	1.6
245	emb\|CR687568.2\|CNS0FTH8 Tetraodon nigroviridis full-length cDNA	40	1.6
246	emb\|CR687349.2\|CNS0FTB5 Tetraodon nigroviridis full-length cDNA	40	1.6
247	emb\|CR686388.2\|CNS0FSKG Tetraodon nigroviridis full-length cDNA	40	1.6
248	emb\|CR685713.2\|CNS0FS1P Tetraodon nigroviridis full-length cDNA	40	1.6
249	emb\|CR685007.2\|CNS0FRI3 Tetraodon nigroviridis full-length cDNA	40	1.6
250	emb\|CR684453.2\|CNS0FR2P Tetraodon nigroviridis full-length cDNA	40	1.6
251	emb\|CR682922.2\|CNS0FPW6 Tetraodon nigroviridis full-length cDNA	40	1.6
252	emb\|CR682801.2\|CNS0FPST Tetraodon nigroviridis full-length cDNA	40	1.6
253	emb\|CR682337.2\|CNS0FPFX Tetraodon nigroviridis full-length cDNA	40	1.6
254	emb\|CR681713.2\|CNS0FOYL Tetraodon nigroviridis full-length cDNA	40	1.6
255	emb\|CR681617.2\|CNS0FOVX Tetraodon nigroviridis full-length cDNA	40	1.6
256	emb\|CR681259.2\|CNS0FOLZ Tetraodon nigroviridis full-length cDNA	40	1.6
257	emb\|CR681245.2\|CNS0FOLL Tetraodon nigroviridis full-length cDNA	40	1.6
258	emb\|CR681233.2\|CNS0FOL9 Tetraodon nigroviridis full-length cDNA	40	1.6
259	emb\|CR681212.2\|CNS0FOKO Tetraodon nigroviridis full-length cDNA	40	1.6
260	emb\|CR681203.2\|CNS0FOKF Tetraodon nigroviridis full-length cDNA	40	1.6
261	emb\|CR681186.2\|CNS0FOJY Tetraodon nigroviridis full-length cDNA	40	1.6
262	emb\|CR681181.2\|CNS0FOJT Tetraodon nigroviridis full-length cDNA	40	1.6
263	emb\|CR681173.2\|CNS0FOJL Tetraodon nigroviridis full-length cDNA	40	1.6
264	emb\|CR681169.2\|CNS0FOJH Tetraodon nigroviridis full-length cDNA	40	1.6
265	emb\|CR681164.2\|CNS0FOJC Tetraodon nigroviridis full-length cDNA	40	1.6
266	emb\|CR681147.2\|CNS0FOIV Tetraodon nigroviridis full-length cDNA	40	1.6
267	emb\|CR681106.2\|CNS0FOHQ Tetraodon nigroviridis full-length cDNA	40	1.6
268	emb\|CR681093.2\|CNS0FOHD Tetraodon nigroviridis full-length cDNA	40	1.6
269	emb\|CR681089.2\|CNS0FOH9 Tetraodon nigroviridis full-length cDNA	40	1.6
270	emb\|CR681087.2\|CNS0FOH7 Tetraodon nigroviridis full-length cDNA	40	1.6
271	emb\|CR681065.2\|CNS0FOGL Tetraodon nigroviridis full-length cDNA	40	1.6
272	emb\|CR681059.2\|CNS0FOGF Tetraodon nigroviridis full-length cDNA	40	1.6
273	emb\|CR681053.2\|CNS0FOG9 Tetraodon nigroviridis full-length cDNA	40	1.6
274	emb\|CR681421.2\|CNS0FOQH Tetraodon nigroviridis full-length cDNA	40	1.6
275	emb\|CR681418.2\|CNS0FOQE Tetraodon nigroviridis full-length cDNA	40	1.6
276	emb\|CR681412.2\|CNS0FOQ8 Tetraodon nigroviridis full-length cDNA	40	1.6
277	emb\|CR681407.2\|CNS0FOQ3 Tetraodon nigroviridis full-length cDNA	40	1.6
278	emb\|CR681375.2\|CNS0FOP7 Tetraodon nigroviridis full-length cDNA	40	1.6
279	emb\|CR681373.2\|CNS0FOP5 Tetraodon nigroviridis full-length cDNA	40	1.6
280	emb\|CR681362.2\|CNS0FOOU Tetraodon nigroviridis full-length cDNA	40	1.6
281	emb\|CR681357.2\|CNS0FOOP Tetraodon nigroviridis full-length cDNA	40	1.6
282	emb\|CR681345.2\|CNS0FOOD Tetraodon nigroviridis full-length cDNA	40	1.6
283	emb\|CR681317.2\|CNS0FONL Tetraodon nigroviridis full-length cDNA	40	1.6
284	emb\|CR681297.2\|CNS0FON1 Tetraodon nigroviridis full-length cDNA	40	1.6
285	emb\|CR681291.2\|CNS0FOMV Tetraodon nigroviridis full-length cDNA	40	1.6
286	emb\|CR681287.2\|CNS0FOMR Tetraodon nigroviridis full-length cDNA	40	1.6
287	emb\|CR681265.2\|CNS0FOM5 Tetraodon nigroviridis full-length cDNA	40	1.6
288	emb\|CR681038.2\|CNS0FOFU Tetraodon nigroviridis full-length cDNA	40	1.6
289	emb\|CR681036.2\|CNS0FOFS Tetraodon nigroviridis full-length cDNA	40	1.6
290	emb\|CR681033.2\|CNS0FOFP Tetraodon nigroviridis full-length cDNA	40	1.6
291	emb\|CR681013.2\|CNS0FOF5 Tetraodon nigroviridis full-length cDNA	40	1.6
292	emb\|CR681000.2\|CNS0FOES Tetraodon nigroviridis full-length cDNA	40	1.6
293	emb\|CR680996.2\|CNS0FOEO Tetraodon nigroviridis full-length cDNA	40	1.6
294	emb\|CR680994.2\|CNS0FOEM Tetraodon nigroviridis full-length cDNA	40	1.6
295	emb\|CR680974.2\|CNS0FOE2 Tetraodon nigroviridis full-length cDNA	40	1.6
296	emb\|CR680962.2\|CNS0FODQ Tetraodon nigroviridis full-length cDNA	40	1.6
297	emb\|CR680922.2\|CNS0FOCM Tetraodon nigroviridis full-length cDNA	40	1.6
298	emb\|CR680909.2\|CNS0FOC9 Tetraodon nigroviridis full-length cDNA	40	1.6
299	emb\|CR680901.2\|CNS0FOC1 Tetraodon nigroviridis full-length cDNA	40	1.6
300	emb\|CR680898.2\|CNS0FOBY Tetraodon nigroviridis full-length cDNA	40	1.6
301	emb\|CR680870.2\|CNS0FOB6 Tetraodon nigroviridis full-length cDNA	40	1.6
302	emb\|CR680818.2\|CNS0FO9Q Tetraodon nigroviridis full-length cDNA	40	1.6
303	emb\|CR680814.2\|CNS0FO9M Tetraodon nigroviridis full-length cDNA	40	1.6
304	emb\|CR680812.2\|CNS0FO9K Tetraodon nigroviridis full-length cDNA	40	1.6
305	emb\|CR680800.2\|CNS0FO98 Tetraodon nigroviridis full-length cDNA	40	1.6
306	emb\|CR681102.1\|CNS0FOHM Tetraodon nigroviridis full-length cDNA	40	1.6
307	emb\|CR680948.1\|CNS0FODC Tetraodon nigroviridis full-length cDNA	40	1.6
308	emb\|CR680760.2\|CNS0FO84 Tetraodon nigroviridis full-length cDNA	40	1.6
309	emb\|CR680754.2\|CNS0FO7Y Tetraodon nigroviridis full-length cDNA	40	1.6
310	emb\|CR680738.2\|CNS0FO7I Tetraodon nigroviridis full-length cDNA	40	1.6
311	emb\|CR680732.2\|CNS0FO7C Tetraodon nigroviridis full-length cDNA	40	1.6
312	emb\|CR680722.2\|CNS0FO72 Tetraodon nigroviridis full-length cDNA	40	1.6
313	emb\|CR680699.2\|CNS0FO6F Tetraodon nigroviridis full-length cDNA	40	1.6
314	emb\|CR680614.2\|CNS0FO42 Tetraodon nigroviridis full-length cDNA	40	1.6
315	emb\|CR680604.2\|CNS0FO3S Tetraodon nigroviridis full-length cDNA	40	1.6
316	emb\|CR680598.2\|CNS0FO3M Tetraodon nigroviridis full-length cDNA	40	1.6
317	emb\|CR680582.2\|CNS0FO36 Tetraodon nigroviridis full-length cDNA	40	1.6
318	emb\|CR680581.2\|CNS0FO35 Tetraodon nigroviridis full-length cDNA	40	1.6
319	emb\|CR680569.2\|CNS0FO2T Tetraodon nigroviridis full-length cDNA	40	1.6
320	emb\|CR680560.2\|CNS0FO2K Tetraodon nigroviridis full-length cDNA	40	1.6
321	emb\|CR680557.2\|CNS0FO2H Tetraodon nigroviridis full-length cDNA	40	1.6
322	emb\|CR680550.2\|CNS0FO2A Tetraodon nigroviridis full-length cDNA	40	1.6
323	emb\|CR680545.2\|CNS0FO25 Tetraodon nigroviridis full-length cDNA	40	1.6
324	emb\|CR680544.2\|CNS0FO24 Tetraodon nigroviridis full-length cDNA	40	1.6
325	emb\|CR680525.2\|CNS0FO1L Tetraodon nigroviridis full-length cDNA	40	1.6
326	emb\|CR680519.2\|CNS0FO1F Tetraodon nigroviridis full-length cDNA	40	1.6
327	emb\|CR680501.2\|CNS0FO0X Tetraodon nigroviridis full-length cDNA	40	1.6
328	emb\|CR680498.2\|CNS0FO0U Tetraodon nigroviridis full-length cDNA	40	1.6
329	emb\|CR680493.2\|CNS0FO0P Tetraodon nigroviridis full-length cDNA	40	1.6
330	emb\|CR680477.2\|CNS0FO09 Tetraodon nigroviridis full-length cDNA	40	1.6
331	emb\|CR680476.2\|CNS0FO08 Tetraodon nigroviridis full-length cDNA	40	1.6
332	emb\|CR680474.2\|CNS0FO06 Tetraodon nigroviridis full-length cDNA	40	1.6
333	emb\|CR680463.2\|CNS0FNZV Tetraodon nigroviridis full-length cDNA	40	1.6
334	emb\|CR680461.2\|CNS0FNZT Tetraodon nigroviridis full-length cDNA	40	1.6
335	emb\|CR680459.2\|CNS0FNZR Tetraodon nigroviridis full-length cDNA	40	1.6
336	emb\|CR680431.2\|CNS0FNYZ Tetraodon nigroviridis full-length cDNA	40	1.6
337	emb\|CR680408.2\|CNS0FNYC Tetraodon nigroviridis full-length cDNA	40	1.6
338	emb\|CR680393.2\|CNS0FNXX Tetraodon nigroviridis full-length cDNA	40	1.6
339	emb\|CR680368.2\|CNS0FNX8 Tetraodon nigroviridis full-length cDNA	40	1.6
340	emb\|CR680352.2\|CNS0FNWS Tetraodon nigroviridis full-length cDNA	40	1.6
341	emb\|CR680346.2\|CNS0FNWM Tetraodon nigroviridis full-length cDNA	40	1.6
342	emb\|CR680341.2\|CNS0FNWH Tetraodon nigroviridis full-length cDNA	40	1.6
343	emb\|CR680322.2\|CNS0FNVY Tetraodon nigroviridis full-length cDNA	40	1.6
344	emb\|CR680292.2\|CNS0FNV4 Tetraodon nigroviridis full-length cDNA	40	1.6
345	emb\|CR680289.2\|CNS0FNV1 Tetraodon nigroviridis full-length cDNA	40	1.6
346	emb\|CR680287.2\|CNS0FNUZ Tetraodon nigroviridis full-length cDNA	40	1.6
347	emb\|CR680282.2\|CNS0FNUU Tetraodon nigroviridis full-length cDNA	40	1.6
348	emb\|CR680275.2\|CNS0FNUN Tetraodon nigroviridis full-length cDNA	40	1.6
349	emb\|CR680274.2\|CNS0FNUM Tetraodon nigroviridis full-length cDNA	40	1.6
350	emb\|CR680587.1\|CNS0FO3B Tetraodon nigroviridis full-length cDNA	40	1.6
351	emb\|CR680166.2\|CNS0FNRM Tetraodon nigroviridis full-length cDNA	40	1.6
352	emb\|CR680071.2\|CNS0FNOZ Tetraodon nigroviridis full-length cDNA	40	1.6
353	emb\|CR680064.2\|CNS0FNOS Tetraodon nigroviridis full-length cDNA	40	1.6
354	emb\|CR680044.2\|CNS0FNO8 Tetraodon nigroviridis full-length cDNA	40	1.6
355	emb\|CR680018.2\|CNS0FNNI Tetraodon nigroviridis full-length cDNA	40	1.6
356	emb\|CR680013.2\|CNS0FNND Tetraodon nigroviridis full-length cDNA	40	1.6
357	emb\|CR679982.2\|CNS0FNMI Tetraodon nigroviridis full-length cDNA	40	1.6
358	emb\|CR679980.2\|CNS0FNMG Tetraodon nigroviridis full-length cDNA	40	1.6
359	emb\|CR679979.2\|CNS0FNMF Tetraodon nigroviridis full-length cDNA	40	1.6
360	emb\|CR679950.2\|CNS0FNLM Tetraodon nigroviridis full-length cDNA	40	1.6
361	emb\|CR679943.2\|CNS0FNLF Tetraodon nigroviridis full-length cDNA	40	1.6
362	emb\|CR679879.2\|CNS0FNJN Tetraodon nigroviridis full-length cDNA	40	1.6
363	emb\|CR679856.2\|CNS0FNJ0 Tetraodon nigroviridis full-length cDNA	40	1.6
364	emb\|CR679837.2\|CNS0FNIH Tetraodon nigroviridis full-length cDNA	40	1.6
365	emb\|CR679817.2\|CNS0FNHX Tetraodon nigroviridis full-length cDNA	40	1.6
366	emb\|CR679804.2\|CNS0FNHK Tetraodon nigroviridis full-length cDNA	40	1.6
367	emb\|CR679779.2\|CNS0FNGV Tetraodon nigroviridis full-length cDNA	40	1.6
368	emb\|CR679770.2\|CNS0FNGM Tetraodon nigroviridis full-length cDNA	40	1.6
369	emb\|CR679761.2\|CNS0FNGD Tetraodon nigroviridis full-length cDNA	40	1.6
370	emb\|CR679753.2\|CNS0FNG5 Tetraodon nigroviridis full-length cDNA	40	1.6
371	emb\|CR679721.2\|CNS0FNF9 Tetraodon nigroviridis full-length cDNA	40	1.6
372	emb\|CR679787.1\|CNS0FNH3 Tetraodon nigroviridis full-length cDNA	40	1.6
373	emb\|CR679764.1\|CNS0FNGG Tetraodon nigroviridis full-length cDNA	40	1.6
374	emb\|CR679706.2\|CNS0FNEU Tetraodon nigroviridis full-length cDNA	40	1.6
375	emb\|CR679694.2\|CNS0FNEI Tetraodon nigroviridis full-length cDNA	40	1.6
376	emb\|CR679688.2\|CNS0FNEC Tetraodon nigroviridis full-length cDNA	40	1.6
377	emb\|CR679677.2\|CNS0FNE1 Tetraodon nigroviridis full-length cDNA	40	1.6
378	emb\|CR679661.2\|CNS0FNDL Tetraodon nigroviridis full-length cDNA	40	1.6
379	emb\|CR679652.2\|CNS0FNDC Tetraodon nigroviridis full-length cDNA	40	1.6
380	emb\|CR679635.2\|CNS0FNCV Tetraodon nigroviridis full-length cDNA	40	1.6
381	emb\|CR679631.2\|CNS0FNCR Tetraodon nigroviridis full-length cDNA	40	1.6
382	emb\|CR679609.2\|CNS0FNC5 Tetraodon nigroviridis full-length cDNA	40	1.6
383	emb\|CR679602.2\|CNS0FNBY Tetraodon nigroviridis full-length cDNA	40	1.6
384	emb\|CR679272.2\|CNS0FN2S Tetraodon nigroviridis full-length cDNA	40	1.6
385	emb\|CR679259.2\|CNS0FN2F Tetraodon nigroviridis full-length cDNA	40	1.6
386	emb\|CR679240.2\|CNS0FN1W Tetraodon nigroviridis full-length cDNA	40	1.6
387	emb\|CR679227.2\|CNS0FN1J Tetraodon nigroviridis full-length cDNA	40	1.6
388	emb\|CR679225.2\|CNS0FN1H Tetraodon nigroviridis full-length cDNA	40	1.6
389	emb\|CR679615.1\|CNS0FNCB Tetraodon nigroviridis full-length cDNA	40	1.6
390	emb\|CR679589.1\|CNS0FNBL Tetraodon nigroviridis full-length cDNA	40	1.6
391	emb\|CR679289.1\|CNS0FN39 Tetraodon nigroviridis full-length cDNA	40	1.6
392	emb\|CR679211.1\|CNS0FN13 Tetraodon nigroviridis full-length cDNA	40	1.6
393	emb\|CR679197.2\|CNS0FN0P Tetraodon nigroviridis full-length cDNA	40	1.6
394	emb\|CR679194.2\|CNS0FN0M Tetraodon nigroviridis full-length cDNA	40	1.6
395	emb\|CR679175.2\|CNS0FN03 Tetraodon nigroviridis full-length cDNA	40	1.6
396	emb\|CR679581.2\|CNS0FNBD Tetraodon nigroviridis full-length cDNA	40	1.6
397	emb\|CR679571.2\|CNS0FNB3 Tetraodon nigroviridis full-length cDNA	40	1.6
398	emb\|CR679537.2\|CNS0FNA5 Tetraodon nigroviridis full-length cDNA	40	1.6
399	emb\|CR679519.2\|CNS0FN9N Tetraodon nigroviridis full-length cDNA	40	1.6
400	emb\|CR679506.2\|CNS0FN9A Tetraodon nigroviridis full-length cDNA	40	1.6
401	emb\|CR679491.2\|CNS0FN8V Tetraodon nigroviridis full-length cDNA	40	1.6
402	emb\|CR679472.2\|CNS0FN8C Tetraodon nigroviridis full-length cDNA	40	1.6
403	emb\|CR679464.2\|CNS0FN84 Tetraodon nigroviridis full-length cDNA	40	1.6
404	emb\|CR679459.2\|CNS0FN7Z Tetraodon nigroviridis full-length cDNA	40	1.6
405	emb\|CR679448.2\|CNS0FN7O Tetraodon nigroviridis full-length cDNA	40	1.6
406	emb\|CR679447.2\|CNS0FN7N Tetraodon nigroviridis full-length cDNA	40	1.6
407	emb\|CR679422.2\|CNS0FN6Y Tetraodon nigroviridis full-length cDNA	40	1.6
408	emb\|CR679415.2\|CNS0FN6R Tetraodon nigroviridis full-length cDNA	40	1.6
409	emb\|CR679400.2\|CNS0FN6C Tetraodon nigroviridis full-length cDNA	40	1.6
410	emb\|CR679396.2\|CNS0FN68 Tetraodon nigroviridis full-length cDNA	40	1.6
411	emb\|CR679381.2\|CNS0FN5T Tetraodon nigroviridis full-length cDNA	40	1.6
412	emb\|CR679377.2\|CNS0FN5P Tetraodon nigroviridis full-length cDNA	40	1.6
413	emb\|CR679371.2\|CNS0FN5J Tetraodon nigroviridis full-length cDNA	40	1.6
414	emb\|CR679368.2\|CNS0FN5G Tetraodon nigroviridis full-length cDNA	40	1.6
415	emb\|CR678932.2\|CNS0FMTC Tetraodon nigroviridis full-length cDNA	40	1.6
416	emb\|CR678920.2\|CNS0FMT0 Tetraodon nigroviridis full-length cDNA	40	1.6
417	emb\|CR678897.2\|CNS0FMSD Tetraodon nigroviridis full-length cDNA	40	1.6
418	emb\|CR678893.2\|CNS0FMS9 Tetraodon nigroviridis full-length cDNA	40	1.6
419	emb\|CR678892.2\|CNS0FMS8 Tetraodon nigroviridis full-length cDNA	40	1.6
420	emb\|CR678890.2\|CNS0FMS6 Tetraodon nigroviridis full-length cDNA	40	1.6
421	emb\|CR678821.2\|CNS0FMQ9 Tetraodon nigroviridis full-length cDNA	40	1.6
422	emb\|CR678819.2\|CNS0FMQ7 Tetraodon nigroviridis full-length cDNA	40	1.6
423	emb\|CR678813.2\|CNS0FMQ1 Tetraodon nigroviridis full-length cDNA	40	1.6
424	emb\|CR678812.2\|CNS0FMQ0 Tetraodon nigroviridis full-length cDNA	40	1.6
425	emb\|CR678805.2\|CNS0FMPT Tetraodon nigroviridis full-length cDNA	40	1.6
426	emb\|CR678803.2\|CNS0FMPR Tetraodon nigroviridis full-length cDNA	40	1.6
427	emb\|CR678801.2\|CNS0FMPP Tetraodon nigroviridis full-length cDNA	40	1.6
428	emb\|CR678796.2\|CNS0FMPK Tetraodon nigroviridis full-length cDNA	40	1.6
429	emb\|CR678790.2\|CNS0FMPE Tetraodon nigroviridis full-length cDNA	40	1.6
430	emb\|CR678786.2\|CNS0FMPA Tetraodon nigroviridis full-length cDNA	40	1.6
431	emb\|CR678780.2\|CNS0FMP4 Tetraodon nigroviridis full-length cDNA	40	1.6
432	emb\|CR678777.2\|CNS0FMP1 Tetraodon nigroviridis full-length cDNA	40	1.6
433	emb\|CR678773.2\|CNS0FMOX Tetraodon nigroviridis full-length cDNA	40	1.6
434	emb\|CR678749.2\|CNS0FMO9 Tetraodon nigroviridis full-length cDNA	40	1.6
435	emb\|CR678743.2\|CNS0FMO3 Tetraodon nigroviridis full-length cDNA	40	1.6
436	emb\|CR678736.2\|CNS0FMNW Tetraodon nigroviridis full-length cDNA	40	1.6
437	emb\|CR679134.2\|CNS0FMYY Tetraodon nigroviridis full-length cDNA	40	1.6
438	emb\|CR679129.2\|CNS0FMYT Tetraodon nigroviridis full-length cDNA	40	1.6
439	emb\|CR679128.2\|CNS0FMYS Tetraodon nigroviridis full-length cDNA	40	1.6
440	emb\|CR679123.2\|CNS0FMYN Tetraodon nigroviridis full-length cDNA	40	1.6
441	emb\|CR679107.2\|CNS0FMY7 Tetraodon nigroviridis full-length cDNA	40	1.6
442	emb\|CR679096.2\|CNS0FMXW Tetraodon nigroviridis full-length cDNA	40	1.6
443	emb\|CR679086.2\|CNS0FMXM Tetraodon nigroviridis full-length cDNA	40	1.6
444	emb\|CR679059.2\|CNS0FMWV Tetraodon nigroviridis full-length cDNA	40	1.6
445	emb\|CR679043.2\|CNS0FMWF Tetraodon nigroviridis full-length cDNA	40	1.6
446	emb\|CR679026.2\|CNS0FMVY Tetraodon nigroviridis full-length cDNA	40	1.6
447	emb\|CR678994.2\|CNS0FMV2 Tetraodon nigroviridis full-length cDNA	40	1.6
448	emb\|CR678984.2\|CNS0FMUS Tetraodon nigroviridis full-length cDNA	40	1.6
449	emb\|CR678969.2\|CNS0FMUD Tetraodon nigroviridis full-length cDNA	40	1.6
450	emb\|CR678966.2\|CNS0FMUA Tetraodon nigroviridis full-length cDNA	40	1.6
451	emb\|CR678956.2\|CNS0FMU0 Tetraodon nigroviridis full-length cDNA	40	1.6
452	emb\|CR678951.2\|CNS0FMTV Tetraodon nigroviridis full-length cDNA	40	1.6
453	emb\|CR677635.2\|CNS0FLTO Tetraodon nigroviridis full-length cDNA	40	1.6
454	emb\|CR677632.2\|CNS0FLTL Tetraodon nigroviridis full-length cDNA	40	1.6
455	emb\|CR677629.2\|CNS0FLTI Tetraodon nigroviridis full-length cDNA	40	1.6
456	emb\|CR677624.2\|CNS0FLTD Tetraodon nigroviridis full-length cDNA	40	1.6
457	emb\|CR677603.2\|CNS0FLST Tetraodon nigroviridis full-length cDNA	40	1.6
458	emb\|CR677590.2\|CNS0FLSH Tetraodon nigroviridis full-length cDNA	40	1.6
459	emb\|CR677583.2\|CNS0FLSA Tetraodon nigroviridis full-length cDNA	40	1.6
460	emb\|CR677568.2\|CNS0FLRV Tetraodon nigroviridis full-length cDNA	40	1.6
461	emb\|CR677557.2\|CNS0FLRK Tetraodon nigroviridis full-length cDNA	40	1.6
462	emb\|CR677556.2\|CNS0FLRJ Tetraodon nigroviridis full-length cDNA	40	1.6
463	emb\|CR677540.2\|CNS0FLR3 Tetraodon nigroviridis full-length cDNA	40	1.6
464	emb\|CR677529.2\|CNS0FLQS Tetraodon nigroviridis full-length cDNA	40	1.6
465	emb\|CR677528.2\|CNS0FLQR Tetraodon nigroviridis full-length cDNA	40	1.6
466	emb\|CR677526.2\|CNS0FLQP Tetraodon nigroviridis full-length cDNA	40	1.6
467	emb\|CR677517.2\|CNS0FLQG Tetraodon nigroviridis full-length cDNA	40	1.6
468	emb\|CR677494.2\|CNS0FLPU Tetraodon nigroviridis full-length cDNA	40	1.6
469	emb\|CR677478.2\|CNS0FLPE Tetraodon nigroviridis full-length cDNA	40	1.6
470	emb\|CR678414.2\|CNS0FMF2 Tetraodon nigroviridis full-length cDNA	40	1.6
471	emb\|CR678410.2\|CNS0FMEY Tetraodon nigroviridis full-length cDNA	40	1.6
472	emb\|CR678408.2\|CNS0FMEW Tetraodon nigroviridis full-length cDNA	40	1.6
473	emb\|CR678396.2\|CNS0FMEK Tetraodon nigroviridis full-length cDNA	40	1.6
474	emb\|CR678389.2\|CNS0FMED Tetraodon nigroviridis full-length cDNA	40	1.6
475	emb\|CR678382.2\|CNS0FME8 Tetraodon nigroviridis full-length cDNA	40	1.6
476	emb\|CR678341.2\|CNS0FMD3 Tetraodon nigroviridis full-length cDNA	40	1.6
477	emb\|CR678335.2\|CNS0FMCX Tetraodon nigroviridis full-length cDNA	40	1.6
478	emb\|CR678302.2\|CNS0FMC1 Tetraodon nigroviridis full-length cDNA	40	1.6
479	emb\|CR678282.2\|CNS0FMBH Tetraodon nigroviridis full-length cDNA	40	1.6
480	emb\|CR678268.2\|CNS0FMB4 Tetraodon nigroviridis full-length cDNA	40	1.6
481	emb\|CR678255.2\|CNS0FMAR Tetraodon nigroviridis full-length cDNA	40	1.6
482	emb\|CR678239.2\|CNS0FMAB Tetraodon nigroviridis full-length cDNA	40	1.6
483	emb\|CR678230.2\|CNS0FMA2 Tetraodon nigroviridis full-length cDNA	40	1.6
484	emb\|CR678218.2\|CNS0FM9Q Tetraodon nigroviridis full-length cDNA	40	1.6
485	emb\|CR678194.2\|CNS0FM92 Tetraodon nigroviridis full-length cDNA	40	1.6
486	emb\|CR678719.2\|CNS0FMNF Tetraodon nigroviridis full-length cDNA	40	1.6
487	emb\|CR678697.2\|CNS0FMMT Tetraodon nigroviridis full-length cDNA	40	1.6
488	emb\|CR678690.2\|CNS0FMMM Tetraodon nigroviridis full-length cDNA	40	1.6
489	emb\|CR678687.2\|CNS0FMMJ Tetraodon nigroviridis full-length cDNA	40	1.6
490	emb\|CR678686.2\|CNS0FMMI Tetraodon nigroviridis full-length cDNA	40	1.6
491	emb\|CR678682.2\|CNS0FMME Tetraodon nigroviridis full-length cDNA	40	1.6
492	emb\|CR679122.1\|CNS0FMYM Tetraodon nigroviridis full-length cDNA	40	1.6
493	emb\|CR679120.1\|CNS0FMYK Tetraodon nigroviridis full-length cDNA	40	1.6
494	emb\|CR678830.1\|CNS0FMQI Tetraodon nigroviridis full-length cDNA	40	1.6
495	emb\|CR678669.2\|CNS0FMM1 Tetraodon nigroviridis full-length cDNA	40	1.6
496	emb\|CR678665.2\|CNS0FMLX Tetraodon nigroviridis full-length cDNA	40	1.6
497	emb\|CR678653.2\|CNS0FMLL Tetraodon nigroviridis full-length cDNA	40	1.6
498	emb\|CR678622.2\|CNS0FMKQ Tetraodon nigroviridis full-length cDNA	40	1.6
499	emb\|CR678584.2\|CNS0FMJO Tetraodon nigroviridis full-length cDNA	40	1.6
500	emb\|CR678582.2\|CNS0FMJM Tetraodon nigroviridis full-length cDNA	40	1.6

>gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, complete cds
          Length = 854

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 76/84 (90%), Gaps = 2/84 (2%)
 Strand = Plus / Minus

                                                                       
Query: 3   ccaaaattagg-ctaacccttgatgataccagaaag-ctaaagcttcaagtcagaccttc 60
           ||||||||||| |||||| || ||  |||||||||| ||||||||||| |||||| ||||
Sbjct: 696 ccaaaattagggctaacctttcatagtaccagaaaggctaaagcttcatgtcagaacttc 637

                                   
Query: 61  acttcttggccttctttggtgccg 84
           ||||||||||||||||||||||||
Sbjct: 636 acttcttggccttctttggtgccg 613



 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 108 gccgctggtgccggtgcatgatct 131
           ||||||||||| ||||||||||||
Sbjct: 598 gccgctggtgctggtgcatgatct 575

to top

>emb|CR730601.2|CNS0GQOE Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 82 cttcttggccttctttggtgcc 61

to top

>emb|CR725565.1|CNS0GMSJ Tetraodon nigroviridis full-length cDNA
          Length = 1233

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 70 cttcttggccttctttggtgcc 49

to top

>emb|CR701659.2|CNS0G4CN Tetraodon nigroviridis full-length cDNA
          Length = 528

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 84 cttcttggccttctttggtgcc 63

to top

>emb|CR670272.2|CNS0FG5I Tetraodon nigroviridis full-length cDNA
          Length = 1038

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 55 cttcttggccttctttggtgcc 34

to top

>emb|CR666708.2|CNS0FDEI Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 78 cttcttggccttctttggtgcc 57

to top

>emb|CR666702.1|CNS0FDEC Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 79 cttcttggccttctttggtgcc 58

to top

>emb|CR665691.2|CNS0FCM9 Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 82 cttcttggccttctttggtgcc 61

to top

>emb|CR663076.2|CNS0FALM Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.100
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 62 cttcttggccttctttggtgcc 83
          ||||||||||||||||||||||
Sbjct: 82 cttcttggccttctttggtgcc 61

to top

>emb|CR674700.2|CNS0FJKI Tetraodon nigroviridis full-length cDNA
          Length = 809

 Score = 42.1 bits (21), Expect = 0.39
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 64  tcttggccttctttggtgccg 84
           |||||||||||||||||||||
Sbjct: 156 tcttggccttctttggtgccg 136

to top

>gb|AY104244.1| Zea mays PCO075323 mRNA sequence
          Length = 924

 Score = 42.1 bits (21), Expect = 0.39
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 58  ttcacttcttggccttctttggtgc 82
           |||||||||| ||||||||||||||
Sbjct: 700 ttcacttcttcgccttctttggtgc 676

to top

>ref|XM_534494.2| PREDICTED: Canis familiaris similar to cyclin A1 (predicted)
           (LOC477302), mRNA
          Length = 1586

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 46  tcaagtcagaccttcacttc 65
           ||||||||||||||||||||
Sbjct: 485 tcaagtcagaccttcacttc 504

to top

>emb|CR734938.2|CNS0GTUX Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR734860.2|CNS0GTSR Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR734745.2|CNS0GTPK Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR734619.2|CNS0GTM2 Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR734317.2|CNS0GTDO Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR734201.2|CNS0GTAG Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR674675.2|CNS0FJJT Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR669989.2|CNS0FFXN Tetraodon nigroviridis full-length cDNA
          Length = 722

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR665304.2|CNS0FCBI Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR663336.2|CNS0FASU Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR679070.2|CNS0FMX6 Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR678868.2|CNS0FMRK Tetraodon nigroviridis full-length cDNA
          Length = 724

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR675606.2|CNS0FK9O Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733921.2|CNS0GT2O Tetraodon nigroviridis full-length cDNA
          Length = 725

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733890.2|CNS0GT1T Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR733527.2|CNS0GSRQ Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733521.2|CNS0GSRK Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 85 tcttggccttctttggtgcc 66

to top

>emb|CR733736.2|CNS0GSXJ Tetraodon nigroviridis full-length cDNA
          Length = 720

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733705.2|CNS0GSWO Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR733407.2|CNS0GSOO Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR733171.2|CNS0GSL0 Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733146.2|CNS0GSKM Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 65 tcttggccttctttggtgcc 46

to top

>emb|CR732834.2|CNS0GSDY Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR732787.2|CNS0GSCU Tetraodon nigroviridis full-length cDNA
          Length = 1102

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR733017.1|CNS0GSI9 Tetraodon nigroviridis full-length cDNA
          Length = 1097

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 64  tcttggccttctttggtgcc 83
           ||||||||||||||||||||
Sbjct: 112 tcttggccttctttggtgcc 93

to top

>emb|CR733000.1|CNS0GSHV Tetraodon nigroviridis full-length cDNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 65 tcttggccttctttggtgcc 46

to top

>emb|CR732678.2|CNS0GSA2 Tetraodon nigroviridis full-length cDNA
          Length = 977

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR732624.2|CNS0GS8L Tetraodon nigroviridis full-length cDNA
          Length = 1201

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR732541.2|CNS0GS6A Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR732527.2|CNS0GS5W Tetraodon nigroviridis full-length cDNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR732475.2|CNS0GS4G Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR732352.2|CNS0GS11 Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR732285.2|CNS0GRZ6 Tetraodon nigroviridis full-length cDNA
          Length = 1229

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 66 tcttggccttctttggtgcc 47

to top

>emb|CR732550.1|CNS0GS6J Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR732516.1|CNS0GS5L Tetraodon nigroviridis full-length cDNA
          Length = 1256

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 73 tcttggccttctttggtgcc 54

to top

>emb|CR732234.2|CNS0GRXR Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR732116.2|CNS0GRUH Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR732086.2|CNS0GRTN Tetraodon nigroviridis full-length cDNA
          Length = 1054

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR732006.2|CNS0GRRF Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR731943.2|CNS0GRPO Tetraodon nigroviridis full-length cDNA
          Length = 1222

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR731942.2|CNS0GRPN Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731863.2|CNS0GRNG Tetraodon nigroviridis full-length cDNA
          Length = 1256

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR731768.2|CNS0GRKT Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR731748.2|CNS0GRK9 Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731913.1|CNS0GROU Tetraodon nigroviridis full-length cDNA
          Length = 1363

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR731709.2|CNS0GRJ6 Tetraodon nigroviridis full-length cDNA
          Length = 1268

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731490.2|CNS0GRD3 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR731489.2|CNS0GRD2 Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731487.2|CNS0GRD0 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731350.2|CNS0GR97 Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731274.2|CNS0GR73 Tetraodon nigroviridis full-length cDNA
          Length = 1269

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731259.2|CNS0GR6O Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731697.1|CNS0GRIU Tetraodon nigroviridis full-length cDNA
          Length = 1234

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR731209.2|CNS0GR5A Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR731161.2|CNS0GR3Y Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR731122.2|CNS0GR2V Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731059.2|CNS0GR14 Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730764.2|CNS0GQSX Tetraodon nigroviridis full-length cDNA
          Length = 1064

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR730736.2|CNS0GQS5 Tetraodon nigroviridis full-length cDNA
          Length = 1029

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR730730.2|CNS0GQRZ Tetraodon nigroviridis full-length cDNA
          Length = 1233

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 55 tcttggccttctttggtgcc 36

to top

>emb|CR730636.2|CNS0GQPD Tetraodon nigroviridis full-length cDNA
          Length = 1160

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR730453.2|CNS0GQKA Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730445.2|CNS0GQK2 Tetraodon nigroviridis full-length cDNA
          Length = 1087

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730400.2|CNS0GQIT Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730359.2|CNS0GQHO Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR730352.2|CNS0GQHH Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730543.1|CNS0GQMS Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR730350.1|CNS0GQHF Tetraodon nigroviridis full-length cDNA
          Length = 1247

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR730237.1|CNS0GQEB Tetraodon nigroviridis full-length cDNA
          Length = 1059

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 64 tcttggccttctttggtgcc 45

to top

>emb|CR730101.2|CNS0GQAJ Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR730023.2|CNS0GQ8D Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729895.2|CNS0GQ4T Tetraodon nigroviridis full-length cDNA
          Length = 1249

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR729802.2|CNS0GQ28 Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729759.2|CNS0GQ11 Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR730008.1|CNS0GQ7Y Tetraodon nigroviridis full-length cDNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR729595.2|CNS0GPWH Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR729540.2|CNS0GPUY Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR729523.2|CNS0GPUH Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR729479.2|CNS0GPT9 Tetraodon nigroviridis full-length cDNA
          Length = 1075

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR729476.2|CNS0GPT6 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729461.2|CNS0GPSR Tetraodon nigroviridis full-length cDNA
          Length = 1073

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR729392.2|CNS0GPQU Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729384.2|CNS0GPQM Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR729353.2|CNS0GPPR Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729321.2|CNS0GPOV Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 45 tcttggccttctttggtgcc 26

to top

>emb|CR729208.2|CNS0GPLQ Tetraodon nigroviridis full-length cDNA
          Length = 1094

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR729126.2|CNS0GPJG Tetraodon nigroviridis full-length cDNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR729048.2|CNS0GPHA Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR728810.2|CNS0GPAO Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR728802.2|CNS0GPAG Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728751.2|CNS0GP91 Tetraodon nigroviridis full-length cDNA
          Length = 1250

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR728744.2|CNS0GP8U Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR728704.2|CNS0GP7Q Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR728853.1|CNS0GPBV Tetraodon nigroviridis full-length cDNA
          Length = 1219

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR728729.1|CNS0GP8F Tetraodon nigroviridis full-length cDNA
          Length = 1063

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR728599.2|CNS0GP4T Tetraodon nigroviridis full-length cDNA
          Length = 1381

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728477.2|CNS0GP1F Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728401.2|CNS0GOZB Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR728366.2|CNS0GOYC Tetraodon nigroviridis full-length cDNA
          Length = 1259

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 85 tcttggccttctttggtgcc 66

to top

>emb|CR728355.2|CNS0GOY1 Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR728273.2|CNS0GOVR Tetraodon nigroviridis full-length cDNA
          Length = 1211

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR728246.2|CNS0GOV0 Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR728233.2|CNS0GOUN Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728363.1|CNS0GOY9 Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR728131.2|CNS0GORT Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR728120.2|CNS0GORI Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728090.2|CNS0GOQO Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728077.2|CNS0GOQB Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 66 tcttggccttctttggtgcc 47

to top

>emb|CR727845.2|CNS0GOJV Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727809.2|CNS0GOIV Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727774.2|CNS0GOHW Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR727770.2|CNS0GOHS Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR727768.2|CNS0GOHQ Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR727700.2|CNS0GOFU Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR727698.2|CNS0GOFS Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727855.1|CNS0GOK5 Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR727511.2|CNS0GOAL Tetraodon nigroviridis full-length cDNA
          Length = 1203

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR727452.2|CNS0GO8Y Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727328.2|CNS0GO5I Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 67 tcttggccttctttggtgcc 48

to top

>emb|CR727264.2|CNS0GO3Q Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR727230.2|CNS0GO2S Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727197.2|CNS0GO1V Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR727468.1|CNS0GO9E Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR727082.2|CNS0GNYO Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 84 tcttggccttctttggtgcc 65

to top

>emb|CR727060.2|CNS0GNY2 Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726968.2|CNS0GNVI Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726930.2|CNS0GNUG Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR726905.2|CNS0GNTR Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR726785.2|CNS0GNQF Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR726748.2|CNS0GNPE Tetraodon nigroviridis full-length cDNA
          Length = 1069

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR726769.1|CNS0GNPZ Tetraodon nigroviridis full-length cDNA
          Length = 1210

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR726597.2|CNS0GNL7 Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 49 tcttggccttctttggtgcc 30

to top

>emb|CR726514.2|CNS0GNIW Tetraodon nigroviridis full-length cDNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR726461.2|CNS0GNHF Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726437.2|CNS0GNGR Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR726399.2|CNS0GNFP Tetraodon nigroviridis full-length cDNA
          Length = 1383

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR726381.2|CNS0GNF7 Tetraodon nigroviridis full-length cDNA
          Length = 1387

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726309.2|CNS0GND7 Tetraodon nigroviridis full-length cDNA
          Length = 1140

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR726206.2|CNS0GNAC Tetraodon nigroviridis full-length cDNA
          Length = 717

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR726196.2|CNS0GNA2 Tetraodon nigroviridis full-length cDNA
          Length = 1082

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR726132.2|CNS0GN8A Tetraodon nigroviridis full-length cDNA
          Length = 1246

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR726077.2|CNS0GN6R Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 85 tcttggccttctttggtgcc 66

to top

>emb|CR725958.2|CNS0GN3G Tetraodon nigroviridis full-length cDNA
          Length = 1137

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 64  tcttggccttctttggtgcc 83
           ||||||||||||||||||||
Sbjct: 129 tcttggccttctttggtgcc 110

to top

>emb|CR725938.2|CNS0GN2W Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR725897.2|CNS0GN1R Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR725343.2|CNS0GMMD Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR725771.2|CNS0GMY9 Tetraodon nigroviridis full-length cDNA
          Length = 1025

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR725738.2|CNS0GMXC Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR725654.2|CNS0GMV0 Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR725159.2|CNS0GMH9 Tetraodon nigroviridis full-length cDNA
          Length = 1070

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR725155.2|CNS0GMH5 Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR725112.2|CNS0GMFY Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR725078.2|CNS0GMF0 Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR725138.1|CNS0GMGO Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR725006.2|CNS0GMD0 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724070.2|CNS0GLN0 Tetraodon nigroviridis full-length cDNA
          Length = 1260

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR724338.1|CNS0GLUG Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR724015.2|CNS0GLLH Tetraodon nigroviridis full-length cDNA
          Length = 1091

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR724596.2|CNS0GM1M Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR724667.1|CNS0GM3L Tetraodon nigroviridis full-length cDNA
          Length = 1066

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR724565.1|CNS0GM0R Tetraodon nigroviridis full-length cDNA
          Length = 1247

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR724528.2|CNS0GLZQ Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724360.2|CNS0GLV2 Tetraodon nigroviridis full-length cDNA
          Length = 723

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 84 tcttggccttctttggtgcc 65

to top

>emb|CR724300.2|CNS0GLTE Tetraodon nigroviridis full-length cDNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724282.2|CNS0GLSW Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724280.2|CNS0GLSU Tetraodon nigroviridis full-length cDNA
          Length = 1078

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR724253.2|CNS0GLS3 Tetraodon nigroviridis full-length cDNA
          Length = 1225

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR724251.2|CNS0GLS1 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724205.2|CNS0GLQR Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR724188.2|CNS0GLQA Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724181.2|CNS0GLQ3 Tetraodon nigroviridis full-length cDNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR724168.2|CNS0GLPQ Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR723912.2|CNS0GLIM Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723911.2|CNS0GLIL Tetraodon nigroviridis full-length cDNA
          Length = 1249

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR723764.2|CNS0GLEI Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR723745.2|CNS0GLDZ Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723671.2|CNS0GLBX Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR723564.2|CNS0GL8Y Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723560.2|CNS0GL8U Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723534.2|CNS0GL84 Tetraodon nigroviridis full-length cDNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723422.2|CNS0GL50 Tetraodon nigroviridis full-length cDNA
          Length = 1076

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR723376.2|CNS0GL3Q Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723358.2|CNS0GL38 Tetraodon nigroviridis full-length cDNA
          Length = 1260

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723250.2|CNS0GL08 Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR723440.1|CNS0GL5I Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR704785.2|CNS0G6RH Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR704638.2|CNS0G6NE Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR704437.2|CNS0G6HT Tetraodon nigroviridis full-length cDNA
          Length = 723

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR704152.2|CNS0G69W Tetraodon nigroviridis full-length cDNA
          Length = 722

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR704013.2|CNS0G661 Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR703966.2|CNS0G64Q Tetraodon nigroviridis full-length cDNA
          Length = 1042

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR703408.2|CNS0G5P8 Tetraodon nigroviridis full-length cDNA
          Length = 733

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR702969.2|CNS0G5D1 Tetraodon nigroviridis full-length cDNA
          Length = 1055

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 66 tcttggccttctttggtgcc 47

to top

>emb|CR702718.2|CNS0G562 Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR701374.2|CNS0G44Q Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR699783.2|CNS0G2WJ Tetraodon nigroviridis full-length cDNA
          Length = 1070

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR700355.1|CNS0G3CF Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR699574.2|CNS0G2QQ Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR699486.2|CNS0G2OA Tetraodon nigroviridis full-length cDNA
          Length = 722

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR699308.2|CNS0G2JC Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR699110.2|CNS0G2DU Tetraodon nigroviridis full-length cDNA
          Length = 717

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR699082.2|CNS0G2D2 Tetraodon nigroviridis full-length cDNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR698802.2|CNS0G25A Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR698139.2|CNS0G1MV Tetraodon nigroviridis full-length cDNA
          Length = 725

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR697716.2|CNS0G1B4 Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR696613.2|CNS0G0GH Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR696489.2|CNS0G0D1 Tetraodon nigroviridis full-length cDNA
          Length = 1064

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR696377.2|CNS0G09X Tetraodon nigroviridis full-length cDNA
          Length = 1078

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR696169.2|CNS0G045 Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR695863.2|CNS0FZVN Tetraodon nigroviridis full-length cDNA
          Length = 1054

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR695350.2|CNS0FZHE Tetraodon nigroviridis full-length cDNA
          Length = 1078

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR692024.2|CNS0FWX0 Tetraodon nigroviridis full-length cDNA
          Length = 725

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR695077.2|CNS0FZ9T Tetraodon nigroviridis full-length cDNA
          Length = 1229

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR694910.2|CNS0FZ56 Tetraodon nigroviridis full-length cDNA
          Length = 1204

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 56 tcttggccttctttggtgcc 37

to top

>emb|CR694798.2|CNS0FZ22 Tetraodon nigroviridis full-length cDNA
          Length = 1069

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR694700.2|CNS0FYZC Tetraodon nigroviridis full-length cDNA
          Length = 1059

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 73 tcttggccttctttggtgcc 54

to top

>emb|CR694477.2|CNS0FYT5 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR694091.2|CNS0FYIF Tetraodon nigroviridis full-length cDNA
          Length = 721

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR694048.2|CNS0FYH8 Tetraodon nigroviridis full-length cDNA
          Length = 717

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR693278.2|CNS0FXVU Tetraodon nigroviridis full-length cDNA
          Length = 1007

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR693275.1|CNS0FXVR Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR693057.2|CNS0FXPP Tetraodon nigroviridis full-length cDNA
          Length = 1068

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR692936.2|CNS0FXMC Tetraodon nigroviridis full-length cDNA
          Length = 1061

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR692775.2|CNS0FXHV Tetraodon nigroviridis full-length cDNA
          Length = 687

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR692006.2|CNS0FWWI Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR691739.2|CNS0FWP3 Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR691469.1|CNS0FWHL Tetraodon nigroviridis full-length cDNA
          Length = 1073

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR685948.2|CNS0FS88 Tetraodon nigroviridis full-length cDNA
          Length = 1008

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR690788.2|CNS0FVYO Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR690630.2|CNS0FVUA Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR690305.2|CNS0FVL9 Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR688034.2|CNS0FTU6 Tetraodon nigroviridis full-length cDNA
          Length = 714

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR687568.2|CNS0FTH8 Tetraodon nigroviridis full-length cDNA
          Length = 1249

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR687349.2|CNS0FTB5 Tetraodon nigroviridis full-length cDNA
          Length = 1029

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR686388.2|CNS0FSKG Tetraodon nigroviridis full-length cDNA
          Length = 411

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR685713.2|CNS0FS1P Tetraodon nigroviridis full-length cDNA
          Length = 1203

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 59 tcttggccttctttggtgcc 40

to top

>emb|CR685007.2|CNS0FRI3 Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR684453.2|CNS0FR2P Tetraodon nigroviridis full-length cDNA
          Length = 1067

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 64 tcttggccttctttggtgcc 83
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 908,545
Number of Sequences: 3902068
Number of extensions: 908545
Number of successful extensions: 59743
Number of sequences better than 10.0: 2351
Number of HSP's better than 10.0 without gapping: 2351
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57387
Number of HSP's gapped (non-prelim): 2356
length of query: 131
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 110
effective length of database: 17,151,101,840
effective search space: 1886621202400
effective search space used: 1886621202400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result