| Clone Name | rbags5p23 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome | 38 | 0.95 | 2 | gb|DQ167203.2| Triticum aestivum eukaryotic translation initiati... | 38 | 0.95 |
|---|
>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome Length = 3940880 Score = 38.2 bits (19), Expect = 0.95 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 aacagatatcgagatgcct 32 ||||||||||||||||||| Sbjct: 1376453 aacagatatcgagatgcct 1376471
>gb|DQ167203.2| Triticum aestivum eukaryotic translation initiation factor 5A3 mRNA, complete cds Length = 768 Score = 38.2 bits (19), Expect = 0.95 Identities = 29/33 (87%) Strand = Plus / Minus Query: 1 actngtttcanccaacagatatcgagatgccta 33 ||| |||||| |||||||||||| |||||||| Sbjct: 686 acttgtttcacccaacagatatcttgatgccta 654 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 41,105 Number of Sequences: 3902068 Number of extensions: 41105 Number of successful extensions: 8542 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 8538 Number of HSP's gapped (non-prelim): 4 length of query: 37 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 17 effective length of database: 17,155,003,908 effective search space: 291635066436 effective search space used: 291635066436 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)