ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags5o18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY072771.1| Triticum aestivum cultivar Soissons thioredoxin H... 62 3e-07
2gb|AC161264.2| Mus musculus BAC clone RP23-275J22 from chromosom... 38 5.0
3gb|BC001982.1| Mus musculus proteasome (prosome, macropain) subu... 38 5.0
4ref|XR_003474.1| PREDICTED: Mus musculus similar to Proteasome s... 38 5.0
5gb|AC115631.4| Mus musculus BAC clone RP24-128K6 from 18, comple... 38 5.0
6gb|AC109261.7| Mus musculus chromosome 17, clone RP23-23D19, com... 38 5.0
7gb|AC027740.11| Mus musculus, clone RP23-57M1, complete sequence 38 5.0
8gb|AC166741.1| Brassica rapa subsp. pekinensis clone KBrH080C09,... 38 5.0
9dbj|AK150565.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 38 5.0
10gb|AC026703.4| Homo sapiens chromosome 5 clone CTD-2029A10, comp... 38 5.0
11dbj|AK168838.1| Mus musculus 17 days pregnant adult female amnio... 38 5.0
12dbj|AK166618.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN fu... 38 5.0
13dbj|AK168150.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 38 5.0
14gb|AC087795.5|AC087795 Genomic Sequence for Mus musculus, clone ... 38 5.0
15dbj|AK085937.1| Mus musculus 16 days neonate heart cDNA, RIKEN f... 38 5.0
16gb|AC008766.4|AC008766 Homo sapiens chromosome 5 clone CTD-2004A... 38 5.0
17gb|AF060093.1|AF060093 Mus musculus proteasome subunit C9 (Psma4... 38 5.0
18gb|AC126554.3| Mus musculus BAC clone RP23-465O13 from 12, compl... 38 5.0
19gb|AC131779.4| Mus musculus BAC clone RP24-336D11 from 8, comple... 38 5.0
20gb|AC147783.13| Mus musculus chromosome 12, clone RP23-256M6, co... 38 5.0
21ref|NM_011966.2| Mus musculus proteasome (prosome, macropain) su... 38 5.0
22emb|CT030249.7| Mouse DNA sequence from clone RP23-285E19 on chr... 38 5.0
23gb|AC163731.2| Mus musculus BAC clone RP23-380F10 from chromosom... 38 5.0
24emb|AL928735.9| Mouse DNA sequence from clone RP23-413M3 on chro... 38 5.0
25emb|AJ277046.1|MMU277046 Mus musculus processed Psma4 pseudogene... 38 5.0

>gb|AY072771.1| Triticum aestivum cultivar Soissons thioredoxin H mRNA, complete
           cds
          Length = 598

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 61  aactacttacaccaggtgctggctcttattg 91
           |||||||||||||||||||||||||||||||
Sbjct: 416 aactacttacaccaggtgctggctcttattg 386



 Score = 40.1 bits (20), Expect = 1.3
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 23  tctgnactctaaaatgaatcaacataaagttcagtcacaacta 65
           |||| ||||||||  |||||| || ||||||||||||| ||||
Sbjct: 481 tctgaactctaaaccgaatcatcacaaagttcagtcacgacta 439



to top

>gb|AC161264.2| Mus musculus BAC clone RP23-275J22 from chromosome 9, complete sequence
          Length = 131422

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 38    gaatcaacataaagttcag 56
             |||||||||||||||||||
Sbjct: 71885 gaatcaacataaagttcag 71867



to top

>gb|BC001982.1| Mus musculus proteasome (prosome, macropain) subunit, alpha type
          4, mRNA (cDNA clone MGC:5640 IMAGE:3592024), complete
          cds
          Length = 1113

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 38 gaatcaacataaagttcag 56
          |||||||||||||||||||
Sbjct: 46 gaatcaacataaagttcag 64



to top

>ref|XR_003474.1| PREDICTED: Mus musculus similar to Proteasome subunit alpha type 4
           (Proteasome component C9) (Macropain subunit C9)
           (Multicatalytic endopeptidase complex subunit C9)
           (Proteasome subunit L) (LOC670627), mRNA
          Length = 1171

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 38  gaatcaacataaagttcag 56
           |||||||||||||||||||
Sbjct: 114 gaatcaacataaagttcag 132



to top

>gb|AC115631.4| Mus musculus BAC clone RP24-128K6 from 18, complete sequence
          Length = 179355

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gaatcaacataaagttcag 56
             |||||||||||||||||||
Sbjct: 77119 gaatcaacataaagttcag 77137



to top

>gb|AC109261.7| Mus musculus chromosome 17, clone RP23-23D19, complete sequence
          Length = 227994

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    taaaatgaatcaacataaa 50
             |||||||||||||||||||
Sbjct: 40558 taaaatgaatcaacataaa 40540



to top

>gb|AC027740.11| Mus musculus, clone RP23-57M1, complete sequence
          Length = 261093

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gaatcaacataaagttcag 56
             |||||||||||||||||||
Sbjct: 66518 gaatcaacataaagttcag 66536



to top

>gb|AC166741.1| Brassica rapa subsp. pekinensis clone KBrH080C09, complete sequence
          Length = 132099

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 28    actctaaaatgaatcaaca 46
             |||||||||||||||||||
Sbjct: 98635 actctaaaatgaatcaaca 98617



to top

>dbj|AK150565.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830012C08 product:proteasome
           (prosome, macropain) subunit, alpha type 4, full insert
           sequence
          Length = 1141

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 38  gaatcaacataaagttcag 56
           |||||||||||||||||||
Sbjct: 91  gaatcaacataaagttcag 109



to top

>gb|AC026703.4| Homo sapiens chromosome 5 clone CTD-2029A10, complete sequence
          Length = 132155

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 69     acaccaggtgctggctctt 87
              |||||||||||||||||||
Sbjct: 113655 acaccaggtgctggctctt 113673



to top

>dbj|AK168838.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920059I16
           product:proteasome (prosome, macropain) subunit, alpha
           type 4, full insert sequence
          Length = 1114

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 38  gaatcaacataaagttcag 56
           |||||||||||||||||||
Sbjct: 105 gaatcaacataaagttcag 123



to top

>dbj|AK166618.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN full-length enriched
           library, clone:I0C0039C20 product:proteasome (prosome,
           macropain) subunit, alpha type 4, full insert sequence
          Length = 854

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 38  gaatcaacataaagttcag 56
           |||||||||||||||||||
Sbjct: 85  gaatcaacataaagttcag 103



to top

>dbj|AK168150.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
          library, clone:I730060P08 product:proteasome (prosome,
          macropain) subunit, alpha type 4, full insert sequence
          Length = 1076

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 38 gaatcaacataaagttcag 56
          |||||||||||||||||||
Sbjct: 62 gaatcaacataaagttcag 80



to top

>gb|AC087795.5|AC087795 Genomic Sequence for Mus musculus, clone RP23-181H5, complete sequence
          Length = 220811

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gaatcaacataaagttcag 56
             |||||||||||||||||||
Sbjct: 65890 gaatcaacataaagttcag 65908



to top

>dbj|AK085937.1| Mus musculus 16 days neonate heart cDNA, RIKEN full-length enriched
           library, clone:D830031O07 product:proteasome (prosome,
           macropain) subunit, alpha type 4, full insert sequence
          Length = 1153

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 38  gaatcaacataaagttcag 56
           |||||||||||||||||||
Sbjct: 104 gaatcaacataaagttcag 122



to top

>gb|AC008766.4|AC008766 Homo sapiens chromosome 5 clone CTD-2004A9, complete sequence
          Length = 147530

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 69     acaccaggtgctggctctt 87
              |||||||||||||||||||
Sbjct: 139986 acaccaggtgctggctctt 139968



to top

>gb|AF060093.1|AF060093 Mus musculus proteasome subunit C9 (Psma4) mRNA, complete cds
          Length = 875

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 38 gaatcaacataaagttcag 56
          |||||||||||||||||||
Sbjct: 31 gaatcaacataaagttcag 49



to top

>gb|AC126554.3| Mus musculus BAC clone RP23-465O13 from 12, complete sequence
          Length = 186243

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 41     tcaacataaagttcagtca 59
              |||||||||||||||||||
Sbjct: 180851 tcaacataaagttcagtca 180869



to top

>gb|AC131779.4| Mus musculus BAC clone RP24-336D11 from 8, complete sequence
          Length = 171978

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    taaaatgaatcaacataaa 50
             |||||||||||||||||||
Sbjct: 37523 taaaatgaatcaacataaa 37505



to top

>gb|AC147783.13| Mus musculus chromosome 12, clone RP23-256M6, complete sequence
          Length = 212734

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 41    tcaacataaagttcagtca 59
             |||||||||||||||||||
Sbjct: 38705 tcaacataaagttcagtca 38687



to top

>ref|NM_011966.2| Mus musculus proteasome (prosome, macropain) subunit, alpha type
          4 (Psma4), mRNA
          Length = 1113

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 38 gaatcaacataaagttcag 56
          |||||||||||||||||||
Sbjct: 46 gaatcaacataaagttcag 64



to top

>emb|CT030249.7| Mouse DNA sequence from clone RP23-285E19 on chromosome 12, complete
              sequence
          Length = 179748

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 41     tcaacataaagttcagtca 59
              |||||||||||||||||||
Sbjct: 178457 tcaacataaagttcagtca 178439



to top

>gb|AC163731.2| Mus musculus BAC clone RP23-380F10 from chromosome 17, complete
             sequence
          Length = 185201

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    taaaatgaatcaacataaa 50
             |||||||||||||||||||
Sbjct: 12930 taaaatgaatcaacataaa 12948



to top

>emb|AL928735.9| Mouse DNA sequence from clone RP23-413M3 on chromosome 2, complete
             sequence
          Length = 187287

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    aaaatgaatcaacataaag 51
             |||||||||||||||||||
Sbjct: 32675 aaaatgaatcaacataaag 32657



to top

>emb|AJ277046.1|MMU277046 Mus musculus processed Psma4 pseudogene for a-type of proteasome
            subunit C9
          Length = 1958

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   gaatcaacataaagttcag 56
            |||||||||||||||||||
Sbjct: 1287 gaatcaacataaagttcag 1305


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 668,888
Number of Sequences: 3902068
Number of extensions: 668888
Number of successful extensions: 41818
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41790
Number of HSP's gapped (non-prelim): 28
length of query: 110
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 89
effective length of database: 17,151,101,840
effective search space: 1526448063760
effective search space used: 1526448063760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top