ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags6a14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 101 3e-19
2emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 64 8e-08
3gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 64 8e-08
4emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 60 1e-06
5emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 60 1e-06
6emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 54 7e-05
7emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 54 7e-05
8emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 52 3e-04
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 50 0.001
10gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 42 0.28
11gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 42 0.28
12gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 42 0.28
13emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 42 0.28
14gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 42 0.28
15gb|AC151778.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 38 4.4
16gb|AC121499.9| Mus musculus chromosome 9, clone RP23-269E5, comp... 38 4.4
17gb|AC147836.2| Xenopus tropicalis clone CH216-26D18, complete se... 38 4.4
18gb|AC022166.7| Homo sapiens chromosome 16 clone RP11-525K10, com... 38 4.4
19emb|BX649250.6| Zebrafish DNA sequence from clone DKEY-53B2 in l... 38 4.4

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  101 bits (51), Expect = 3e-19
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                       
Query: 39  atatatatcccacatgaagataatatgagagcatttattcatatatangnangtatgtgt 98
           ||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||
Sbjct: 520 atatatatcccacatgaagataatatgagagcatttattcatatatatgtatgtatgtgt 461



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score = 63.9 bits (32), Expect = 8e-08
 Identities = 51/57 (89%), Gaps = 1/57 (1%)
 Strand = Plus / Minus

                                                                     
Query: 42   tatatcccacatgaagataatatgagagcatttattcatatatangnangtatgtgt 98
            |||||||||||||||||||||||  | ||||||||||||||||| | | ||||||||
Sbjct: 1121 tatatcccacatgaagataatat-tgtgcatttattcatatatatgtatgtatgtgt 1066



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score = 63.9 bits (32), Expect = 8e-08
 Identities = 51/57 (89%), Gaps = 1/57 (1%)
 Strand = Plus / Minus

                                                                     
Query: 42   tatatcccacatgaagataatatgagagcatttattcatatatangnangtatgtgt 98
            |||||||||||||||||||||||  | ||||||||||||||||| | | ||||||||
Sbjct: 2517 tatatcccacatgaagataatat-tgtgcatttattcatatatatgtatgtatgtgt 2462



to top

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score = 60.0 bits (30), Expect = 1e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 56  agataatatgagagcatttattcatatata 85
           ||||||||||||||||||||||||||||||
Sbjct: 442 agataatatgagagcatttattcatatata 413



to top

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score = 60.0 bits (30), Expect = 1e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                          
Query: 56   agataatatgagagcatttattcatatata 85
            ||||||||||||||||||||||||||||||
Sbjct: 1738 agataatatgagagcatttattcatatata 1709



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score = 54.0 bits (27), Expect = 7e-05
 Identities = 39/42 (92%), Gaps = 2/42 (4%)
 Strand = Plus / Minus

                                                      
Query: 46   tcccacatgaagataatat--gagagcatttattcatatata 85
            ||||||||| |||||||||  |||||||||||||||||||||
Sbjct: 1514 tcccacatggagataatatatgagagcatttattcatatata 1473



to top

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score = 54.0 bits (27), Expect = 7e-05
 Identities = 39/42 (92%), Gaps = 2/42 (4%)
 Strand = Plus / Minus

                                                     
Query: 46  tcccacatgaagataatat--gagagcatttattcatatata 85
           ||||||||| |||||||||  |||||||||||||||||||||
Sbjct: 512 tcccacatggagataatatatgagagcatttattcatatata 471



to top

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 56   agataatatgagagcatttattcata 81
            ||||||||||||||||||||||||||
Sbjct: 1750 agataatatgagagcatttattcata 1725



to top

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 61  atatgagagcatttattcatatata 85
           |||||||||||||||||||||||||
Sbjct: 540 atatgagagcatttattcatatata 516



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score = 42.1 bits (21), Expect = 0.28
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 49   cacatgaagataatatgagagcatttattcatatata 85
            |||||| |||| |||| ||||||||||||||| ||||
Sbjct: 3339 cacatggagatcatatcagagcatttattcatgtata 3303



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score = 42.1 bits (21), Expect = 0.28
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 49  cacatgaagataatatgagagcatttattcatatata 85
           |||||| |||| |||| ||||||||||||||| ||||
Sbjct: 548 cacatggagatcatatcagagcatttattcatgtata 512



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score = 42.1 bits (21), Expect = 0.28
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 49  cacatgaagataatatgagagcatttattcatatata 85
           |||||| |||| |||| ||||||||||||||| ||||
Sbjct: 543 cacatggagatcatatcagagcatttattcatgtata 507



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score = 42.1 bits (21), Expect = 0.28
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 49  cacatgaagataatatgagagcatttattcatatata 85
           |||||| |||| |||| ||||||||||||||| ||||
Sbjct: 489 cacatggagatcatatcagagcatttattcatgtata 453



to top

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score = 42.1 bits (21), Expect = 0.28
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 61  atatgagagcatttattcatatata 85
           |||||||| ||||||||||||||||
Sbjct: 564 atatgagatcatttattcatatata 540



to top

>gb|AC151778.1| Ornithorhynchus anatinus chromosome UNK clone OABb-238A1, complete
            sequence
          Length = 168798

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 64   tgagagcatttattcatat 82
            |||||||||||||||||||
Sbjct: 8610 tgagagcatttattcatat 8628



to top

>gb|AC121499.9| Mus musculus chromosome 9, clone RP23-269E5, complete sequence
          Length = 212061

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     taatatgagagcatttatt 77
              |||||||||||||||||||
Sbjct: 157545 taatatgagagcatttatt 157527



to top

>gb|AC147836.2| Xenopus tropicalis clone CH216-26D18, complete sequence
          Length = 157688

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     taatatgagagcatttatt 77
              |||||||||||||||||||
Sbjct: 140781 taatatgagagcatttatt 140763



to top

>gb|AC022166.7| Homo sapiens chromosome 16 clone RP11-525K10, complete sequence
          Length = 163998

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    tatatatcccacatgaaga 58
             |||||||||||||||||||
Sbjct: 13667 tatatatcccacatgaaga 13685



to top

>emb|BX649250.6| Zebrafish DNA sequence from clone DKEY-53B2 in linkage group 20,
             complete sequence
          Length = 165729

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 65    gagagcatttattcatata 83
             |||||||||||||||||||
Sbjct: 79657 gagagcatttattcatata 79639


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 591,272
Number of Sequences: 3902068
Number of extensions: 591272
Number of successful extensions: 41895
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41870
Number of HSP's gapped (non-prelim): 23
length of query: 99
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 78
effective length of database: 17,151,101,840
effective search space: 1337785943520
effective search space used: 1337785943520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top