ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags6f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|CT737399.2| Pan troglodytes chromosome X clone CH251-213G08 ... 46 0.14
2dbj|AP006403.1| Lotus japonicus genomic DNA, chromosome 1, clone... 46 0.14
3gb|AY273696.1| Dendrobium crumenatum specimen_voucher M.W.K.Goh ... 44 0.56
4gb|AF503704.1| Thunia alba trnL-trnF intergenic spacer, chloropl... 44 0.56
5gb|AF503703.1| Dendrochilum longifolium trnL-trnF intergenic spa... 44 0.56
6gb|AF503702.1| Pleione x lagenaria trnL-trnF intergenic spacer, ... 44 0.56
7gb|AF503701.1| Pleione chunii x Pleione hookeriana trnL-trnF int... 44 0.56
8gb|AF503700.1| Pleione yunnanensis trnL-trnF intergenic spacer, ... 44 0.56
9gb|AF503699.1| Pleione x taliensis trnL-trnF intergenic spacer, ... 44 0.56
10gb|AF503698.1| Pleione scopulorum trnL-trnF intergenic spacer, c... 44 0.56
11gb|AF503697.1| Pleione saxicola trnL-trnF intergenic spacer, chl... 44 0.56
12gb|AF503696.1| Pleione pleionoides isolate 309 trnL-trnF interge... 44 0.56
13gb|AF503695.1| Pleione pleionoides isolate 308 trnL-trnF interge... 44 0.56
14gb|AF503694.1| Pleione praecox trnL-trnF intergenic spacer, chlo... 44 0.56
15gb|AF503693.1| Pleione maculata trnL-trnF intergenic spacer, chl... 44 0.56
16gb|AF503692.1| Pleione limprichtii trnL-trnF intergenic spacer, ... 44 0.56
17gb|AF503691.1| Pleione humilis trnL-trnF intergenic spacer, chlo... 44 0.56
18gb|AF503690.1| Pleione hookeriana isolate 406 trnL-trnF intergen... 44 0.56
19gb|AF503689.1| Pleione hookeriana isolate 322 trnL-trnF intergen... 44 0.56
20gb|AF503688.1| Pleione grandiflora trnL-trnF intergenic spacer, ... 44 0.56
21gb|AF503686.1| Pleione formosana trnL-trnF intergenic spacer, ch... 44 0.56
22gb|AF503685.1| Pleione coronaria trnL-trnF intergenic spacer, ch... 44 0.56
23gb|AF503684.1| Pleione x confusa trnL-trnF intergenic spacer, ch... 44 0.56
24gb|AF503683.1| Pleione chunii trnL-trnF intergenic spacer, chlor... 44 0.56
25gb|AF503681.1| Pleione delavayi trnL-trnF intergenic spacer, chl... 44 0.56
26gb|AF503680.1| Pleione albiflora trnL-trnF intergenic spacer, ch... 44 0.56
27gb|AF463383.1| Pholidota imbricata trnL-trnF intergenic spacer, ... 44 0.56
28gb|AF463382.1| Neogyna gardneriana trnL-trnF intergenic spacer, ... 44 0.56
29gb|AF463381.1| Coelogyne macdonaldii trnL-trnF intergenic spacer... 44 0.56
30gb|AF463380.1| Coelogyne beccarii trnL-trnF intergenic spacer, c... 44 0.56
31gb|AF463379.1| Coelogyne cuprea trnL-trnF intergenic spacer, cho... 44 0.56
32gb|AF463378.1| Coelogyne bilamellata trnL-trnF intergenic spacer... 44 0.56
33gb|AF463377.1| Coelogyne renae trnL-trnF intergenic spacer, chol... 44 0.56
34gb|AF463376.1| Coelogyne naja trnL-trnF intergenic spacer, cholo... 44 0.56
35gb|AF463375.1| Coelogyne monilirachis trnL-trnF intergenic space... 44 0.56
36gb|AF463374.1| Coelogyne longpasiaensis trnL-trnF intergenic spa... 44 0.56
37gb|AF463373.1| Coelogyne kelamensis trnL-trnF intergenic spacer,... 44 0.56
38gb|AF463372.1| Coelogyne incrassata trnL-trnF intergenic spacer,... 44 0.56
39gb|AF463371.1| Coelogyne harana trnL-trnF intergenic spacer, cho... 44 0.56
40gb|AF463370.1| Coelogyne gibbifera trnL-trnF intergenic spacer, ... 44 0.56
41gb|AF463369.1| Coelogyne chanii trnL-trnF intergenic spacer, cho... 44 0.56
42gb|AF519954.1| Eria ferruginea tRNA-Leu (trnL) gene and trnL-trn... 44 0.56
43gb|AF519953.1| Nephelaphyllum pulchrum tRNA-Leu (trnL) gene and ... 44 0.56
44gb|AF519949.1| Malaxis spicata tRNA-Leu (trnL) gene and trnL-trn... 44 0.56
45gb|AF519947.1| Liparis liliifolia tRNA-Leu (trnL) gene and trnL-... 44 0.56
46gb|AF519940.1| Calanthe tricarinata tRNA-Leu (trnL) gene and trn... 44 0.56
47gb|AF519939.1| Bletilla striata tRNA-Leu (trnL) gene and trnL-tr... 44 0.56
48gb|AF519938.1| Entomophobia kinabaluensis tRNA-Leu (trnL) gene a... 44 0.56
49gb|AF519937.1| Coelogyne cristata tRNA-Leu (trnL) gene and trnL-... 44 0.56
50gb|AF519936.1| Pleione chunii tRNA-Leu (trnL) gene and trnL-trnF... 44 0.56
51gb|AF519935.1| Thunia alba tRNA-Leu (trnL) gene and trnL-trnF in... 44 0.56
52gb|AF519933.1| Dendrochilum glumaceum tRNA-Leu (trnL) gene and t... 44 0.56
53gb|AF519932.1| Dilochia sp. Chase O-672 tRNA-Leu (trnL) gene and... 44 0.56
54gb|AF519911.1| Collabium sp. Chase O-821 tRNA-Leu (trnL) gene an... 44 0.56
55emb|AJ409456.1|TEF409456 Tropidia effusa chloroplast tRNA-Leu ge... 44 0.56
56emb|AJ409451.1|SVI409451 Spathoglottis vieillardii chloroplast t... 44 0.56
57emb|AJ409409.1|EBU409409 Eria bulbophylloides chloroplast tRNA-L... 44 0.56
58ref|NM_001017526.1| Homo sapiens Rho GTPase activating protein 8... 42 2.2
59ref|NM_181335.2| Homo sapiens Rho GTPase activating protein 8 (A... 42 2.2
60ref|XM_639087.1| Dictyostelium discoideum histidine kinase (DDB0... 42 2.2
61ref|XM_515189.1| PREDICTED: Pan troglodytes similar to Rho GTPas... 42 2.2
62gb|AC113334.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
63gb|AF544240.1| Homo sapiens BCH domain-containing Cdc42GAP-like ... 42 2.2
64gb|AC122378.4| Mus musculus BAC clone RP23-474C9 from chromosome... 42 2.2
65emb|Z83838.2|HS127B20 Human DNA sequence from clone RP1-127B20 o... 42 2.2
66emb|X96869.1|DDDOKAGEN D.discoideum dokA gene 42 2.2
67gb|BC067824.1| Homo sapiens Rho GTPase activating protein 8, mRN... 42 2.2
68gb|BC059382.1| Homo sapiens Rho GTPase activating protein 8, mRN... 42 2.2
69emb|CR622409.1| full-length cDNA clone CS0DI084YM15 of Placenta ... 42 2.2
70emb|CR619940.1| full-length cDNA clone CS0DI079YF14 of Placenta ... 42 2.2
71emb|CR608243.1| full-length cDNA clone CS0DI084YP04 of Placenta ... 42 2.2
72emb|CR600027.1| full-length cDNA clone CS0DI029YD05 of Placenta ... 42 2.2
73emb|CR597658.1| full-length cDNA clone CS0DI011YB06 of Placenta ... 42 2.2
74dbj|AK001306.1| Homo sapiens cDNA FLJ10444 fis, clone NT2RP10008... 42 2.2
75dbj|AK022305.1| Homo sapiens cDNA FLJ12243 fis, clone MAMMA10013... 42 2.2
76gb|AC091699.6| Homo sapiens chromosome 10 clone RP11-296D9, comp... 42 2.2
77gb|AC022026.7| Homo sapiens chromosome 10 clone RP11-506B4, comp... 42 2.2
78gb|AF195968.1|AF195968 Homo sapiens rho GTPase activating protei... 42 2.2
79gb|BC010490.2| Homo sapiens Rho GTPase activating protein 8, mRN... 42 2.2
80dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
81ref|NM_181334.3| Homo sapiens PRR5-ARHGAP8 fusion (LOC553158), mRNA 42 2.2
82gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067... 42 2.2
83gb|AF519955.1| Podochilus cultratus tRNA-Leu (trnL) gene and trn... 42 2.2
84dbj|AP003777.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.2
85dbj|AP003066.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.2
86gb|AC156998.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.2
87gb|BC048280.1| Homo sapiens Rho GTPase activating protein 8, mRN... 42 2.2
88emb|AL355192.1|HSARHGAP8 Novel human gene mapping to chomosome 22 42 2.2
89ref|XM_511744.1| PREDICTED: Pan troglodytes similar to BC003940 ... 40 8.8
90ref|NM_001031024.1| Gallus gallus syndecan binding protein (synt... 40 8.8
91gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14... 40 8.8
92gb|AY133250.1|AY133250S1 Hordeum vulgare subsp. vulgare starch s... 40 8.8
93gb|BC081272.1| Xenopus laevis MGC86435 protein, mRNA (cDNA clone... 40 8.8
94gb|AC147679.13| Canis Familiaris, clone XX-10F3, complete sequence 40 8.8
95gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 40 8.8
96gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorell... 40 8.8
97gb|BC063557.1| Homo sapiens hypothetical protein LOC348262, mRNA... 40 8.8
98gb|BC019318.1| Homo sapiens hypothetical protein LOC348262, mRNA... 40 8.8
99gb|BC041068.1| Homo sapiens hypothetical protein LOC348262, mRNA... 40 8.8
100gb|BC017108.1| Homo sapiens hypothetical protein LOC348262, mRNA... 40 8.8
101emb|BX537334.4| Human DNA sequence from clone WI2-86101C3 on chr... 40 8.8
102emb|AJ721106.1| Gallus gallus mRNA for hypothetical protein, clo... 40 8.8
103dbj|AK125584.1| Homo sapiens cDNA FLJ43596 fis, clone SMINT2011311 40 8.8
104gb|AC026696.5| Homo sapiens chromosome 5 clone CTC-348L14, compl... 40 8.8
105gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 8.8
106gb|BC094876.1| Homo sapiens cDNA clone IMAGE:6484550 40 8.8
107ref|NM_207368.1| Homo sapiens hypothetical protein LOC348262 (LO... 40 8.8
108emb|BX936107.1| Gallus gallus finished cDNA, clone ChEST489l1 40 8.8
109emb|BX930464.1| Gallus gallus finished cDNA, clone ChEST636o24 40 8.8
110gb|AC007380.3| Homo sapiens BAC clone RP11-150O13 from 2, comple... 40 8.8
111gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156... 40 8.8
112emb|BX649156.1|HSM809308 Homo sapiens mRNA; cDNA DKFZp686A17165 ... 40 8.8
113dbj|AK000852.1| Homo sapiens cDNA FLJ20845 fis, clone ADKA01901 40 8.8
114gb|BC111795.1| Homo sapiens hypothetical protein LOC348262, mRNA... 40 8.8
115gb|AC145207.2| Homo sapiens chromosome 17, clone RP11-498C9, com... 40 8.8
116emb|AL772328.13| Mouse DNA sequence from clone RP23-270A19 on ch... 40 8.8 
>emb|CT737399.2| Pan troglodytes chromosome X clone CH251-213G08 map Xq28, complete
             sequence
          Length = 144757

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 546   ccatttcacagttattagctatt 568
             |||||||||||||||||||||||
Sbjct: 11194 ccatttcacagttattagctatt 11216
to top
>dbj|AP006403.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT16P18, TM0289,
             complete sequence
          Length = 94172

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 558   tattagctattactccctctgtacctatata 588
             ||||| |||||||||||||||| ||||||||
Sbjct: 75227 tattaactattactccctctgttcctatata 75197
to top
>gb|AY273696.1| Dendrobium crumenatum specimen_voucher M.W.K.Goh P703 chloroplast
           tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer
           region, partial sequence
          Length = 1182

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 898 atttgttttgtatagtacgata 919
to top
>gb|AF503704.1| Thunia alba trnL-trnF intergenic spacer, chloroplast sequence
          Length = 437

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 164 atttgttttgtatagtacgata 185
to top
>gb|AF503703.1| Dendrochilum longifolium trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 434

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 168 atttgttttgtatagtacgata 189
to top
>gb|AF503702.1| Pleione x lagenaria trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 403

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 160 atttgttttgtatagtacgata 181
to top
>gb|AF503701.1| Pleione chunii x Pleione hookeriana trnL-trnF intergenic spacer,
           chloroplast sequence
          Length = 449

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 170 atttgttttgtatagtacgata 191
to top
>gb|AF503700.1| Pleione yunnanensis trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 451

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 172 atttgttttgtatagtacgata 193
to top
>gb|AF503699.1| Pleione x taliensis trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 448

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 169 atttgttttgtatagtacgata 190
to top
>gb|AF503698.1| Pleione scopulorum trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 461

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 182 atttgttttgtatagtacgata 203
to top
>gb|AF503697.1| Pleione saxicola trnL-trnF intergenic spacer, chloroplast sequence
          Length = 427

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 170 atttgttttgtatagtacgata 191
to top
>gb|AF503696.1| Pleione pleionoides isolate 309 trnL-trnF intergenic spacer,
           chloroplast sequence
          Length = 460

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 184 atttgttttgtatagtacgata 205
to top
>gb|AF503695.1| Pleione pleionoides isolate 308 trnL-trnF intergenic spacer,
           chloroplast sequence
          Length = 435

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 156 atttgttttgtatagtacgata 177
to top
>gb|AF503694.1| Pleione praecox trnL-trnF intergenic spacer, chloroplast sequence
          Length = 448

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 170 atttgttttgtatagtacgata 191
to top
>gb|AF503693.1| Pleione maculata trnL-trnF intergenic spacer, chloroplast sequence
          Length = 462

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 184 atttgttttgtatagtacgata 205
to top
>gb|AF503692.1| Pleione limprichtii trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 464

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 185 atttgttttgtatagtacgata 206
to top
>gb|AF503691.1| Pleione humilis trnL-trnF intergenic spacer, chloroplast sequence
          Length = 402

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 156 atttgttttgtatagtacgata 177
to top
>gb|AF503690.1| Pleione hookeriana isolate 406 trnL-trnF intergenic spacer,
           chloroplast sequence
          Length = 426

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 147 atttgttttgtatagtacgata 168
to top
>gb|AF503689.1| Pleione hookeriana isolate 322 trnL-trnF intergenic spacer,
           chloroplast sequence
          Length = 454

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 175 atttgttttgtatagtacgata 196
to top
>gb|AF503688.1| Pleione grandiflora trnL-trnF intergenic spacer, chloroplast
           sequence
          Length = 463

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 184 atttgttttgtatagtacgata 205
to top
>gb|AF503686.1| Pleione formosana trnL-trnF intergenic spacer, chloroplast sequence
          Length = 462

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 184 atttgttttgtatagtacgata 205
to top
>gb|AF503685.1| Pleione coronaria trnL-trnF intergenic spacer, chloroplast sequence
          Length = 421

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 176 atttgttttgtatagtacgata 197
to top
>gb|AF503684.1| Pleione x confusa trnL-trnF intergenic spacer, chloroplast sequence
          Length = 412

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 168 atttgttttgtatagtacgata 189
to top
>gb|AF503683.1| Pleione chunii trnL-trnF intergenic spacer, chloroplast sequence
          Length = 450

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 171 atttgttttgtatagtacgata 192
to top
>gb|AF503681.1| Pleione delavayi trnL-trnF intergenic spacer, chloroplast sequence
          Length = 432

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 167 atttgttttgtatagtacgata 188
to top
>gb|AF503680.1| Pleione albiflora trnL-trnF intergenic spacer, chloroplast sequence
          Length = 429

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 173 atttgttttgtatagtacgata 194
to top
>gb|AF463383.1| Pholidota imbricata trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 425

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 179 atttgttttgtatagtacgata 200
to top
>gb|AF463382.1| Neogyna gardneriana trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 415

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 169 atttgttttgtatagtacgata 190
to top
>gb|AF463381.1| Coelogyne macdonaldii trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 422

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 177 atttgttttgtatagtacgata 198
to top
>gb|AF463380.1| Coelogyne beccarii trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 410

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 170 atttgttttgtatagtacgata 191
to top
>gb|AF463379.1| Coelogyne cuprea trnL-trnF intergenic spacer, choloroplast sequence
          Length = 424

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 181 atttgttttgtatagtacgata 202
to top
>gb|AF463378.1| Coelogyne bilamellata trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 391

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 149 atttgttttgtatagtacgata 170
to top
>gb|AF463377.1| Coelogyne renae trnL-trnF intergenic spacer, choloroplast sequence
          Length = 298

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 153 atttgttttgtatagtacgata 174
to top
>gb|AF463376.1| Coelogyne naja trnL-trnF intergenic spacer, choloroplast sequence
          Length = 418

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 172 atttgttttgtatagtacgata 193
to top
>gb|AF463375.1| Coelogyne monilirachis trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 364

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 130 atttgttttgtatagtacgata 151
to top
>gb|AF463374.1| Coelogyne longpasiaensis trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 359

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 130 atttgttttgtatagtacgata 151
to top
>gb|AF463373.1| Coelogyne kelamensis trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 418

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 172 atttgttttgtatagtacgata 193
to top
>gb|AF463372.1| Coelogyne incrassata trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 359

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 118 atttgttttgtatagtacgata 139
to top
>gb|AF463371.1| Coelogyne harana trnL-trnF intergenic spacer, choloroplast sequence
          Length = 412

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 172 atttgttttgtatagtacgata 193
to top
>gb|AF463370.1| Coelogyne gibbifera trnL-trnF intergenic spacer, choloroplast
           sequence
          Length = 359

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 125 atttgttttgtatagtacgata 146
to top
>gb|AF463369.1| Coelogyne chanii trnL-trnF intergenic spacer, choloroplast sequence
          Length = 387

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 153 atttgttttgtatagtacgata 174
to top
>gb|AF519954.1| Eria ferruginea tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 1030

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 784 atttgttttgtatagtacgata 805
to top
>gb|AF519953.1| Nephelaphyllum pulchrum tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer region, partial sequence; chloroplast
           gene for chloroplast product
          Length = 407

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 159 atttgttttgtatagtacgata 180
to top
>gb|AF519949.1| Malaxis spicata tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 434

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 195 atttgttttgtatagtacgata 216
to top
>gb|AF519947.1| Liparis liliifolia tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 425

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 181 atttgttttgtatagtacgata 202
to top
>gb|AF519940.1| Calanthe tricarinata tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 1024

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 768 atttgttttgtatagtacgata 789
to top
>gb|AF519939.1| Bletilla striata tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 995

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 780 atttgttttgtatagtacgata 801
to top
>gb|AF519938.1| Entomophobia kinabaluensis tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer region, partial sequence; chloroplast
           gene for chloroplast product
          Length = 847

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 622 atttgttttgtatagtacgata 643
to top
>gb|AF519937.1| Coelogyne cristata tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 1034

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 789 atttgttttgtatagtacgata 810
to top
>gb|AF519936.1| Pleione chunii tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer
           region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 1009

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 778 atttgttttgtatagtacgata 799
to top
>gb|AF519935.1| Thunia alba tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer
           region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 414

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 173 atttgttttgtatagtacgata 194
to top
>gb|AF519933.1| Dendrochilum glumaceum tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer region, partial sequence; chloroplast
           gene for chloroplast product
          Length = 968

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 752 atttgttttgtatagtacgata 773
to top
>gb|AF519932.1| Dilochia sp. Chase O-672 tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer region, partial sequence; chloroplast
           gene for chloroplast product
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 772 atttgttttgtatagtacgata 793
to top
>gb|AF519911.1| Collabium sp. Chase O-821 tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer region, partial sequence; chloroplast
           gene for chloroplast product
          Length = 450

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 196 atttgttttgtatagtacgata 217
to top
>emb|AJ409456.1|TEF409456 Tropidia effusa chloroplast tRNA-Leu gene for transfer RNA-Leu and
           trnL-F intergenic spacer
          Length = 540

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 305 atttgttttgtatagtacgata 326
to top
>emb|AJ409451.1|SVI409451 Spathoglottis vieillardii chloroplast tRNA-Leu gene for transfer
           RNA-Leu and trnL-F intergenic spacer
          Length = 453

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 201 atttgttttgtatagtacgata 222
to top
>emb|AJ409409.1|EBU409409 Eria bulbophylloides chloroplast tRNA-Leu gene for transfer RNA-Leu
           and trnL-F intergenic spacer
          Length = 1057

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 624 atttgttttgtatagtacgata 645
           ||||||||||||||||||||||
Sbjct: 812 atttgttttgtatagtacgata 833
to top
>ref|NM_001017526.1| Homo sapiens Rho GTPase activating protein 8 (ARHGAP8), transcript
           variant 1, mRNA
          Length = 1725

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 781 ccgccgcggcccccgctgcccacacagca 809
to top
>ref|NM_181335.2| Homo sapiens Rho GTPase activating protein 8 (ARHGAP8), transcript
           variant 2, mRNA
          Length = 1632

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 688 ccgccgcggcccccgctgcccacacagca 716
to top
>ref|XM_639087.1| Dictyostelium discoideum histidine kinase (DDB0185194), partial
           mRNA
          Length = 5016

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                        
Query: 203 acaagaacagagaacaagaagaacaatca 231
           ||||||||| |||||||||||||||||||
Sbjct: 519 acaagaaca-agaacaagaagaacaatca 546
to top
>ref|XM_515189.1| PREDICTED: Pan troglodytes similar to Rho GTPase activating protein 8
            isoform 4; BCH domain-containing Cdc42GAP-like protein
            (LOC458901), mRNA
          Length = 6984

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 372  ccgccgcagcccccgctccccacacagca 400
            ||||||| ||||||||| |||||||||||
Sbjct: 5653 ccgccgcggcccccgctgcccacacagca 5681
to top
>gb|AC113334.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1123_F01,
             complete sequence
          Length = 118799

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 204   caagaacagagaacaagaagaacaa 228
             ||||||||||||| |||||||||||
Sbjct: 79241 caagaacagagaagaagaagaacaa 79217
to top
>gb|AF544240.1| Homo sapiens BCH domain-containing Cdc42GAP-like protein (BPGAP1)
           mRNA, complete cds
          Length = 1302

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 547 ccgccgcggcccccgctgcccacacagca 575
to top
>gb|AC122378.4| Mus musculus BAC clone RP23-474C9 from chromosome 15, complete sequence
          Length = 203662

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 207    gaacagagaacaagaagaaca 227
              |||||||||||||||||||||
Sbjct: 159184 gaacagagaacaagaagaaca 159164
to top
>emb|Z83838.2|HS127B20 Human DNA sequence from clone RP1-127B20 on chromosome 22, complete
             sequence
          Length = 135259

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 372   ccgccgcagcccccgctccccacacagca 400
             ||||||| ||||||||| |||||||||||
Sbjct: 10995 ccgccgcggcccccgctgcccacacagca 11023
to top
>emb|X96869.1|DDDOKAGEN D.discoideum dokA gene
          Length = 5284

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                        
Query: 203 acaagaacagagaacaagaagaacaatca 231
           ||||||||| |||||||||||||||||||
Sbjct: 562 acaagaaca-agaacaagaagaacaatca 589
to top
>gb|BC067824.1| Homo sapiens Rho GTPase activating protein 8, mRNA (cDNA clone
           IMAGE:30339826), containing frame-shift errors
          Length = 1417

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 643 ccgccgcggcccccgctgcccacacagca 671
to top
>gb|BC059382.1| Homo sapiens Rho GTPase activating protein 8, mRNA (cDNA clone
           IMAGE:30336727), partial cds
          Length = 2921

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 672 ccgccgcggcccccgctgcccacacagca 700
to top
>emb|CR622409.1| full-length cDNA clone CS0DI084YM15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1502

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 621 ccgccgcggcccccgctgcccacacagca 649
to top
>emb|CR619940.1| full-length cDNA clone CS0DI079YF14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1506

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 621 ccgccgcggcccccgctgcccacacagca 649
to top
>emb|CR608243.1| full-length cDNA clone CS0DI084YP04 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1415

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 621 ccgccgcggcccccgctgcccacacagca 649
to top
>emb|CR600027.1| full-length cDNA clone CS0DI029YD05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1501

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 615 ccgccgcggcccccgctgcccacacagca 643
to top
>emb|CR597658.1| full-length cDNA clone CS0DI011YB06 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2013

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 372  ccgccgcagcccccgctccccacacagca 400
            ||||||| ||||||||| |||||||||||
Sbjct: 1182 ccgccgcggcccccgctgcccacacagca 1210
to top
>dbj|AK001306.1| Homo sapiens cDNA FLJ10444 fis, clone NT2RP1000825, moderately
           similar to GTPASE-ACTIVATING PROTEIN RHOGAP
          Length = 1653

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 781 ccgccgcggcccccgctgcccacacagca 809
to top
>dbj|AK022305.1| Homo sapiens cDNA FLJ12243 fis, clone MAMMA1001305, moderately
           similar to RHO-GTPASE-ACTIVATING PROTEIN 1
          Length = 2863

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 630 ccgccgcggcccccgctgcccacacagca 658
to top
>gb|AC091699.6| Homo sapiens chromosome 10 clone RP11-296D9, complete sequence
          Length = 196856

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 618    attcatatttgttttgtatag 638
              |||||||||||||||||||||
Sbjct: 124202 attcatatttgttttgtatag 124222
to top
>gb|AC022026.7| Homo sapiens chromosome 10 clone RP11-506B4, complete sequence
          Length = 170834

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 618  attcatatttgttttgtatag 638
            |||||||||||||||||||||
Sbjct: 8368 attcatatttgttttgtatag 8388
to top
>gb|AF195968.1|AF195968 Homo sapiens rho GTPase activating protein 8 isoform 1 (ARHGAP8)
           mRNA, complete cds
          Length = 1684

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 808 ccgccgcggcccccgctgcccacacagca 836
to top
>gb|BC010490.2| Homo sapiens Rho GTPase activating protein 8, mRNA (cDNA clone
           IMAGE:2900625), partial cds
          Length = 1491

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 532 ccgccgcggcccccgctgcccacacagca 560
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 204      caagaacagagaacaagaagaacaa 228
                ||||||||||||| |||||||||||
Sbjct: 24797258 caagaacagagaagaagaagaacaa 24797234
to top
>ref|NM_181334.3| Homo sapiens PRR5-ARHGAP8 fusion (LOC553158), mRNA
          Length = 1752

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 808 ccgccgcggcccccgctgcccacacagca 836
to top
>gb|AC116957.2| Dictyostelium discoideum chromosome 2 map 1685067-2090751 strain AX4,
             complete sequence
          Length = 405682

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                          
Query: 203   acaagaacagagaacaagaagaacaatca 231
             ||||||||| |||||||||||||||||||
Sbjct: 94374 acaagaaca-agaacaagaagaacaatca 94347
to top
>gb|AF519955.1| Podochilus cultratus tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer region, partial sequence; chloroplast gene for
           chloroplast product
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 625 tttgttttgtatagtacgata 645
           |||||||||||||||||||||
Sbjct: 874 tttgttttgtatagtacgata 894
to top
>dbj|AP003777.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-249I1, complete
             sequence
          Length = 173223

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 593   aaattgatgcatgcatttctg 613
             |||||||||||||||||||||
Sbjct: 74726 aaattgatgcatgcatttctg 74706
to top
>dbj|AP003066.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-360K13, complete
             sequence
          Length = 187688

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 593   aaattgatgcatgcatttctg 613
             |||||||||||||||||||||
Sbjct: 60186 aaattgatgcatgcatttctg 60166
to top
>gb|AC156998.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0086B08,
              complete sequence
          Length = 148274

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 204    caagaacagagaacaagaagaacaa 228
              ||||||||||||| |||||||||||
Sbjct: 123756 caagaacagagaagaagaagaacaa 123732
to top
>gb|BC048280.1| Homo sapiens Rho GTPase activating protein 8, mRNA (cDNA clone
           IMAGE:5190702), partial cds
          Length = 1620

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 372 ccgccgcagcccccgctccccacacagca 400
           ||||||| ||||||||| |||||||||||
Sbjct: 640 ccgccgcggcccccgctgcccacacagca 668
to top
>emb|AL355192.1|HSARHGAP8 Novel human gene mapping to chomosome 22
          Length = 2043

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 372  ccgccgcagcccccgctccccacacagca 400
            ||||||| ||||||||| |||||||||||
Sbjct: 1177 ccgccgcggcccccgctgcccacacagca 1205
to top
>ref|XM_511744.1| PREDICTED: Pan troglodytes similar to BC003940 protein (LOC454969),
           mRNA
          Length = 801

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 234 gcagcccccgctccccacccagca 257
to top
>ref|NM_001031024.1| Gallus gallus syndecan binding protein (syntenin) (SDCBP), mRNA
          Length = 1694

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 372 ccgccgcagcccccgctccccacacagc 399
           ||||||| ||||||||||||| ||||||
Sbjct: 14  ccgccgccgcccccgctcccctcacagc 41
to top
>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence
          Length = 153766

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 565  tattactccctctgtaccta 584
            ||||||||||||||||||||
Sbjct: 8720 tattactccctctgtaccta 8701
to top
>gb|AY133250.1|AY133250S1 Hordeum vulgare subsp. vulgare starch synthase II gene, exons 1
            through 8
          Length = 4976

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 568  tactccctctgtacctatatactt 591
            ||||||||||||||||| ||||||
Sbjct: 2349 tactccctctgtacctaaatactt 2372
to top
>gb|BC081272.1| Xenopus laevis MGC86435 protein, mRNA (cDNA clone MGC:86435
           IMAGE:7012000), complete cds
          Length = 3558

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 396 cagcaccggggacacccgcagcagcaac 423
           |||||||||||||| | |||||||||||
Sbjct: 4   cagcaccggggacagcggcagcagcaac 31
to top
>gb|AC147679.13| Canis Familiaris, clone XX-10F3, complete sequence
          Length = 193944

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 372   ccgccgcagcccccgctccc 391
             ||||||||||||||||||||
Sbjct: 95428 ccgccgcagcccccgctccc 95409
to top
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 444     gcagagcaccagccgccgca 463
               ||||||||||||||||||||
Sbjct: 2275758 gcagagcaccagccgccgca 2275777
to top
>gb|DQ491002.1| Paramecium bursaria Chlorella virus NY2A Chlorella virus NY2A ctg_13
              genomic sequence
          Length = 368683

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    aacagagaacaagaagaaca 227
              ||||||||||||||||||||
Sbjct: 228119 aacagagaacaagaagaaca 228138
to top
>gb|BC063557.1| Homo sapiens hypothetical protein LOC348262, mRNA (cDNA clone
           IMAGE:4941803), partial cds
          Length = 1256

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 125 gcagcccccgctccccacccagca 148
to top
>gb|BC019318.1| Homo sapiens hypothetical protein LOC348262, mRNA (cDNA clone
           IMAGE:2822562), with apparent retained intron
          Length = 1239

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 129 gcagcccccgctccccacccagca 152
to top
>gb|BC041068.1| Homo sapiens hypothetical protein LOC348262, mRNA (cDNA clone
           IMAGE:5473875), with apparent retained intron
          Length = 889

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 82  gcagcccccgctccccacccagca 105
to top
>gb|BC017108.1| Homo sapiens hypothetical protein LOC348262, mRNA (cDNA clone
           IMAGE:3542312), partial cds
          Length = 1238

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 117 gcagcccccgctccccacccagca 140
to top
>emb|BX537334.4| Human DNA sequence from clone WI2-86101C3 on chromosome X Contains the
             5' end of the gene for a novel protein (FLJ11323) and four
             CpG islands, complete sequence
          Length = 36872

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 246   gaacacaggcagcaccgagg 265
             ||||||||||||||||||||
Sbjct: 29649 gaacacaggcagcaccgagg 29630
to top
>emb|AJ721106.1| Gallus gallus mRNA for hypothetical protein, clone 35e13
          Length = 1694

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 372 ccgccgcagcccccgctccccacacagc 399
           ||||||| ||||||||||||| ||||||
Sbjct: 14  ccgccgccgcccccgctcccctcacagc 41
to top
>dbj|AK125584.1| Homo sapiens cDNA FLJ43596 fis, clone SMINT2011311
          Length = 2980

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 377  gcagcccccgctccccacacagca 400
            |||||||||||||||||| |||||
Sbjct: 2207 gcagcccccgctccccacccagca 2230
to top
>gb|AC026696.5| Homo sapiens chromosome 5 clone CTC-348L14, complete sequence
          Length = 125862

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 575   tctgtacctatatacttcaaattg 598
             ||||| ||||||||||||||||||
Sbjct: 31113 tctgtccctatatacttcaaattg 31136
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 364     agggtccgccgccgcagcccccgc 387
               ||||||||||||||| ||||||||
Sbjct: 2559211 agggtccgccgccgccgcccccgc 2559234
to top
>gb|BC094876.1| Homo sapiens cDNA clone IMAGE:6484550
          Length = 1069

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 265 gcagcccccgctccccacccagca 288
to top
>ref|NM_207368.1| Homo sapiens hypothetical protein LOC348262 (LOC348262), mRNA
          Length = 2980

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 377  gcagcccccgctccccacacagca 400
            |||||||||||||||||| |||||
Sbjct: 2207 gcagcccccgctccccacccagca 2230
to top
>emb|BX936107.1| Gallus gallus finished cDNA, clone ChEST489l1
          Length = 905

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 11  attcttcagttatctctaaa 30
           ||||||||||||||||||||
Sbjct: 484 attcttcagttatctctaaa 465
to top
>emb|BX930464.1| Gallus gallus finished cDNA, clone ChEST636o24
          Length = 597

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 11  attcttcagttatctctaaa 30
           ||||||||||||||||||||
Sbjct: 513 attcttcagttatctctaaa 494
to top
>gb|AC007380.3| Homo sapiens BAC clone RP11-150O13 from 2, complete sequence
          Length = 207362

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 554   cagttattagctattactcc 573
             ||||||||||||||||||||
Sbjct: 57782 cagttattagctattactcc 57763
to top
>gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156G16, complete sequence
          Length = 187012

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 565   tattactccctctgtaccta 584
             ||||||||||||||||||||
Sbjct: 17328 tattactccctctgtaccta 17309
to top
>emb|BX649156.1|HSM809308 Homo sapiens mRNA; cDNA DKFZp686A17165 (from clone DKFZp686A17165)
          Length = 952

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 153 gcagcccccgctccccacccagca 176
to top
>dbj|AK000852.1| Homo sapiens cDNA FLJ20845 fis, clone ADKA01901
          Length = 1239

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 377 gcagcccccgctccccacacagca 400
           |||||||||||||||||| |||||
Sbjct: 138 gcagcccccgctccccacccagca 161
to top
>gb|BC111795.1| Homo sapiens hypothetical protein LOC348262, mRNA (cDNA clone
            MGC:133184 IMAGE:40026268), complete cds
          Length = 2516

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 377  gcagcccccgctccccacacagca 400
            |||||||||||||||||| |||||
Sbjct: 1738 gcagcccccgctccccacccagca 1761
to top
>gb|AC145207.2| Homo sapiens chromosome 17, clone RP11-498C9, complete sequence
          Length = 182848

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 377    gcagcccccgctccccacacagca 400
              |||||||||||||||||| |||||
Sbjct: 162615 gcagcccccgctccccacccagca 162638
to top
>emb|AL772328.13| Mouse DNA sequence from clone RP23-270A19 on chromosome 4, complete
             sequence
          Length = 219095

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 535   tagtcagtcggccatttcac 554
             ||||||||||||||||||||
Sbjct: 92849 tagtcagtcggccatttcac 92830


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,525,573
Number of Sequences: 3902068
Number of extensions: 5525573
Number of successful extensions: 115707
Number of sequences better than 10.0: 116
Number of HSP's better than 10.0 without gapping: 113
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 115464
Number of HSP's gapped (non-prelim): 246
length of query: 646
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 623
effective length of database: 17,143,297,704
effective search space: 10680274469592
effective search space used: 10680274469592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top