ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags6c08 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X82548.1|HVBKIN2 H.vulgare mRNA for SNF1-related protein kinase Length = 1453 Score = 658 bits (332), Expect = 0.0 Identities = 335/336 (99%) Strand = Plus / Minus Query: 277 aaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtcc 336 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1453 aaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtcc 1394 Query: 337 actaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaatttc 396 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 1393 actaaccctttgcaagtcgagaagatacttatcaccccttgttttgtacagctgaatttc 1334 Query: 397 aaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagactc 456 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1333 aaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagactc 1274 Query: 457 cacaccgaatccattgttgttatgcatcatattctcaaaaaagccaggactccacctgca 516 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1273 cacaccgaatccattgttgttatgcatcatattctcaaaaaagccaggactccacctgca 1214 Query: 517 cttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaag 576 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1213 cttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaag 1154 Query: 577 cacttcagttatgatttctcgtggatgcgctcgaga 612 |||||||||||||||||||||||||||||||||||| Sbjct: 1153 cacttcagttatgatttctcgtggatgcgctcgaga 1118
>ref|XM_475738.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1518 Score = 337 bits (170), Expect = 3e-89 Identities = 300/343 (87%), Gaps = 9/343 (2%) Strand = Plus / Minus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 1516 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 1457 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaattt 395 |||| |||||||||||||| ||||| || || ||||||||||||||||| |||||||||| Sbjct: 1456 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctgaattt 1397 Query: 396 caaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagact 455 |||| ||||| ||||||||||||| |||| | |||||| ||||||||||||||| | Sbjct: 1396 caaatttcacagtgtgggttgatttctcac---tgtcatcagtttcaattatagcagatt 1340 Query: 456 ccacaccgaatccattgttgttatgcatcatattctca------aaaaagccaggactcc 509 | |||| || |||| |||||||||||||||| ||||| ||| | |||||||| Sbjct: 1339 ctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaactaggactcc 1280 Query: 510 acctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagag 569 | ||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 1279 atctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctcttgcagag 1220 Query: 570 ctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 1219 ctttaagaacttcagttattatttctcgtggatgtgctcgaga 1177
>dbj|AK104868.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-A03, full insert sequence Length = 1203 Score = 337 bits (170), Expect = 3e-89 Identities = 300/343 (87%), Gaps = 9/343 (2%) Strand = Plus / Minus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 849 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 790 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaattt 395 |||| |||||||||||||| ||||| || || ||||||||||||||||| |||||||||| Sbjct: 789 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctgaattt 730 Query: 396 caaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagact 455 |||| ||||| ||||||||||||| |||| | |||||| ||||||||||||||| | Sbjct: 729 caaatttcacagtgtgggttgatttctcac---tgtcatcagtttcaattatagcagatt 673 Query: 456 ccacaccgaatccattgttgttatgcatcatattctca------aaaaagccaggactcc 509 | |||| || |||| |||||||||||||||| ||||| ||| | |||||||| Sbjct: 672 ctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaactaggactcc 613 Query: 510 acctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagag 569 | ||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 612 atctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctcttgcagag 553 Query: 570 ctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 552 ctttaagaacttcagttattatttctcgtggatgtgctcgaga 510
>dbj|AK067158.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094M16, full insert sequence Length = 2073 Score = 337 bits (170), Expect = 3e-89 Identities = 300/343 (87%), Gaps = 9/343 (2%) Strand = Plus / Minus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 1705 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 1646 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaattt 395 |||| |||||||||||||| ||||| || || ||||||||||||||||| |||||||||| Sbjct: 1645 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctgaattt 1586 Query: 396 caaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagact 455 |||| ||||| ||||||||||||| |||| | |||||| ||||||||||||||| | Sbjct: 1585 caaatttcacagtgtgggttgatttctcac---tgtcatcagtttcaattatagcagatt 1529 Query: 456 ccacaccgaatccattgttgttatgcatcatattctca------aaaaagccaggactcc 509 | |||| || |||| |||||||||||||||| ||||| ||| | |||||||| Sbjct: 1528 ctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaactaggactcc 1469 Query: 510 acctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagag 569 | ||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 1468 atctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctcttgcagag 1409 Query: 570 ctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 1408 ctttaagaacttcagttattatttctcgtggatgtgctcgaga 1366
>dbj|D82039.1| Oryza sativa mRNA for OSK1, complete cds Length = 2209 Score = 337 bits (170), Expect = 3e-89 Identities = 300/343 (87%), Gaps = 9/343 (2%) Strand = Plus / Minus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 1699 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 1640 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaattt 395 |||| |||||||||||||| ||||| || || ||||||||||||||||| |||||||||| Sbjct: 1639 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctgaattt 1580 Query: 396 caaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagact 455 |||| ||||| ||||||||||||| |||| | |||||| ||||||||||||||| | Sbjct: 1579 caaatttcacagtgtgggttgatttctcac---tgtcatcagtttcaattatagcagatt 1523 Query: 456 ccacaccgaatccattgttgttatgcatcatattctca------aaaaagccaggactcc 509 | |||| || |||| |||||||||||||||| ||||| ||| | |||||||| Sbjct: 1522 ctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaactaggactcc 1463 Query: 510 acctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagag 569 | ||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 1462 atctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctcttgcagag 1403 Query: 570 ctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 1402 ctttaagaacttcagttattatttctcgtggatgtgctcgaga 1360
>gb|AF062479.1|AF062479 Oryza sativa protein kinase SNF1 (Snf1) mRNA, complete cds Length = 2100 Score = 305 bits (154), Expect = 9e-80 Identities = 296/343 (86%), Gaps = 9/343 (2%) Strand = Plus / Minus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 1674 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 1615 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaattt 395 |||| | |||||||||||| |||| || || ||||||||||||||||| |||||||||| Sbjct: 1614 cactgagcctttgcaagtcaagaaagtatttttcatcccttgttttgtaaagctgaattt 1555 Query: 396 caaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattatagcagact 455 |||| ||||| ||||||||||||| |||| | |||||| |||||| |||||||| Sbjct: 1554 caaatttcacagtgtgggttgatttctcac---tgtcatcagtttcaatcatagcagatg 1498 Query: 456 ccacaccgaatccattgttgttatgcatcatattctca------aaaaagccaggactcc 509 | |||| || |||| |||||||||||||||| ||||| ||| | |||||||| Sbjct: 1497 ctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaactaggactcc 1438 Query: 510 acctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagag 569 | ||||| |||||||||| || ||||||||||||||||||||||||||||||||||||| Sbjct: 1437 atctgcatttcatgttatgatgtccaatcttcttccagcaaacatttagctcttgcagag 1378 Query: 570 ctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||| |||||||||||||||||||||||||| |||||||| Sbjct: 1377 ctttaagaacttcagttatgatttctcgtggatgtgctcgaga 1335
>gb|BT018428.1| Zea mays clone EL01N0363F09.d mRNA sequence Length = 1948 Score = 287 bits (145), Expect = 2e-74 Identities = 295/345 (85%) Strand = Plus / Plus Query: 268 tcaggatcaaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggag 327 ||||| |||||| ||||||||||| ||||||||||| ||||||| |||||||||||| || Sbjct: 339 tcaggctcaaagaactctcagctgagttagaaaggcggaacacaagtccagaaagagaag 398 Query: 328 ctgtggtccactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacag 387 |||| |||||| |||||||||| ||| ||||| ||||| |||||||| |||||||| || Sbjct: 399 atgtgatccactgaccctttgcaggtcaagaaggtacttctcatccctcgttttgtaaag 458 Query: 388 ctgaatttcaaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattat 447 |||||| ||||||||||| | |||||||||| || || |||||| ||||||||| Sbjct: 459 ctgaatctcaaacttcactgtcggggttgatttctccatgaaaacatcagtttcaattat 518 Query: 448 agcagactccacaccgaatccattgttgttatgcatcatattctcaaaaaagccaggact 507 |||||||||| ||| ||| | || |||||||||||||| |||||| |||||||||| Sbjct: 519 agcagactccgcactgaagctatcactgttatgcatcatactctcaaggcagccaggact 578 Query: 508 ccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcag 567 ||| ||||| |||||||| ||||| |||||||| |||||| ||||||| || |||||||| Sbjct: 579 ccatctgcatttcatgttgtagtgtccaatctttttccagtaaacattcagttcttgcag 638 Query: 568 agctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 |||||||||||||||| |||| |||||||||||||| |||||||| Sbjct: 639 agctttaagcacttcacttattatttctcgtggatgtgctcgaga 683
>gb|AC111015.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1131_E09, complete sequence Length = 94399 Score = 186 bits (94), Expect = 6e-44 Identities = 197/231 (85%), Gaps = 9/231 (3%) Strand = Plus / Plus Query: 388 ctgaatttcaaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattat 447 |||||||||||| ||||| ||||||||||||| |||| | |||||| ||||||||| Sbjct: 58465 ctgaatttcaaatttcacagtgtgggttgatttctcactgt---catcagtttcaattat 58521 Query: 448 agcagactccacaccgaatccattgttgttatgcatcatattctcaaaa------aagcc 501 |||||| || |||| || |||| |||||||||||||||| ||||| | || | Sbjct: 58522 agcagattctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaact 58581 Query: 502 aggactccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctc 561 ||||||||| ||||| ||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 58582 aggactccatctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctc 58641 Query: 562 ttgcagagctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 58642 ttgcagagctttaagaacttcagttattatttctcgtggatgtgctcgaga 58692 Score = 157 bits (79), Expect = 5e-35 Identities = 106/115 (92%) Strand = Plus / Plus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 58067 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 58126 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctg 390 |||| |||||||||||||| ||||| || || ||||||||||||||||| ||||| Sbjct: 58127 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctg 58181
>dbj|AB101655.1| Oryza sativa (japonica cultivar-group) OSK1 gene for SnRK1a protein kinase, complete cds Length = 6112 Score = 186 bits (94), Expect = 6e-44 Identities = 197/231 (85%), Gaps = 9/231 (3%) Strand = Plus / Minus Query: 388 ctgaatttcaaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattat 447 |||||||||||| ||||| ||||||||||||| |||| | |||||| ||||||||| Sbjct: 5133 ctgaatttcaaatttcacagtgtgggttgatttctcactgt---catcagtttcaattat 5077 Query: 448 agcagactccacaccgaatccattgttgttatgcatcatattctcaaaa------aagcc 501 |||||| || |||| || |||| |||||||||||||||| ||||| | || | Sbjct: 5076 agcagattctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaact 5017 Query: 502 aggactccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctc 561 ||||||||| ||||| ||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 5016 aggactccatctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctc 4957 Query: 562 ttgcagagctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 4956 ttgcagagctttaagaacttcagttattatttctcgtggatgtgctcgaga 4906 Score = 157 bits (79), Expect = 5e-35 Identities = 106/115 (92%) Strand = Plus / Minus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 5531 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 5472 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctg 390 |||| |||||||||||||| ||||| || || ||||||||||||||||| ||||| Sbjct: 5471 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctg 5417
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 186 bits (94), Expect = 6e-44 Identities = 197/231 (85%), Gaps = 9/231 (3%) Strand = Plus / Plus Query: 388 ctgaatttcaaacttcacgatgtgggttgatttgtcaccgaggccatcagcttcaattat 447 |||||||||||| ||||| ||||||||||||| |||| | |||||| ||||||||| Sbjct: 26141125 ctgaatttcaaatttcacagtgtgggttgatttctcactgt---catcagtttcaattat 26141181 Query: 448 agcagactccacaccgaatccattgttgttatgcatcatattctcaaaa------aagcc 501 |||||| || |||| || |||| |||||||||||||||| ||||| | || | Sbjct: 26141182 agcagattctgcaccaaagccatggttgttatgcatcatactctcatgactgggaaaact 26141241 Query: 502 aggactccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctc 561 ||||||||| ||||| ||||||||||| || ||||||||||||||||||||||||||||| Sbjct: 26141242 aggactccatctgcatttcatgttataatgtccaatcttcttccagcaaacatttagctc 26141301 Query: 562 ttgcagagctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||||||||||| ||||||||||| |||||||||||||| |||||||| Sbjct: 26141302 ttgcagagctttaagaacttcagttattatttctcgtggatgtgctcgaga 26141352 Score = 157 bits (79), Expect = 5e-35 Identities = 106/115 (92%) Strand = Plus / Plus Query: 276 aaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtggtc 335 |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 26140727 aaaggactctcagctgagttagaaaggcagagcacaggtccagaaagagaagctgtggtc 26140786 Query: 336 cactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctg 390 |||| |||||||||||||| ||||| || || ||||||||||||||||| ||||| Sbjct: 26140787 cactgaccctttgcaagtcaagaaggtatttttcatcccttgttttgtaaagctg 26140841
>gb|AY675583.1| Zea mays putative serine/threonine-specific protein kinase (kin2) mRNA, partial cds Length = 849 Score = 123 bits (62), Expect = 7e-25 Identities = 113/130 (86%) Strand = Plus / Minus Query: 273 atcaaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtg 332 ||||||| |||||||| || ||||||||||| | |||| |||||||||||||||||||| Sbjct: 502 atcaaagaactctcagttgagttagaaaggccgcgcacaagtccagaaagaggagctgtg 443 Query: 333 gtccactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaa 392 | ||||| || |||||||| ||||| || || || || || ||||||||||||||||||| Sbjct: 442 gcccactgactctttgcaaatcgaggaggtatttctcgtctcttgttttgtacagctgaa 383 Query: 393 tttcaaactt 402 |||||||||| Sbjct: 382 tttcaaactt 373 Score = 121 bits (61), Expect = 3e-24 Identities = 103/117 (88%) Strand = Plus / Minus Query: 496 aaagccaggactccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatt 555 ||||||||||||||| |||||||||||||||||||| || ||||| |||||| ||||||| Sbjct: 291 aaagccaggactccatctgcacttcatgttatagtgacctatctttttccagtaaacatt 232 Query: 556 tagctcttgcagagctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || |||||||||||||| |||||||||| || |||||| |||||| |||||||| Sbjct: 231 taattcttgcagagctttcagcacttcagacattatttcttttggatgtgctcgaga 175
>gb|AY112593.1| Zea mays CL3200_1 mRNA sequence Length = 1019 Score = 123 bits (62), Expect = 7e-25 Identities = 113/130 (86%) Strand = Plus / Plus Query: 273 atcaaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtg 332 ||||||| |||||||| || ||||||||||| | |||| |||||||||||||||||||| Sbjct: 304 atcaaagaactctcagttgagttagaaaggccgcgcacaagtccagaaagaggagctgtg 363 Query: 333 gtccactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaa 392 | ||||| || |||||||| ||||| || || || || || ||||||||||||||||||| Sbjct: 364 gcccactgactctttgcaaatcgaggaggtatttctcgtctcttgttttgtacagctgaa 423 Query: 393 tttcaaactt 402 |||||||||| Sbjct: 424 tttcaaactt 433 Score = 99.6 bits (50), Expect = 1e-17 Identities = 99/117 (84%) Strand = Plus / Plus Query: 496 aaagccaggactccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatt 555 ||||||||||||||| |||||||||||||||||||| || ||| |||| ||||||| Sbjct: 515 aaagccaggactccatctgcacttcatgttatagtgacctatcnnnnnccagtaaacatt 574 Query: 556 tagctcttgcagagctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || |||||||||||||| |||||||||| || |||||| |||||| |||||||| Sbjct: 575 taattcttgcagagctttcagcacttcagacattatttcttttggatgtgctcgaga 631
>dbj|AB113570.1| Lotus japonicus mRNA for Ser/Thr protein kinase, complete cds, clone:LNZ002 Length = 1942 Score = 97.6 bits (49), Expect = 4e-17 Identities = 91/105 (86%) Strand = Plus / Minus Query: 508 ccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcag 567 |||||||||||||||||| ||||| ||||||||||||||||| ||||| | ||||||| Sbjct: 1330 ccacctgcacttcatgttgtagtgtccaatcttcttccagcatacattcaattcttgcaa 1271 Query: 568 agctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||||| || ||||| || ||||| || ||||| |||||||| Sbjct: 1270 agctttaaggacctcagtcattatttcacgaggatgagctcgaga 1226
>gb|U83797.4|STU83797 Solanum tuberosum StubSNF1 protein (SNF1) mRNA, complete cds Length = 1966 Score = 93.7 bits (47), Expect = 6e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 ||||||||||| || |||||||| ||||| || ||||| || |||||||||||||| || Sbjct: 1479 ttcatgttatactgaccaatctttttccaacatacattcagttcttgcagagctttcaga 1420 Query: 578 acttcagttatgatttctcgtggatgcgctcgaga 612 |||||||| || ||||| ||||||||||||||||| Sbjct: 1419 acttcagtcattatttcacgtggatgcgctcgaga 1385
>gb|AF143743.1| Lycopersicon esculentum SNF1 (SNF1) mRNA, complete cds Length = 1948 Score = 85.7 bits (43), Expect = 2e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 ||||||||||| || |||||||| ||||| || ||||| || |||||||||||||| | Sbjct: 1315 ttcatgttatactgaccaatctttttccaacatacattcagttcttgcagagctttcaaa 1256 Query: 578 acttcagttatgatttctcgtggatgcgctcgaga 612 |||||||| || ||||| ||||||||||||||||| Sbjct: 1255 acttcagtcattatttcacgtggatgcgctcgaga 1221
>gb|BT009349.1| Triticum aestivum clone wlm96.pk0007.e4:fis, full insert mRNA sequence Length = 2006 Score = 85.7 bits (43), Expect = 2e-13 Identities = 94/111 (84%) Strand = Plus / Minus Query: 502 aggactccacctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctc 561 ||||||||| || || |||||||||||||| ||||| || |||||| | ||||| || || Sbjct: 1346 aggactccatctacatttcatgttatagtgtccaatttttttccagtatacattcagttc 1287 Query: 562 ttgcagagctttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||||||| || ||||||||||| || | ||||| |||||| |||||||| Sbjct: 1286 ttgcagagccttcagcacttcagtcataacttctcttggatgtgctcgaga 1236 Score = 75.8 bits (38), Expect = 2e-10 Identities = 107/130 (82%) Strand = Plus / Minus Query: 273 atcaaaggactctcagctgggttagaaaggcagaacacaggtccagaaagaggagctgtg 332 |||||| |||||||||||| | ||||||||| | ||| || || ||||||||||| || | Sbjct: 1575 atcaaaagactctcagctgagctagaaaggcggcacatagatcaagaaagaggagatgcg 1516 Query: 333 gtccactaaccctttgcaagtcgagaagatacttatcatcccttgttttgtacagctgaa 392 | || || |||||||||| || ||||| || || ||||| ||||||||||| ||||||| Sbjct: 1515 gcccgctcgccctttgcaaatccagaaggtatttctcatctcttgttttgtaaagctgaa 1456 Query: 393 tttcaaactt 402 ||| ||||| Sbjct: 1455 gttcgaactt 1446
>gb|AC149804.11| Medicago truncatula clone mth2-73h22, complete sequence Length = 121763 Score = 81.8 bits (41), Expect = 2e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||||||| | ||||| || ||||| || ||||| || |||||||||||| Sbjct: 93087 ctgcacttcatgttatagggtccaatttttttccaacagacattcagttcttgcagagct 93028 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||| ||||| || || ||||| || || ||||||||||| Sbjct: 93027 ttaaggacttcggtcattatttcacgaggctgcgctcgaga 92987
>emb|AJ617128.1| Nicotiana plumbaginifolia cDNA-AFLP fragment, clone Np346 Length = 165 Score = 77.8 bits (39), Expect = 4e-11 Identities = 81/95 (85%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 ||||||||||| || |||||||| ||||| || |||||||| |||||||||||||| || Sbjct: 120 ttcatgttatactgaccaatctttttccaacacacatttagttcttgcagagctttcaga 61 Query: 578 acttcagttatgatttctcgtggatgcgctcgaga 612 |||||||| || || || |||||||| || ||||| Sbjct: 60 acttcagtcattatctcacgtggatgtgcccgaga 26
>gb|AY919676.1| Nicotiana benthamiana SNF1-related kinase (SnRK1) mRNA, partial cds Length = 664 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 533 ccaatcttcttccagcaaacatttagctcttgcagagctttaagcacttcagttatgatt 592 |||||||| ||||| || |||||||| |||||||||||||| || |||||||| || || Sbjct: 657 ccaatctttttccaacacacatttagttcttgcagagctttcagaacttcagtcattatc 598 Query: 593 tctcgtggatgcgctcgaga 612 || |||||||| |||||||| Sbjct: 597 tcacgtggatgtgctcgaga 578
>gb|AF128443.1|AF128443 Glycine max SNF-1-like serine/threonine protein kinase mRNA, complete cds Length = 1941 Score = 69.9 bits (35), Expect = 9e-09 Identities = 81/95 (85%), Gaps = 1/95 (1%) Strand = Plus / Minus Query: 519 tcatgttatagtgcccaatcttcttccag-caaacatttagctcttgcagagctttaagc 577 ||||| ||||||| |||||||||||||| |||||||||| ||||| ||||||||||| Sbjct: 1367 tcatggtatagtgtccaatcttcttccaaacaaacatttaattcttgtagagctttaagg 1308 Query: 578 acttcagttatgatttctcgtggatgcgctcgaga 612 || ||||| || ||||| ||||| || |||||||| Sbjct: 1307 acctcagtcattatttcacgtggttgggctcgaga 1273
>ref|NM_180157.1| Arabidopsis thaliana AKIN10; protein kinase AT3G01090 (AKIN10) transcript variant AT3G01090.2 mRNA, complete cds Length = 2208 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 1702 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 1643 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 1642 ttcaggacttccgtcattatttcacggggatgagcccgaga 1602 Score = 40.1 bits (20), Expect = 8.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 359 agatacttatcatcccttgttttgtacagctgaatttcaaactt 402 |||||||| || |||| ||||| |||| ||||||||||||||| Sbjct: 1867 agatacttgtcgtcccgagttttatacaactgaatttcaaactt 1824
>ref|NM_110974.3| Arabidopsis thaliana AKIN10; protein kinase AT3G01090 (AKIN10) transcript variant AT3G01090.1 mRNA, complete cds Length = 1989 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 1483 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 1424 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 1423 ttcaggacttccgtcattatttcacggggatgagcccgaga 1383 Score = 40.1 bits (20), Expect = 8.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 359 agatacttatcatcccttgttttgtacagctgaatttcaaactt 402 |||||||| || |||| ||||| |||| ||||||||||||||| Sbjct: 1648 agatacttgtcgtcccgagttttatacaactgaatttcaaactt 1605
>ref|NM_202646.1| Arabidopsis thaliana AKIN11; protein kinase AT3G29160 (AKIN11) transcript variant AT3G29160.3 mRNA, complete cds Length = 1799 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1362 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1303 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1302 acttcattcatgatttcacgaggatgcgc 1274
>ref|NM_202645.1| Arabidopsis thaliana AKIN11; protein kinase AT3G29160 (AKIN11) transcript variant AT3G29160.2 mRNA, complete cds Length = 1849 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1412 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1353 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1352 acttcattcatgatttcacgaggatgcgc 1324
>ref|NM_113839.2| Arabidopsis thaliana AKIN11; protein kinase AT3G29160 (AKIN11) transcript variant AT3G29160.1 mRNA, complete cds Length = 1910 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1392 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1333 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1332 acttcattcatgatttcacgaggatgcgc 1304
>gb|AC008261.5|ATAC008261 Arabidopsis thaliana chromosome III BAC T4P13 genomic sequence, complete sequence Length = 93735 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 65268 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 65209 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 65208 ttcaggacttccgtcattatttcacggggatgagcccgaga 65168
>gb|BT010386.1| Arabidopsis thaliana At3g01090 mRNA, complete cds Length = 1608 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 1358 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 1299 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 1298 ttcaggacttccgtcattatttcacggggatgagcccgaga 1258 Score = 40.1 bits (20), Expect = 8.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 359 agatacttatcatcccttgttttgtacagctgaatttcaaactt 402 |||||||| || |||| ||||| |||| ||||||||||||||| Sbjct: 1523 agatacttgtcgtcccgagttttatacaactgaatttcaaactt 1480
>gb|AY149927.1| Arabidopsis thaliana At3g29160/MXE2_16 mRNA, complete cds Length = 1539 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1289 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1230 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1229 acttcattcatgatttcacgaggatgcgc 1201
>emb|X99279.1|ATNPK A.thaliana mRNA for protein kinase Length = 1834 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1375 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1316 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1315 acttcattcatgatttcacgaggatgcgc 1287
>emb|X94757.1|ATSKIN2 A.thaliana mRNA for SNF1-related ser/thr protein kinase (1869 bp) Length = 1869 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 1418 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 1359 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 1358 ttcaggacttccgtcattatttcacggggatgagcccgaga 1318 Score = 40.1 bits (20), Expect = 8.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 359 agatacttatcatcccttgttttgtacagctgaatttcaaactt 402 |||||||| || |||| ||||| |||| ||||||||||||||| Sbjct: 1583 agatacttgtcgtcccgagttttatacaactgaatttcaaactt 1540
>emb|X94755.1|ATSKIN1 A.thaliana mRNA for SNF1-related ser/thr protein kinase (1852 bp) Length = 1852 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1316 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1257 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1256 acttcattcatgatttcacgaggatgcgc 1228
>gb|AY093170.1| Arabidopsis thaliana putative SNF1-related protein kinase (At3g01090) mRNA, complete cds Length = 2209 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 1702 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 1643 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 1642 ttcaggacttccgtcattatttcacggggatgagcccgaga 1602 Score = 40.1 bits (20), Expect = 8.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 359 agatacttatcatcccttgttttgtacagctgaatttcaaactt 402 |||||||| || |||| ||||| |||| ||||||||||||||| Sbjct: 1867 agatacttgtcgtcccgagttttatacaactgaatttcaaactt 1824
>gb|AY070468.1| Arabidopsis thaliana AT3g29160/MXE2_16 mRNA, complete cds Length = 1809 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1392 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1333 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1332 acttcattcatgatttcacgaggatgcgc 1304
>emb|BX824554.1|CNS0A6PQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH56ZA02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1704 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1364 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1305 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1304 acttcattcatgatttcacgaggatgcgc 1276
>emb|BX824275.1|CNS0A6XV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH35ZG03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1822 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 1412 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 1353 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 1352 acttcattcatgatttcacgaggatgcgc 1324
>dbj|AB018121.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXE2 Length = 86854 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||||| |||||||||||||| || ||||| || ||||| |||||||| | Sbjct: 77074 ttcatgttgtagtgaccaatcttcttccaacacacattgagttcttgaagagctttcaaa 77133 Query: 578 acttcagttatgatttctcgtggatgcgc 606 |||||| | |||||||| || |||||||| Sbjct: 77134 acttcattcatgatttcacgaggatgcgc 77162
>gb|M93023.1|ATHAKIN10A Arabidopsis thaliana SNF1-related protein kinase (AKin10) gene, complete cds Length = 3416 Score = 65.9 bits (33), Expect = 1e-07 Identities = 84/101 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 |||||||||||||| |||||||| ||||||||||| || ||||| | |||||||| ||| Sbjct: 2683 ctgcacttcatgttgtagtgccctatcttcttccaacatacattcaaatcttgcagggct 2624 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 || || ||||| || || ||||| || ||||| || ||||| Sbjct: 2623 ttcaggacttccgtcattatttcacggggatgagcccgaga 2583
>gb|BT009004.1| Triticum aestivum clone wdk2c.pk018.c16:fis, full insert mRNA sequence Length = 1899 Score = 60.0 bits (30), Expect = 9e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 508 ccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||||||| |||||||| ||||| ||| ||||||||||||| ||||||| Sbjct: 1356 ccacctgcatttcatgttgtagtgtccattcttcttccagcagacattta 1307 Score = 50.1 bits (25), Expect = 0.009 Identities = 73/89 (82%) Strand = Plus / Minus Query: 314 tccagaaagaggagctgtggtccactaaccctttgcaagtcgagaagatacttatcatcc 373 ||||| ||||||||||| |||||| |||| || |||| || || || ||||| |||||| Sbjct: 1556 tccaggaagaggagctgaggtccagtaactctctgcatatctagcaggtacttgtcatcc 1497 Query: 374 cttgttttgtacagctgaatttcaaactt 402 | || ||||| ||||| ||||||||||| Sbjct: 1496 ttggtcttgtaaagctggatttcaaactt 1468
>emb|AJ971809.1| Vicia faba mRNA for SNF1-related protein kinase (snrk1 gene) Length = 2024 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 ||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||||||| Sbjct: 1454 ctgcacttcatattatagtgtccaatttttttccaacagacattcagtccttgcagagct 1395 Query: 572 ttaag 576 ||||| Sbjct: 1394 ttaag 1390
>gb|M74113.1|RYERKIN1 Secale cereale RKIN1 mRNA, complete CDS Length = 1809 Score = 58.0 bits (29), Expect = 4e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 314 tccagaaagaggagctgtggtccactaaccctttgcaagtcgagaagatacttatcatcc 373 ||||| ||||||||||| |||||| |||| || |||| || || || ||||| |||||| Sbjct: 1578 tccaggaagaggagctgaggtccagtaactctctgcatatctagcaggtacttgtcatcc 1519 Query: 374 cttgttttgtacagctgaatttcaaactt 402 | || ||||| ||||||||||||||||| Sbjct: 1518 ttggtcttgtaaagctgaatttcaaactt 1490
>ref|XM_507272.1| PREDICTED Oryza sativa (japonica cultivar-group), P0419H09.18 mRNA Length = 2245 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 1515 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 1464
>ref|XM_483026.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2213 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 1519 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 1468
>dbj|AB101656.1| Oryza sativa (japonica cultivar-group) OSK24 gene for SnRK1b protein kinase, complete cds Length = 8146 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 6987 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 6936
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 23939061 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 23939010
>dbj|AP005918.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0419H09 Length = 143533 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 72212 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 72161
>dbj|AK100591.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023106J08, full insert sequence Length = 2213 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 1519 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 1468
>dbj|AK072723.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023135H07, full insert sequence Length = 2245 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 1515 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 1464
>dbj|D82037.1| Oryza sativa mRNA for OSK2, partial cds Length = 2138 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 1444 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 1393
>dbj|D82035.1| Oryza sativa mRNA for OSK4, complete cds Length = 1838 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||||| ||||||| Sbjct: 1383 ctccatctgcacttcatgttgtactgtccattcttcttccagcagacattta 1332
>gb|AY462018.1| Nicotiana attenuata SNF1-related protein kinase alpha subunit mRNA, complete cds Length = 1869 Score = 54.0 bits (27), Expect = 6e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||| | || ||||||||||| | ||||| || ||||||||||||| || Sbjct: 1474 ttcatgttgtagggtccgatcttcttccaacgtacattcagtccttgcagagctttcaga 1415 Query: 578 acttcagttatgatttctcgtggatgcgctcgaga 612 ||||| || || || || ||||||||||||||||| Sbjct: 1414 acttctgtcattatctcacgtggatgcgctcgaga 1380
>emb|AJ007990.1|HVU7990 Hordeum vulgare mRNA for SnRK1-type protein kinase, partial Length = 1542 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 508 ccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||||||| |||||||| ||| | ||| ||||||||||||| ||||||| Sbjct: 1299 ccacctgcatttcatgttgtagagtccattcttcttccagcagacattta 1250
>emb|X65606.1|HVBKIN12G H.vulgare BKIN12 gene for protein kinase Length = 5574 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 508 ccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||||||| |||||||| ||| | ||| ||||||||||||| ||||||| Sbjct: 4743 ccacctgcatttcatgttgtagagtccattcttcttccagcagacattta 4694
>emb|X65604.1|HVBKIN12M H.vulgare BKIN12 mRNA for protein kinase (partial) Length = 1539 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 508 ccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||||||| |||||||| ||| | ||| ||||||||||||| ||||||| Sbjct: 1299 ccacctgcatttcatgttgtagagtccattcttcttccagcagacattta 1250
>gb|AY222455.1| Lycopersicon esculentum SNF1-related protein kinase mRNA, complete cds Length = 1974 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 377 gttttgtacagctgaatttcaaacttcac 405 |||||||||||||| |||||||||||||| Sbjct: 1556 gttttgtacagctgcatttcaaacttcac 1528 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 515 cacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcag 567 |||||||| |||||||||||||| || ||||| | ||||||||| ||| |||| Sbjct: 1412 cacttcatattatagtgcccaatttttttccatcgaacatttagttctagcag 1360
>emb|Y10036.1|CSSNF1RPK C.sativus mRNA for SNF1-related protein kinase Length = 1778 Score = 50.1 bits (25), Expect = 0.009 Identities = 82/101 (81%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 ||||| ||||| || |||||||||||||||||||| ||||| ||||| | || || Sbjct: 1285 ctgcatttcatattgtagtgcccaatcttcttccaagccacattaagctcccgtagggcc 1226 Query: 572 ttaagcacttcagttatgatttctcgtggatgcgctcgaga 612 ||||| |||||||| || ||||| || ||||| |||||||| Sbjct: 1225 ttaagaacttcagtcataatttcacgaggatgagctcgaga 1185
>emb|X95996.1|STSNF1PKN S.tuberosum mRNA for SNF1-related protein kinase (1175bp) Length = 1175 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 377 gttttgtacagctgaatttcaaacttcac 405 |||||||||||||| |||||||||||||| Sbjct: 942 gttttgtacagctgcatttcaaacttcac 914 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 515 cacttcatgttatagtgcccaatcttcttccagcaaacatttag 558 |||||||| |||||||||||||| || ||||| | ||||||||| Sbjct: 798 cacttcatattatagtgcccaatttttttccatcgaacatttag 755
>emb|X96000.1|STPKIN1X8 S.tuberosum PKIN1 gene (668bp) Length = 668 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 515 cacttcatgttatagtgcccaatcttcttccagcaaacatttag 558 |||||||| |||||||||||||| || ||||| | ||||||||| Sbjct: 518 cacttcatattatagtgcccaatttttttccatcgaacatttag 475
>gb|U55768.1|OSU55768 Oryza sativa SNF1-related protein kinase (RSk1) mRNA, complete cds Length = 1770 Score = 48.1 bits (24), Expect = 0.034 Identities = 45/52 (86%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| |||||||||||||| || || ||| ||||||||||| | ||||||| Sbjct: 1307 ctccatctgcacttcatgttgtactgtccattcttcttccaggagacattta 1256
>dbj|D26602.1|TOBNPK5 Tobacco mRNA for protein kinase NPK5, complete cds Length = 2028 Score = 46.1 bits (23), Expect = 0.14 Identities = 77/95 (81%) Strand = Plus / Minus Query: 518 ttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagctttaagc 577 |||||||| ||| | || ||||||||||| | ||||| || ||||||||||||| || Sbjct: 1430 ttcatgttgtagggtccgatcttcttccaacgtacattcagtccttgcagagctttcaga 1371 Query: 578 acttcagttatgatttctcgtggatgcgctcgaga 612 || || || || || || ||||||||||||||||| Sbjct: 1370 acctctgtcattatctcacgtggatgcgctcgaga 1336
>gb|AC130221.4| Mus musculus BAC clone RP23-168E11 from chromosome 5, complete sequence Length = 200384 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 497 aagccaggactccacctgcact 518 |||||||||||||||||||||| Sbjct: 103332 aagccaggactccacctgcact 103311
>gb|AC009509.7| Homo sapiens 12p11-37.2-54.4 BAC RP11-1060J15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192690 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 504 gactccacctgcacttcatgtt 525 |||||||||||||||||||||| Sbjct: 76200 gactccacctgcacttcatgtt 76179
>gb|AC097500.3| Homo sapiens BAC clone RP11-335G13 from 2, complete sequence Length = 180215 Score = 44.1 bits (22), Expect = 0.53 Identities = 31/34 (91%) Strand = Plus / Plus Query: 290 tgggttagaaaggcagaacacaggtccagaaaga 323 ||||| |||||||||||||| | ||||||||||| Sbjct: 37634 tgggtaagaaaggcagaacataagtccagaaaga 37667
>gb|AC167333.3| Mus musculus BAC clone RP23-92L4 from chromosome 5, complete sequence Length = 236596 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 497 aagccaggactccacctgcact 518 |||||||||||||||||||||| Sbjct: 25550 aagccaggactccacctgcact 25571
>gb|AC145366.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0014O08 map near S2137, complete sequence Length = 134033 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 ccatcaaaacaaaaccacgtg 140 ||||||||||||||||||||| Sbjct: 58477 ccatcaaaacaaaaccacgtg 58457
>gb|AC121756.5| Homo sapiens 3 BAC RP11-455G2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 141000 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 467 ccattgttgttatgcatcatattct 491 |||||||||||||||||||| |||| Sbjct: 62874 ccattgttgttatgcatcattttct 62850
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 ccatcaaaacaaaaccacgtg 140 ||||||||||||||||||||| Sbjct: 8647311 ccatcaaaacaaaaccacgtg 8647291
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 ccatcaaaacaaaaccacgtg 140 ||||||||||||||||||||| Sbjct: 8718074 ccatcaaaacaaaaccacgtg 8718054
>emb|AJ971810.1| Pisum sativum mRNA for SNF1-related protein kinase (snrk1 gene) Length = 2126 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 512 ctgcacttcatgttatagtgcccaatcttcttccagcaaacatttagctcttgcagagct 571 ||||||||||| |||||||| ||||| || ||||| || ||||| | |||| |||||| Sbjct: 1372 ctgcacttcatattatagtgtccaatttttttccaacagacattcaatccttggagagct 1313 Query: 572 ttaag 576 ||||| Sbjct: 1312 ttaag 1308
>gb|AC087229.27| Mus musculus strain C57BL/6J chromosome 1 clone rp23-191a19, complete sequence Length = 215043 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 435 cagcttcaattatagcagact 455 ||||||||||||||||||||| Sbjct: 171554 cagcttcaattatagcagact 171574
>gb|AY398371.1| Danio rerio clone RK125A3D11 unknown (KM0003) mRNA, complete cds Length = 1943 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 ccgtcacctctggtttagta 106 |||||||||||||||||||| Sbjct: 1336 ccgtcacctctggtttagta 1317
>ref|XM_522981.1| PREDICTED: Pan troglodytes similar to immunoglobulin heavy chain variable region (LOC467586), mRNA Length = 978 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 773 tcaccatcttcaggatcaaa 754
>ref|XM_476970.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1866 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 ttgtacagctgaatttcaaa 399 |||||||||||||||||||| Sbjct: 1556 ttgtacagctgaatttcaaa 1537
>ref|NM_199704.1| Danio rerio utp15, U3 small nucleolar ribonucleoprotein, homolog (utp15), mRNA Length = 1872 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 ccgtcacctctggtttagta 106 |||||||||||||||||||| Sbjct: 1269 ccgtcacctctggtttagta 1250
>gb|AY866814.1| Homo sapiens clone 152e05 anti-tetanus toxoid immunoglobulin heavy chain variable region (IGH@) mRNA, partial cds Length = 383 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 170 tcaccatcttcaggatcaaa 151
>gb|AY393130.1| Homo sapiens clone RA702-M1-37.fa immunoglobulin heavy chain mRNA, partial cds Length = 402 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 158 tcaccatcttcaggatcaaa 139
>gb|AY393127.1| Homo sapiens clone RA702-M1-34.fa immunoglobulin heavy chain mRNA, partial cds Length = 381 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 158 tcaccatcttcaggatcaaa 139
>gb|BC045308.1| Danio rerio utp15, U3 small nucleolar ribonucleoprotein, homolog, mRNA (cDNA clone MGC:55320 IMAGE:2600767), complete cds Length = 1872 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 ccgtcacctctggtttagta 106 |||||||||||||||||||| Sbjct: 1269 ccgtcacctctggtttagta 1250
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 9982904 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 9982853
>emb|AJ009913.1|BTA9913 Bos taurus plp gene Length = 18767 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 245 ttgcagttgggaagtcaccatctt 268 ||||||||||| |||||||||||| Sbjct: 16513 ttgcagttggggagtcaccatctt 16490
>gb|AC132093.3| Mus musculus BAC clone RP24-506H13 from chromosome 10, complete sequence Length = 148364 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 taaatataggtctacaagcgtcat 39 ||||||||||||||||||| |||| Sbjct: 120193 taaatataggtctacaagcatcat 120170
>gb|AF533986.1| Homo sapiens anti-microcystin-LR heavy chain single chain Fv antibody mRNA, partial cds Length = 354 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 170 tcaccatcttcaggatcaaa 151
>gb|AC122212.2| Mus musculus BAC clone RP23-99K17 from 10, complete sequence Length = 198928 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 taaatataggtctacaagcgtcat 39 ||||||||||||||||||| |||| Sbjct: 23381 taaatataggtctacaagcatcat 23358
>gb|AY393655.1| Homo sapiens clone RA130BM-G1-165 immunoglobulin heavy chain variable region mRNA, partial cds Length = 450 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 158 tcaccatcttcaggatcaaa 139
>gb|AC137075.2| Genomic sequence for Oryza sativa, Nipponbare striain, clone OSJNBb0027B12, from chromosome 3, complete sequence Length = 127426 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 32820 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 32769
>gb|AC120544.9| Mus musculus chromosome 1, clone RP23-299N6, complete sequence Length = 223752 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 95 tctggtttagtaaataagtcctga 118 ||||||||||||||||||| |||| Sbjct: 152737 tctggtttagtaaataagttctga 152714
>emb|AL161730.9| Human DNA sequence from clone RP11-441I5 on chromosome 9 Contains the DMRTA1 gene for DMRT-like family A1 (DMO) and a CpG island, complete sequence Length = 170066 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 ctggtttagtaaataagtcc 115 |||||||||||||||||||| Sbjct: 21120 ctggtttagtaaataagtcc 21101
>emb|AL160173.9| Human DNA sequence from clone RP11-6I13 on chromosome 1q31.1-31.3, complete sequence Length = 33407 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 537 tcttcttccagcaaacattt 556 |||||||||||||||||||| Sbjct: 25722 tcttcttccagcaaacattt 25703
>emb|AL136162.18| Human DNA sequence from clone RP11-560J1 on chromosome 6 Contains the 5' end of the JMJ gene for jumonji protein, a novel gene and one CpG island, complete sequence Length = 129135 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 273 atcaaaggactctcagctgg 292 |||||||||||||||||||| Sbjct: 38278 atcaaaggactctcagctgg 38259
>emb|AL035701.13|HS8B1 Human DNA sequence from clone RP1-8B1 on chromosome 6p11.2-21.1 Contains the ENPP5 gene for ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function), the ENPP4 gene for ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) (NPP4, KIAA0879) and a novel gene, complete sequence Length = 126956 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 430 gccatcagcttcaattatag 449 |||||||||||||||||||| Sbjct: 119134 gccatcagcttcaattatag 119153
>emb|AL138653.1|ATT32A11 Arabidopsis thaliana DNA chromosome 3, BAC clone T32A11 Length = 129021 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 120 ccatcaaaacaaaaccacgtggtt 143 |||||| ||||||||||||||||| Sbjct: 42476 ccatcataacaaaaccacgtggtt 42499
>gb|BC103102.1| Bos taurus proteolipid protein, mRNA (cDNA clone MGC:128128 IMAGE:7983738), complete cds Length = 1490 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 245 ttgcagttgggaagtcaccatctt 268 ||||||||||| |||||||||||| Sbjct: 1241 ttgcagttggggagtcaccatctt 1218
>dbj|AK126233.1| Homo sapiens cDNA FLJ44245 fis, clone THYMU3009255 Length = 3294 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 117 tcaccatcttcaggatcaaa 136
>gb|AC060232.6| Homo sapiens chromosome 10 clone RP11-458D17, complete sequence Length = 167912 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 ctggtttagtaaataagtcc 115 |||||||||||||||||||| Sbjct: 18966 ctggtttagtaaataagtcc 18947
>gb|AC025441.6| Homo sapiens chromosome 5 clone CTD-2014E14, complete sequence Length = 56752 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 385 cagctgaatttcaaacttca 404 |||||||||||||||||||| Sbjct: 33433 cagctgaatttcaaacttca 33414
>ref|XM_696991.1| PREDICTED: Danio rerio hypothetical protein LOC555017 (LOC555017), mRNA Length = 1371 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 ccgtcacctctggtttagta 106 |||||||||||||||||||| Sbjct: 1269 ccgtcacctctggtttagta 1250
>dbj|AB101657.1| Oryza sativa (japonica cultivar-group) OSK35 gene for SnRK1b protein kinase, complete cds Length = 7074 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 6131 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 6080
>emb|AL626778.12| Mouse DNA sequence from clone RP23-326E2 on chromosome 4, complete sequence Length = 186208 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 aagtcaccatcttcaggatc 275 |||||||||||||||||||| Sbjct: 136185 aagtcaccatcttcaggatc 136166
>ref|NM_174149.3| Bos taurus proteolipid protein (PLP1), mRNA Length = 1490 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 245 ttgcagttgggaagtcaccatctt 268 ||||||||||| |||||||||||| Sbjct: 1241 ttgcagttggggagtcaccatctt 1218
>gb|AF062286.1|AF062286 Homo sapiens clone Xu-58 immunoglobulin heavy chain variable region (IGH) mRNA, partial cds Length = 435 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 227 tcaccatcttcaggatcaaa 208
>gb|AF062249.1|AF062249 Homo sapiens clone Xu-2 immunoglobulin heavy chain variable region (IGH) mRNA, partial cds Length = 417 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 227 tcaccatcttcaggatcaaa 208
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 9981025 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 9980974
>gb|AC007593.5|AC007593 Drosophila melanogaster, chromosome 2R, region 42E-43A, BAC clone BACR01C10, complete sequence Length = 173702 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 atgttatagtgcccaatctt 540 |||||||||||||||||||| Sbjct: 111546 atgttatagtgcccaatctt 111565
>gb|AC079226.7| Homo sapiens BAC clone RP11-18D7 from 4, complete sequence Length = 184032 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 378 ttttgtacagctgaatttca 397 |||||||||||||||||||| Sbjct: 16109 ttttgtacagctgaatttca 16128
>gb|AF297156.1|AF297156 Homo sapiens clone 5-4.1.2C immunoglobulin heavy chain variable region gene, partial cds Length = 285 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 131 tcaccatcttcaggatcaaa 112
>gb|AF308557.1|AF308557 Homo sapiens clone ST1R_M31 immunoglobulin heavy chain mRNA, partial cds Length = 420 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 128 tcaccatcttcaggatcaaa 109
>gb|AC127287.4| Mus musculus BAC clone RP23-345G7 from chromosome 7, complete sequence Length = 209901 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ccatcttcaggatcaaagga 281 |||||||||||||||||||| Sbjct: 165752 ccatcttcaggatcaaagga 165733
>emb|AL163193.5|HS73E6 Homo sapiens chromosome 9 BAC RP11-73E6, complete sequence Length = 175931 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 282 ctctcagctgggttagaaag 301 |||||||||||||||||||| Sbjct: 132140 ctctcagctgggttagaaag 132159
>dbj|AK069206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008I17, full insert sequence Length = 2927 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 2483 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 2432
>emb|Y17140.1|HOSA17140 Homo sapiens mRNA for IgG heavy chain, Fab fragment, clone AI-B38 Length = 366 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 170 tcaccatcttcaggatcaaa 151
>dbj|AK063365.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-D08, full insert sequence Length = 1866 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 ttgtacagctgaatttcaaa 399 |||||||||||||||||||| Sbjct: 1556 ttgtacagctgaatttcaaa 1537
>gb|BC089421.1| Homo sapiens cDNA clone MGC:105008 IMAGE:3055541, complete cds Length = 1792 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 233 tcaccatcttcaggatcaaa 214
>gb|AF103142.1|AF103142 Homo sapiens clone N147 immunoglobulin heavy chain variable region mRNA, partial cds Length = 376 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 146 tcaccatcttcaggatcaaa 127
>gb|AE003789.5| Drosophila melanogaster chromosome 2R, section 6 of 73 of the complete sequence Length = 415717 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 atgttatagtgcccaatctt 540 |||||||||||||||||||| Sbjct: 398414 atgttatagtgcccaatctt 398433
>ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) on chromosome 14 Length = 1279711 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 556273 tcaccatcttcaggatcaaa 556254
>gb|AF077421.1|AF077421 Homo sapiens clone BF3N3g1B11 immunoglobulin heavy chain variable region gene, partial cds Length = 306 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 125 tcaccatcttcaggatcaaa 106
>gb|AF077414.1|AF077414 Homo sapiens clone BF3N2g1C05 immunoglobulin heavy chain variable region gene, partial cds Length = 300 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 131 tcaccatcttcaggatcaaa 112
>gb|AY944709.1| Homo sapiens clone CRV-CD5-25-VH immunoglobulin heavy chain variable region mRNA, partial cds Length = 372 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 176 tcaccatcttcaggatcaaa 157
>gb|AF015193.1|AF015193 Onchocerca volvulus mitochondrion, complete genome Length = 13747 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 aaccatcaaaacaaaaccac 137 |||||||||||||||||||| Sbjct: 8368 aaccatcaaaacaaaaccac 8349
>emb|BX005155.4| Zebrafish DNA sequence from clone CH211-286N5 in linkage group 7, complete sequence Length = 139365 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 469 attgttgttatgcatcatat 488 |||||||||||||||||||| Sbjct: 60622 attgttgttatgcatcatat 60603
>gb|AY430007.1| Homo sapiens isolate NSB-12-3-H1-C1 immunoglobulin heavy chain variable region gene, partial cds Length = 268 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 114 tcaccatcttcaggatcaaa 95
>gb|L23236.1|HUMIGHZAE Human rearranged IgH chain gene, VJ6 region, partial cds Length = 192 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 35 tcaccatcttcaggatcaaa 16
>emb|X03098.1|BTPLPR1 Bovine mRNA fragment for lipophilin (aa 129-276) (myelin proteolipid protein) Length = 929 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 245 ttgcagttgggaagtcaccatctt 268 ||||||||||| |||||||||||| Sbjct: 710 ttgcagttggggagtcaccatctt 687
>gb|M99642.1|HUMIGH124P Human immunoglobulin heavy chain variable region V1-24P (IGHV@) gene, exons 1-2 Length = 600 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 379 tcaccatcttcaggatcaaa 360
>emb|Z80577.1|HSZ80577 H.sapiens BF2N1-g1B06 gene for immunoglobulin heavy chain variable region Length = 306 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 131 tcaccatcttcaggatcaaa 112
>emb|Z80451.1|HSZ80451 H.sapiens BF2P1-g1G08 gene for immunoglobulin heavy chain variable region Length = 294 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 128 tcaccatcttcaggatcaaa 109
>emb|Z80450.1|HSZ80450 H.sapiens BF2P1-g1F06 gene for immunoglobulin heavy chain variable region Length = 294 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 128 tcaccatcttcaggatcaaa 109
>emb|Z80590.1|HSZ80590 H.sapiens BF2N2-g1E02 gene for immunoglobulin heavy chain variable region Length = 294 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 116 tcaccatcttcaggatcaaa 97
>emb|Z37307.1|HSIGVHC19 H.sapiens rearranged immunoglobulin heavy chain V-region (VH-1) Length = 402 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 170 tcaccatcttcaggatcaaa 151
>emb|Z12307.1|HSIGDP5 H.sapiens germline Ig H-chain V-region (DP-5) Length = 294 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 170 tcaccatcttcaggatcaaa 151
>emb|X87041.1|HSB8G1F03 H.sapiens B8-g1F03 gene for immunoglobulin heavy chain variable region Length = 312 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 140 tcaccatcttcaggatcaaa 121
>emb|AJ406646.1|HSA406646 Homo sapiens partial VH1-24 gene for rearranged immunoglobulin heavy chain variable region, isolate case4-PTGC1-148 Length = 246 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 74 tcaccatcttcaggatcaaa 55
>emb|AJ406643.1|HSA406643 Homo sapiens partial VH1-24 gene for rearranged immunoglobulin heavy chain variable region, isolate case4-PTGC1-176 Length = 348 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 170 tcaccatcttcaggatcaaa 151
>emb|AJ347226.1|HSA347226 Homo sapiens partial IGVH1-24 gene for immunoglobulin heavy chain variable region, isolate case9-cell419 Length = 250 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 74 tcaccatcttcaggatcaaa 55
>emb|AJ496464.1|HSA496464 Homo sapiens partial mRNA for immunoglobulin heavy chain variable region (IGHV gene), clone 5f7 Length = 381 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 258 gtcaccatcttcaggatcaa 277 |||||||||||||||||||| Sbjct: 171 gtcaccatcttcaggatcaa 152
>dbj|D82038.1| Oryza sativa mRNA for OSK3, complete cds Length = 1872 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 1418 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 1367
>dbj|D82036.1| Oryza sativa mRNA for OSK5, complete cds Length = 2161 Score = 40.1 bits (20), Expect = 8.3 Identities = 44/52 (84%) Strand = Plus / Minus Query: 506 ctccacctgcacttcatgttatagtgcccaatcttcttccagcaaacattta 557 ||||| ||||| |||||||| || || ||| ||||||||||| | ||||||| Sbjct: 1418 ctccatctgcatttcatgttgtactgtccattcttcttccaggagacattta 1367
>dbj|AB019439.1| Homo sapiens DNA for immunoglobulin heavy-chain variable region, complete sequence, 3 of 5 Length = 200000 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcaccatcttcaggatcaaa 278 |||||||||||||||||||| Sbjct: 156273 tcaccatcttcaggatcaaa 156254 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,758,114 Number of Sequences: 3902068 Number of extensions: 5758114 Number of successful extensions: 95986 Number of sequences better than 10.0: 137 Number of HSP's better than 10.0 without gapping: 137 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95588 Number of HSP's gapped (non-prelim): 396 length of query: 612 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 589 effective length of database: 17,143,297,704 effective search space: 10097402347656 effective search space used: 10097402347656 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
