>emb|AL354711.24| Human DNA sequence from clone RP11-340N12 on chromosome 9 Contains the
3' end of a novel gene (FLJ25636) and the 5' end of a
novel gene (FLJ20276), complete sequence
Length = 162126
Score = 44.1 bits (22), Expect = 0.43
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 235 atcactcagggaaacatgagggaaaa 260
||||||||||||||| ||||||||||
Sbjct: 26556 atcactcagggaaacctgagggaaaa 26581
>emb|AL365181.24| Human DNA sequence from clone RP11-284F21 on chromosome 1 Contains the
5' end of the MEF2D gene for MADS box transcription
enhancer factor 2 polypeptide D (myocyte enhancer factor
2D), the IQGAP3 gene for IQ motif containing GTPase
activating protein 3, a novel gene, the APOA1BP gene for
apolipoprotein A-I binding protein, a novel gene
(FLJ20249), a novel gene, the gene for brain link
protein-1 (BRAL1), a novel gene, the 5' end of the BCAN
gene for brevican, the 3' end of a novel gene and three
CpG islands, complete sequence
Length = 164512
Score = 40.1 bits (20), Expect = 6.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 81 ggcaatgtggagaatacatg 100
||||||||||||||||||||
Sbjct: 73438 ggcaatgtggagaatacatg 73419
>dbj|AP001476.1| Homo sapiens genomic DNA, chromosome 21q22.3, clone:f25H12, telomere
region, complete sequence
Length = 32025
Score = 40.1 bits (20), Expect = 6.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 322 cactcacaggtccacacgtc 341
||||||||||||||||||||
Sbjct: 30238 cactcacaggtccacacgtc 30257
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,303,882
Number of Sequences: 3902068
Number of extensions: 4303882
Number of successful extensions: 86382
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86251
Number of HSP's gapped (non-prelim): 130
length of query: 498
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 476
effective length of database: 17,147,199,772
effective search space: 8162067091472
effective search space used: 8162067091472
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)