ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags5l09 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 1170 bits (590), Expect = 0.0 Identities = 595/597 (99%) Strand = Plus / Minus Query: 5 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 64 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1020 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 961 Query: 65 cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 960 cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 901 Query: 125 ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 900 ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 841 Query: 185 ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 244 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 840 ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 781 Query: 245 ggagatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgac 304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 780 ggagatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgac 721 Query: 305 ccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggagacggc 364 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 720 ccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggagacggc 661 Query: 365 ggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaa 424 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 660 ggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaa 601 Query: 425 gccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggc 484 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 600 gccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggc 541 Query: 485 gtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgc 544 |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 540 gtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgc 481 Query: 545 gccgatgccggtgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 480 gccgatgccggtgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 424
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 682 bits (344), Expect = 0.0 Identities = 379/391 (96%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786 Query: 271 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 330 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726 Query: 331 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666 Query: 391 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 450 ||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606 Query: 451 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaagg 510 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| Sbjct: 605 ccaggctgcccttcttggggtccacggccgtggcgtacaccgtgtacaccagcccgaagg 546 Query: 511 tcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggtgc 570 |||| ||||||||||| ||||||| || ||||||||||||||| | ||||||||||||| Sbjct: 545 tcatcacgatctccagcaccaccgcctcccacgcgccgatgccactcagcccgaaggtgc 486 Query: 571 cggtggggagcccgccggtggagaagcggag 601 ||||||||||||||||||||||||||||||| Sbjct: 485 cggtggggagcccgccggtggagaagcggag 455 Score = 46.1 bits (23), Expect = 0.13 Identities = 36/39 (92%), Gaps = 1/39 (2%) Strand = Plus / Minus Query: 4 cgaattcacaggttttacacaagcaaattgacagggtcg 42 ||||||||||| ||||||| |||||||||||||| |||| Sbjct: 1064 cgaattcacag-ttttacagaagcaaattgacagtgtcg 1027 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 117 aagcaaacttaaacgactcatg 138 |||||||||||||||||||||| Sbjct: 977 aagcaaacttaaacgactcatg 956
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 513 bits (259), Expect = e-142 Identities = 360/394 (91%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 268 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695 Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 328 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635 Query: 329 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 388 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575 Query: 389 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||| || ||||||||||| || ||||||||||||||||||||||| |||||||| Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515 Query: 449 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 508 |||||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 514 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 455 Query: 509 ggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggt 568 |||||| ||||||||||| |||| || || |||| | | ||| || ||||||||||| Sbjct: 454 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 395 Query: 569 gccggtggggagcccgccggtggagaagcggagc 602 ||| |||| ||||||| || |||||||||||| Sbjct: 394 gcccgtggcctgcccgcccgtcgagaagcggagc 361
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 505 bits (255), Expect = e-140 Identities = 359/394 (91%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 268 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791 Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 328 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731 Query: 329 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 388 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671 Query: 389 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||| || |||||||||||||| ||||||||||||||||||||||| |||||||| Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611 Query: 449 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 508 |||||||||||||||||| ||||| || || || |||||||||||||||||||||||||| Sbjct: 610 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 551 Query: 509 ggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggt 568 |||||| ||||||||||| |||| || || |||| | | ||| || ||||||||||| Sbjct: 550 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 491 Query: 569 gccggtggggagcccgccggtggagaagcggagc 602 ||| |||| ||||||| || |||||||||||| Sbjct: 490 gcccgtggcctgcccgcccgtcgagaagcggagc 457
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Plus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 2544956 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545015 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 2545016 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 2545075 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 2545076 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 2545121 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 8319519 acggacggacgggcgggcggg 8319499
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 125138 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 125079 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 125078 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 125019 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 125018 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 124973
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Plus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 2545066 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545125 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 2545126 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 2545185 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 2545186 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 2545231 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 8317354 acggacggacgggcgggcggg 8317334
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 604 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 545 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 544 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 485 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 484 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 439
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 613 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 554 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 553 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 494 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 493 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 448
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 615 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 556 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 555 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 496 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 495 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 450
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 505 bits (255), Expect = e-140 Identities = 368/406 (90%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 611 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 552 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 551 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 492 Query: 556 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggag 601 | || |||||||||||||||| |||||||||||||||||||||||| Sbjct: 491 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggag 446
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 498 bits (251), Expect = e-137 Identities = 358/394 (90%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 268 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790 Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 328 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730 Query: 329 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 388 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670 Query: 389 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||| || ||||||||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610 Query: 449 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 508 |||||||||||||||||| ||||| || || || |||||||||||||||||||||||||| Sbjct: 609 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 550 Query: 509 ggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggt 568 |||||| ||||||||||| |||| || || |||| | | ||| || ||||||||||| Sbjct: 549 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 490 Query: 569 gccggtggggagcccgccggtggagaagcggagc 602 ||| |||| ||||||| || |||||||||||| Sbjct: 489 gcccgtggcctgcccgcccgtcgagaagcggagc 456
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 498 bits (251), Expect = e-137 Identities = 358/394 (90%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 268 |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787 Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 328 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727 Query: 329 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 388 |||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667 Query: 389 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||| || ||||||||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607 Query: 449 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 508 |||||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| Sbjct: 606 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 547 Query: 509 ggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggt 568 |||||| ||||||||||| |||| || || |||| | | ||| || ||||||||||| Sbjct: 546 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 487 Query: 569 gccggtggggagcccgccggtggagaagcggagc 602 ||| |||| ||||||| || |||||||||||| Sbjct: 486 gcccgtggcctgcccgcccgtcgagaagcggagc 453
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 488 bits (246), Expect = e-134 Identities = 356/393 (90%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 268 |||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||| Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694 Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 328 ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || |||| Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634 Query: 329 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 388 ||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||| Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574 Query: 389 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514 Query: 449 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 508 ||| |||||||||||||||||||| ||||||||||||||||| ||||| || || ||||| Sbjct: 513 gccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaa 454 Query: 509 ggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggt 568 |||||||||||||||||| |||| | || |||| || || |||||| || |||||||| Sbjct: 453 ggtcatgacgatctccagcaccagggcctcccacacggagacgccggtcaggccgaaggt 394 Query: 569 gccggtggggagcccgccggtggagaagcggag 601 |||||||| |||||||||||||||||||||||| Sbjct: 393 gccggtggcgagcccgccggtggagaagcggag 361
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 460 bits (232), Expect = e-126 Identities = 342/379 (90%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 315 | | |||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||| Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260 Query: 316 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 375 ||||| || |||| ||||||||||||||| ||||||||||||||||| |||||||||| Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200 Query: 376 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 435 | |||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140 Query: 436 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 495 |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| Sbjct: 139 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 80 Query: 496 acaccagcccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccgg 555 | || || ||||||||||||||||||||||| |||| | || |||| || || ||||| Sbjct: 79 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 20 Query: 556 tgagcccgaaggtgccggt 574 | || |||||||||||||| Sbjct: 19 tcaggccgaaggtgccggt 1
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 383 bits (193), Expect = e-103 Identities = 347/398 (87%), Gaps = 3/398 (0%) Strand = Plus / Minus Query: 207 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 263 |||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||| Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778 Query: 264 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 323 || || | | ||||| | | ||||||| |||||||||||||||||||| |||| Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718 Query: 324 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 383 ||| |||||||||||| | |||||||||||| |||||||||||||||||||||||| Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658 Query: 384 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 443 |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598 Query: 444 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 503 |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 597 atggtgcccaggctgcccttcttggggtcgaccgcggtggcgtacacagtgtacaccaga 538 Query: 504 ccgaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccg 563 ||||||||||| |||||||| || |||| | || |||| || ||||||||| || ||| Sbjct: 537 ccgaaggtcatcacgatctcgagcaccagggcctcccacacggagatgccggtcaggccg 478 Query: 564 aaggtgccggtggggagcccgccggtggagaagcggag 601 ||||||||||||||||||||||||||| ||||||||| Sbjct: 477 aaggtgccggtggggagcccgccggtgacgaagcggag 440
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 359 bits (181), Expect = 7e-96 Identities = 279/312 (89%) Strand = Plus / Plus Query: 290 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 349 |||||| ||||| |||||||||||||||||| || |||| ||||||||||||||| || Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278 Query: 350 gccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgtt 409 ||||||||||||||| ||||||||||| |||||| ||| |||||||||||||||||||| Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338 Query: 410 ggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggg 469 ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgcccttcttggg 398 Query: 470 gtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggac 529 ||| ||||||||||||||||| ||||| || || ||||||||||||||||||||||| || Sbjct: 399 gtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatctccagcac 458 Query: 530 caccgncttccacgcgccgatgccggtgagcccgaaggtgccggtggggagcccgccggt 589 || | || |||| || || |||||| || |||||||||||||||| |||||||||||| Sbjct: 459 cagggcctcccacacggagacgccggtcaggccgaaggtgccggtggcgagcccgccggt 518 Query: 590 ggagaagcggag 601 |||||||||||| Sbjct: 519 ggagaagcggag 530 Score = 97.6 bits (49), Expect = 4e-17 Identities = 55/57 (96%) Strand = Plus / Plus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 252 ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 246 bits (124), Expect = 7e-62 Identities = 208/236 (88%) Strand = Plus / Minus Query: 297 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 356 |||||||||||||||||||| |||| | |||| | | | |||||| ||| ||||||||| Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623 Query: 357 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 416 |||||||||||||||||||| |||||| ||||||||| || | ||||||||||||||| Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563 Query: 417 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 476 |||||||||||||||||||||||||||||| ||| ||| ||||||||||||||| ||| Sbjct: 562 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 503 Query: 477 gcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 532 || |||||||||||||||||||| || |||||||||||||| |||||||| ||||| Sbjct: 502 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 447
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 222 bits (112), Expect = 1e-54 Identities = 186/211 (88%) Strand = Plus / Minus Query: 337 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 396 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569 Query: 397 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 456 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 509 Query: 457 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 516 |||||||||||| || || |||||||||||||| ||||| || || ||||||||||||| Sbjct: 508 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 449 Query: 517 cgatctccaggaccaccgncttccacgcgcc 547 ||||||| | ||||||| ||||| ||||| Sbjct: 448 cgatctcgaacaccaccgcgttccaggcgcc 418
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 222 bits (112), Expect = 1e-54 Identities = 186/211 (88%) Strand = Plus / Plus Query: 337 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 396 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858 Query: 397 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 456 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 43108918 Query: 457 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 516 |||||||||||| || || |||||||||||||| ||||| || || ||||||||||||| Sbjct: 43108919 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 43108978 Query: 517 cgatctccaggaccaccgncttccacgcgcc 547 ||||||| | ||||||| ||||| ||||| Sbjct: 43108979 cgatctcgaacaccaccgcgttccaggcgcc 43109009 Score = 91.7 bits (46), Expect = 3e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 340 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 399 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420 Query: 400 cgaggatgttggcgccgacgatgaagccga 429 ||||||||||||||||||||| || ||||| Sbjct: 7297419 cgaggatgttggcgccgacgacgaggccga 7297390 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 420 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 7302352 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 222 bits (112), Expect = 1e-54 Identities = 186/211 (88%) Strand = Plus / Plus Query: 337 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 396 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887 Query: 397 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 456 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 105947 Query: 457 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 516 |||||||||||| || || |||||||||||||| ||||| || || ||||||||||||| Sbjct: 105948 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 106007 Query: 517 cgatctccaggaccaccgncttccacgcgcc 547 ||||||| | ||||||| ||||| ||||| Sbjct: 106008 cgatctcgaacaccaccgcgttccaggcgcc 106038
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 222 bits (112), Expect = 1e-54 Identities = 186/211 (88%) Strand = Plus / Minus Query: 337 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 396 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593 Query: 397 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 456 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 533 Query: 457 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 516 |||||||||||| || || |||||||||||||| ||||| || || ||||||||||||| Sbjct: 532 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 473 Query: 517 cgatctccaggaccaccgncttccacgcgcc 547 ||||||| | ||||||| ||||| ||||| Sbjct: 472 cgatctcgaacaccaccgcgttccaggcgcc 442
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 222 bits (112), Expect = 1e-54 Identities = 186/211 (88%) Strand = Plus / Minus Query: 337 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 396 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642 Query: 397 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 456 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 582 Query: 457 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 516 |||||||||||| || || |||||||||||||| ||||| || || ||||||||||||| Sbjct: 581 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 522 Query: 517 cgatctccaggaccaccgncttccacgcgcc 547 ||||||| | ||||||| ||||| ||||| Sbjct: 521 cgatctcgaacaccaccgcgttccaggcgcc 491
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 222 bits (112), Expect = 1e-54 Identities = 186/211 (88%) Strand = Plus / Minus Query: 337 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 396 |||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||| Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579 Query: 397 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 456 || |||||||||||||||||||||||||||||||||||||||| |||||| || ||| Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 519 Query: 457 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 516 |||||||||||| || || |||||||||||||| ||||| || || ||||||||||||| Sbjct: 518 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 459 Query: 517 cgatctccaggaccaccgncttccacgcgcc 547 ||||||| | ||||||| ||||| ||||| Sbjct: 458 cgatctcgaacaccaccgcgttccaggcgcc 428
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 13250891 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 13250890 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 13250831 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 13250830 gatgatctcca 13250820 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 413 gccgacgatgaagccgatggcgat 436 ||||| |||||||||||||||||| Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 12701 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 12700 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 12641 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 12640 gatgatctcca 12630 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 168079 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 168078 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 168019 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 168018 gatgatctcca 168008 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 591 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 590 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 531 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 530 gatgatctcca 520 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 532 gatgatctcca 522 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 471 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 470 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 411 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 410 gatgatctcca 400 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 533 gatgatctcca 523 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 531 gatgatctcca 521 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 533 gatgatctcca 523 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 220 bits (111), Expect = 4e-54 Identities = 171/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||||||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 531 gatgatctcca 521 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 212 bits (107), Expect = 1e-51 Identities = 170/191 (89%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 394 |||| ||| |||||| ||||||||| || ||||||||||| |||||||||||| ||| Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653 Query: 395 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593 Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533 Query: 515 gacgatctcca 525 || |||||||| Sbjct: 532 gatgatctcca 522 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| || |||||||||||||||||||| |||||||||||||||||| Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 212 bits (107), Expect = 1e-51 Identities = 202/236 (85%) Strand = Plus / Plus Query: 297 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 356 |||||||||||||||||||| |||| | |||| | | | |||||| || ||||||||| Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388 Query: 357 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 416 |||||||||| ||||||||| |||||| ||||||| | ||||||||||||||| Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448 Query: 417 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 476 |||||||||||||||||||||||||||||| ||| ||| ||||||||||||||| ||| Sbjct: 449 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 508 Query: 477 gcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 532 || |||||||||||||||||||| || |||||||||||||| |||||||| ||||| Sbjct: 509 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 564
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 202 bits (102), Expect = 1e-48 Identities = 162/182 (89%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || |||||||||||| |||||||||||| |||| ||||||| Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||||||||| || ||||||||||| ||| ||||| Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccgagggacccctt 544 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||||| |||||||||||||||| ||||| || ||||||||||| | || |||||| Sbjct: 543 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 484 Query: 524 ca 525 || Sbjct: 483 ca 482 Score = 63.9 bits (32), Expect = 6e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 202 bits (102), Expect = 1e-48 Identities = 162/182 (89%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || |||||||||||| |||||||||||| |||| | ||||| Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggaaccctt 547 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||||| |||||||||||||||| ||||| || ||||||||||| | || |||||| Sbjct: 546 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 487 Query: 524 ca 525 || Sbjct: 486 ca 485 Score = 63.9 bits (32), Expect = 6e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 310 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 202 bits (102), Expect = 1e-48 Identities = 162/182 (89%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || |||||||||||| |||||||||||| |||| | ||||| Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 548 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||||| |||||||||||||||| ||||| || ||||||||||| | || |||||| Sbjct: 547 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 488 Query: 524 ca 525 || Sbjct: 487 ca 486 Score = 67.9 bits (34), Expect = 4e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 263 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 198 bits (100), Expect = 1e-47 Identities = 160/180 (88%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagccctt 563 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||||| |||||||||||||||| ||||| || ||| ||||||| ||||||||||| Sbjct: 562 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacgatctc 503 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 262 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||| || ||| ||||| |||||||||||||| |||||||||||||| ||||| Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 186 bits (94), Expect = 6e-44 Identities = 210/249 (84%) Strand = Plus / Minus Query: 326 ccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccgga 385 |||||||||||| || || | || |||||||| || || |||||||| ||||| ||| Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573 Query: 386 gaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 445 |||||| |||||| | ||||||||||| || |||||||||||||| |||||||||||||| Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513 Query: 446 ggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagccc 505 || |||||||| |||||||| ||||| | ||||||||||||||| ||||| || ||||| Sbjct: 512 cgtccccaggctccccttcttcgggtcaatggcggtggcgtacacggtgtagacgagccc 453 Query: 506 gaaggtcatgacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaa 565 |||||||||||||||||| ||||||| || ||||| ||| || |||| ||||||||| Sbjct: 452 gaaggtcatgacgatctcgaggaccagcgcgttccagacgctgaccccggagagcccgaa 393 Query: 566 ggtgccggt 574 | ||||||| Sbjct: 392 gctgccggt 384
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 186 bits (94), Expect = 6e-44 Identities = 160/182 (87%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 496 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| |||||| | |||||||||||||| |||||||||||| ||||||| || |||||||| Sbjct: 495 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 436 Query: 524 ca 525 || Sbjct: 435 ca 434 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttca 372 |||| ||||||||| |||||||||||||| Sbjct: 276 ggcgaggccgaaggtgacggcggggttca 248
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 186 bits (94), Expect = 6e-44 Identities = 160/182 (87%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 564 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| |||||| | |||||||||||||| |||||||||||| ||||||| || |||||||| Sbjct: 563 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 504 Query: 524 ca 525 || Sbjct: 503 ca 502 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttca 372 |||| ||||||||| |||||||||||||| Sbjct: 344 ggcgaggccgaaggtgacggcggggttca 316
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 186 bits (94), Expect = 6e-44 Identities = 160/182 (87%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || |||||||||||| ||||||| |||| |||| | ||||| Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||| |||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccgagggatccctt 550 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||||| |||||||||||||||| ||||| || ||||||||||| | || |||||| Sbjct: 549 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 490 Query: 524 ca 525 || Sbjct: 489 ca 488 Score = 63.9 bits (32), Expect = 6e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 ||||||||||||||| ||||||||||| |||||| ||||||| ||||| Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 186 bits (94), Expect = 6e-44 Identities = 160/182 (87%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 555 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| |||||| | |||||||||||||| |||||||||||| ||||||| || |||||||| Sbjct: 554 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 495 Query: 524 ca 525 || Sbjct: 494 ca 493 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttca 372 |||| ||||||||| |||||||||||||| Sbjct: 335 ggcgaggccgaaggtgacggcggggttca 307
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 182 bits (92), Expect = 9e-43 Identities = 155/176 (88%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 720 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 |||||||||| |||||||||||||||| ||||| || ||| ||||||| ||||||| Sbjct: 719 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 664 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 262 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 182 bits (92), Expect = 9e-43 Identities = 155/176 (88%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||||||||||||||| ||||| ||||| || || |||| Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 719 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 |||||||||| |||||||||||||||| ||||| || ||| ||||||| ||||||| Sbjct: 718 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 663 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 262 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||| || ||| |||||||||||||||| ||| |||||||||||||| ||||| Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 178 bits (90), Expect = 1e-41 Identities = 159/182 (87%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| ||| ||||||||||| ||||| ||||| |||| || | || Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 573 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| |||||| | |||||||||||||| ||||||||||| ||||||| || |||||||| Sbjct: 572 cttcgggtcggccgcggtggcgtacacggtgtacaccagagcgaaggtgatcacgatctc 513 Query: 524 ca 525 || Sbjct: 512 ca 511 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||||| |||||||||||||||||||||||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttca 372 |||| ||||||||| |||||||||||||| Sbjct: 353 ggcgaggccgaaggtgacggcggggttca 325
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 159 bits (80), Expect = 1e-35 Identities = 140/160 (87%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| ||||| ||||| ||| || |||||||||||||||||||||||||| Sbjct: 44819 gggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccgacgatgaag 44760 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 ||||| || ||||||||||||||||| ||| |||||||||||||||| | || || ||| Sbjct: 44759 ccgatcgccatgggcgcgatggtgccgagggagcccttcttggggtcggccgccgtcgcg 44700 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 |||||||||||||||||| ||||||| || |||||||||| Sbjct: 44699 tacaccgtgtacaccagcgcgaaggtgatcacgatctcca 44660 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||| || ||||| || ||||||||||||||||| Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 159 bits (80), Expect = 1e-35 Identities = 130/147 (88%) Strand = Plus / Minus Query: 455 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 514 |||||||||||||||||| ||||||||||||||||| ||||| || || ||||||||||| Sbjct: 592 gctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcat 533 Query: 515 gacgatctccaggaccaccgncttccacgcgccgatgccggtgagcccgaaggtgccggt 574 |||||||||||| |||| | || |||| || || |||||| || |||||||||||||| Sbjct: 532 gacgatctccagcaccagggcctcccacacggagacgccggtcaggccgaaggtgccggt 473 Query: 575 ggggagcccgccggtggagaagcggag 601 || |||||||||||||||||||||||| Sbjct: 472 ggcgagcccgccggtggagaagcggag 446 Score = 155 bits (78), Expect = 2e-34 Identities = 93/98 (94%) Strand = Plus / Minus Query: 196 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 255 ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630 Query: 256 gcagctcgtagatgacgccggcgaggccgccgccgatg 293 | | |||||||||||||||||||||||| ||||||||| Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 493 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 492 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 433 Query: 524 ca 525 || Sbjct: 432 ca 431 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Plus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 26627373 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 26627374 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 26627433 Query: 524 ca 525 || Sbjct: 26627434 ca 26627435 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Plus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 169754 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 169755 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 169814 Query: 524 ca 525 || Sbjct: 169815 ca 169816 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Plus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 61534 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 61535 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 61594 Query: 524 ca 525 || Sbjct: 61595 ca 61596 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 566 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 565 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 506 Query: 524 ca 525 || Sbjct: 505 ca 504 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 368 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 367 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 308 Query: 524 ca 525 || Sbjct: 307 ca 306 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 155 bits (78), Expect = 2e-34 Identities = 156/182 (85%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||||||||||||| || ||||||||||| ||||| ||| | |||| || |||| Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521 Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||||||||||||||||||||| |||||||||||||||||||| || ||||| Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 250461 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | || |||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 250460 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 250401 Query: 524 ca 525 || Sbjct: 250400 ca 250399 Score = 139 bits (70), Expect = 1e-29 Identities = 112/126 (88%) Strand = Plus / Plus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 459 ||||||||||||||||||||||||||||||| |||||||||||||||||||| || | Sbjct: 332124 cgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatc 332183 Query: 460 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 ||||||| ||||| | || |||||||||||||||||||||||| |||| || ||||||| Sbjct: 332184 ccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacga 332243 Query: 520 tctcca 525 |||||| Sbjct: 332244 tctcca 332249 Score = 63.9 bits (32), Expect = 6e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 |||||||||||||||||||| || |||||||||||||| ||||| Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 119 bits (60), Expect = 1e-23 Identities = 108/124 (87%) Strand = Plus / Minus Query: 402 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 461 ||||||||||| |||||||||||||||||||| |||||||||| |||||| ||| ||| Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 498 Query: 462 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 521 ||||| |||||| | || |||||||||||||||||||||||| |||| || || || ||| Sbjct: 497 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 438 Query: 522 tcca 525 |||| Sbjct: 437 tcca 434 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 119 bits (60), Expect = 1e-23 Identities = 108/124 (87%) Strand = Plus / Plus Query: 402 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 461 ||||||||||| |||||||||||||||||||| |||||||||| |||||| ||| ||| Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 92681 Query: 462 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 521 ||||| |||||| | || |||||||||||||||||||||||| |||| || || || ||| Sbjct: 92682 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 92741 Query: 522 tcca 525 |||| Sbjct: 92742 tcca 92745 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 119 bits (60), Expect = 1e-23 Identities = 108/124 (87%) Strand = Plus / Plus Query: 402 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 461 ||||||||||| |||||||||||||||||||| |||||||||| |||||| ||| ||| Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 27568705 Query: 462 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 521 ||||| |||||| | || |||||||||||||||||||||||| |||| || || || ||| Sbjct: 27568706 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 27568765 Query: 522 tcca 525 |||| Sbjct: 27568766 tcca 27568769 Score = 81.8 bits (41), Expect = 2e-12 Identities = 189/235 (80%), Gaps = 5/235 (2%) Strand = Plus / Minus Query: 286 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 345 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 26354830 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 26354771 Query: 346 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 405 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 26354770 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 26354711 Query: 406 tgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc-cttc 464 |||| ||||| ||| ||||||||||||| |||||| ||| ||| || ||| |||| Sbjct: 26354710 tgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccgcttc 26354654 Query: 465 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | || |||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 26354653 tccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 26354600 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 ||||| ||||| || ||||| || |||||||||||||||||||| Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560 Score = 40.1 bits (20), Expect = 8.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 269 gacgccggcgaggccgccgccgatgagg 296 ||||||| ||||||||||||||| |||| Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 119 bits (60), Expect = 1e-23 Identities = 210/260 (80%) Strand = Plus / Minus Query: 264 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 323 |||||||| |||||||| || || |||||||| |||||||||||||| ||||| |||| Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttg 693 Query: 324 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 383 ||| ||| ||||| ||||| || ||||| || ||||| ||||||||||| || ||| Sbjct: 692 ttccaggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccg 633 Query: 384 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 443 | |||||| || ||||| | ||||||||| || |||||||| || ||||| || || || Sbjct: 632 gtgaaggctcctccgaccaagatgttggctccaacgatgaaaccaatggcaattggggca 573 Query: 444 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 503 ||| | || ||| |||| ||||| |||||| ||| ||||||||||| ||||| ||||| Sbjct: 572 atgattccgaggttgcctctcttgtggtcgatggccgtggcgtacacggtgtagaccagg 513 Query: 504 ccgaaggtcatgacgatctc 523 ||||||||||| || ||||| Sbjct: 512 ccgaaggtcatcacaatctc 493
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 107 bits (54), Expect = 4e-20 Identities = 144/174 (82%) Strand = Plus / Minus Query: 352 cgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttgg 411 |||||||| ||||||||||||||| |||| ||||||| ||| || | | |||||||| Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625 Query: 412 cgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggt 471 |||| ||||||||||| || || ||||| ||||||||||||||| ||||||||| |||| Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccaggtcgcccttcttcgggt 565 Query: 472 cgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || | ||||||||||| || ||||| | ||| |||| || || |||||||||| Sbjct: 564 cggctgcggtggcgtagacggtgtagatgagcgcgaatgtgataacgatctcca 511 Score = 71.9 bits (36), Expect = 2e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 316 ||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 103 bits (52), Expect = 7e-19 Identities = 136/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| |||||| ||| || || ||| |||||||||| || || ||| Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || |||| ||||||||||| ||||| Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 368 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 325
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 99.6 bits (50), Expect = 1e-17 Identities = 250/314 (79%), Gaps = 2/314 (0%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 270 ||||||| ||||| |||||||| || |||||| || |||||| | ||||| ||||| || Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771 Query: 271 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 330 |||||||| | | | |||| || |||||||||||||| | ||| |||| |||| | Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711 Query: 331 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 390 |||||| || | ||| || || |||| ||||| ||||||||||| || |||| |||| Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651 Query: 391 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 450 | || ||||||| ||||||||| | || || | ||||||||||| ||| ||||| |||| Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591 Query: 451 cca-ggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaag 509 | | |||| || ||||||||||||| |||||||||||| || ||||| || || |||||| Sbjct: 590 cgatggct-cctttcttggggtcgatggcggtggcgtagacggtgtagactagtccgaag 532 Query: 510 gtcatgacgatctc 523 ||||| |||||||| Sbjct: 531 gtcatcacgatctc 518
>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence Length = 1054 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Minus Query: 359 gacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgac 418 |||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || || Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620 Query: 419 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 478 |||||| || ||||| || || ||||| || || || || || ||||||||||||||||| Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560 Query: 479 ggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 559 tgtggcgtaaacggtgtagacgagcccgaaggtcatcacgatctc 515
>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water channel AT3G26520 (TIP2) mRNA, complete cds Length = 1201 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 600 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 557
>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 762 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 488 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 445
>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1061 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 550 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 507
>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1066 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 555 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 512
>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic protein mRNA, complete cds Length = 1072 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 562 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 519
>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1010 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 538 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 495
>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1020 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1054 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 527 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 484
>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 545 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 502
>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 359 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 316
>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1012 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493
>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16 Length = 82646 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Plus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 15638 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 15681
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 95.6 bits (48), Expect = 2e-16 Identities = 135/164 (82%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 497 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 454
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 91.7 bits (46), Expect = 3e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 340 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 399 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557 Query: 400 cgaggatgttggcgccgacgatgaagccga 429 ||||||||||||||||||||| || ||||| Sbjct: 556 cgaggatgttggcgccgacgacgaggccga 527
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 91.7 bits (46), Expect = 3e-15 Identities = 73/82 (89%) Strand = Plus / Minus Query: 339 acgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccg 398 ||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||| Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655 Query: 399 acgaggatgttggcgccgacga 420 |||| | |||||||||||||| Sbjct: 654 gcgagcacgttggcgccgacga 633
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 91.7 bits (46), Expect = 3e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 340 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 399 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850 Query: 400 cgaggatgttggcgccgacgatgaagccga 429 ||||||||||||||||||||| || ||||| Sbjct: 98849 cgaggatgttggcgccgacgacgaggccga 98820 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 420 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 103782 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 91.7 bits (46), Expect = 3e-15 Identities = 79/90 (87%) Strand = Plus / Minus Query: 340 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 399 ||||||| |||||||||||| ||| ||||||||||| ||||||||| ||| |||||| Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560 Query: 400 cgaggatgttggcgccgacgatgaagccga 429 ||||||||||||||||||||| || ||||| Sbjct: 559 cgaggatgttggcgccgacgacgaggccga 530
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 89.7 bits (45), Expect = 1e-14 Identities = 96/113 (84%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 268 |||||| ||||||||||||||||||||||||||| |||||||||||| | || ||||| Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767 Query: 269 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 ||| || || ||||| || || || || |||||||||||||| ||||| |||| Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 87.7 bits (44), Expect = 4e-14 Identities = 181/224 (80%), Gaps = 2/224 (0%) Strand = Plus / Minus Query: 301 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 360 |||||||||| |||||||||| |||| | |||||| || | ||| || || |||| | Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369 Query: 361 cggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 420 |||| ||||||||||| || |||| |||| | || ||| ||| ||||||||| | || | Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309 Query: 421 tgaagccgatggcgatgggcgcgatggtgccca-ggctgcccttcttggggtcgacggcg 479 | | ||||||||||| ||| ||||| ||||| | |||| || ||||||||||||| |||| Sbjct: 308 taaggccgatggcgaggggagcgatagtgccgatggct-cctttcttggggtcgatggcg 250 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || || ||||||||||| |||||||| Sbjct: 249 gtggcgtagacggtgtagactagtccgaaggtcatcacgatctc 206
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 87.7 bits (44), Expect = 4e-14 Identities = 101/120 (84%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||| ||||||||||| || || || || || ||||| || ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcaattggtgcaattgttcccagacttccctt 262 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||||||||| | ||||| ||||| || |||||||| |||||||| ||||| || ||||| Sbjct: 261 cttggggtcaattgcggttgcgtagactgtgtacacaagcccgaacgtcattacaatctc 202
>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein, complete cds Length = 1122 Score = 85.7 bits (43), Expect = 2e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 405 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 464 ||||||||||| |||||||| || || |||||||||||||| || |||| ||| || ||| Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgattgtccccacgctcccattc 572 Query: 465 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 || ||||| | ||| || ||||| |||||||| ||||| ||||| ||||| |||||||| Sbjct: 571 ttcgggtcaatggcagtcgcgtagaccgtgtagaccagtccgaacgtcatcacgatctc 513
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 83.8 bits (42), Expect = 6e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 342 agggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacg 401 ||||| |||||||||||| || ||||||||||||||||||| |||| ||||||| || Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709 Query: 402 aggatgttggcgccgacgatga 423 ||| |||||||||||||||||| Sbjct: 708 aggctgttggcgccgacgatga 687
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 81.8 bits (41), Expect = 2e-12 Identities = 189/235 (80%), Gaps = 5/235 (2%) Strand = Plus / Minus Query: 286 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 345 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 697 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 638 Query: 346 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 405 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 637 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 578 Query: 406 tgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc-cttc 464 |||| ||||| ||| ||||||||||||| |||||| ||| ||| || ||| |||| Sbjct: 577 tgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccgcttc 521 Query: 465 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | || |||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 520 tccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 467
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 81.8 bits (41), Expect = 2e-12 Identities = 189/235 (80%), Gaps = 5/235 (2%) Strand = Plus / Minus Query: 286 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 345 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 131407 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 131348 Query: 346 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 405 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 131347 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 131288 Query: 406 tgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc-cttc 464 |||| ||||| ||| ||||||||||||| |||||| ||| ||| || ||| |||| Sbjct: 131287 tgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccgcttc 131231 Query: 465 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | || |||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 131230 tccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 131177
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 81.8 bits (41), Expect = 2e-12 Identities = 101/121 (83%) Strand = Plus / Minus Query: 405 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 464 ||||| ||||| || ||||| || ||||||||||| || || | |||| |||||||| Sbjct: 665 atgttagcgccaacaatgaaaccaatggcgatgggagcaataattcccaaattgcccttc 606 Query: 465 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcc 524 |||||||| ||||| |||||||| || |||||||||| ||||||||||| ||||||||| Sbjct: 605 ttggggtcaacggcagtggcgtagactgtgtacaccaaaccgaaggtcatcacgatctcc 546 Query: 525 a 525 | Sbjct: 545 a 545
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 79.8 bits (40), Expect = 1e-11 Identities = 133/164 (81%) Strand = Plus / Minus Query: 362 ggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgat 421 |||||||||||| ||||| |||| ||| || || || || || |||||||| |||||||| Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564 Query: 422 gaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggt 481 ||| ||||| || ||||| |||||||| || | ||||||||||| ||||| || || Sbjct: 563 gaatccgatcgcaatgggagcgatggttccaatatcccccttcttgggatcgacagcagt 504 Query: 482 ggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 |||||||| ||||| || |||||| | ||||| |||||||||| Sbjct: 503 agcgtacacagtgtagacgagcccgcacgtcatcacgatctcca 460 Score = 48.1 bits (24), Expect = 0.034 Identities = 30/32 (93%) Strand = Plus / Minus Query: 285 ccgccgatgagggggccgacccagtacaccca 316 ||||||||||| ||||| |||||||||||||| Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 79.8 bits (40), Expect = 1e-11 Identities = 100/120 (83%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||| || || ||||| ||||| |||||||| || || || || || || || || Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||| || |||||||||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 537 cttgggatcaacggcggtggcgtagactgtgtaaactagcccgaaggtcatcacgatctc 478 Score = 48.1 bits (24), Expect = 0.034 Identities = 30/32 (93%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtg 242 ||||||||| |||||||||||| ||||||||| Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759
>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 628 Score = 79.8 bits (40), Expect = 1e-11 Identities = 103/124 (83%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 459 |||||||||| || || |||||||| || |||||||| || ||||| || || || || | Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123 Query: 460 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | ||||||||||| |||| |||||||| || ||||| || |||||||||||||| |||| Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacgagcccgaaggtcattacga 63 Query: 520 tctc 523 |||| Sbjct: 62 tctc 59
>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 931 Score = 79.8 bits (40), Expect = 1e-11 Identities = 133/164 (81%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| ||||| ||| || || ||| |||||||||| || || ||| Sbjct: 644 acggctgggttcatggaagcgcccctgaacgctccaccggcgaggatgttcgctccaacg 585 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| | |||||||| || ||||| |||| || | || ||||||||||| ||||| Sbjct: 584 atgaaacttatggcgattggtgcgattttgccgagaataccgttcttggggtcaacggct 525 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 524 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 481
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 1143 Score = 77.8 bits (39), Expect = 4e-11 Identities = 99/119 (83%) Strand = Plus / Minus Query: 405 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 464 ||||| ||||| || | ||| ||||| ||||| |||||||| || |||| |||||| || Sbjct: 660 atgttcgcgccaactacgaaaccgatcgcgatcggcgcgattgttcccacgctgcctctc 601 Query: 465 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 || ||||| | ||| |||||||||||||||||||||| ||| || ||||| |||||||| Sbjct: 600 ttcgggtcaatggctgtggcgtacaccgtgtacaccaacccaaacgtcatcacgatctc 542
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 469 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 |||||||||||||||||||||| |||||||| |||||||| |||||||||| Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 533 Score = 58.0 bits (29), Expect = 3e-05 Identities = 125/157 (79%) Strand = Plus / Minus Query: 286 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 345 |||||||||| || |||| |||||| ||||| |||| | ||| | ||||| |||||| | Sbjct: 763 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 704 Query: 346 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 405 | |||||||| | | || |||||||||| ||||||| ||| | ||| ||| |||||| Sbjct: 703 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 644 Query: 406 tgttggcgccgacgatgaagccgatggcgatgggcgc 442 |||| ||||| ||| ||||||||||||| |||||| Sbjct: 643 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 607
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||||||||||||||| |||||||| || || |||| | ||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgcaattgtccccacgtcaccctt 262 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacacca 501 ||| ||||| |||||| ||||||| |||||||||| Sbjct: 261 ctttgggtcacatgcggtgccgtacactgtgtacacca 224
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 73.8 bits (37), Expect = 6e-10 Identities = 244/313 (77%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 270 ||||||||||||| |||||||| ||||||||| | ||||||| | ||||||||||| Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708 Query: 271 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 330 ||||||| || ||||||| ||| || ||| ||||||| ||||| |||| |||| Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggttggtccacg 648 Query: 331 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 390 |||||| || | || || ||||| | |||||||| |||||||| || |||||||| | Sbjct: 647 tccagctcacaaccgctggtccgaaagccacggcgggattcatggaggctccggagaatg 588 Query: 391 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 450 | || || | | |||||||| ||||| ||||| || || ||||| || ||||| || | Sbjct: 587 ctcctccagctaatatgttggctccgactatgaaaccaatagcgattggagcgattgttc 528 Query: 451 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaagg 510 | || || || || |||||||| | |||||||||||| || ||||| || |||||||| | Sbjct: 527 cgagactcccgtttttggggtcaatggcggtggcgtagacagtgtaaacaagcccgaatg 468 Query: 511 tcatgacgatctc 523 |||| |||||||| Sbjct: 467 tcatcacgatctc 455
>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 73.8 bits (37), Expect = 6e-10 Identities = 88/105 (83%) Strand = Plus / Minus Query: 419 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 478 |||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| Sbjct: 589 gatgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggc 530 Query: 479 ggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 529 tgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 485
>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1062 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 403 ggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccct 462 ||||||| || || |||||||| || |||||||| || ||||| || || || || || | Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554 Query: 463 tcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatct 522 |||||||||| ||||| |||||||| || ||| | || |||||||||||||| ||||||| Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggtcatcacgatct 494 Query: 523 c 523 | Sbjct: 493 c 493
>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 921 Score = 71.9 bits (36), Expect = 2e-09 Identities = 103/124 (83%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 459 |||||||||| || || |||||||| || |||||||| | ||||| || || || || | Sbjct: 615 cgaggatgttagctccaacgatgaaacctatggcgattgt-gcgattgttccgagactac 557 Query: 460 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | ||||||||||| ||||| |||||||| || ||||| || |||||||||||||| |||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacga 497 Query: 520 tctc 523 |||| Sbjct: 496 tctc 493
>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2) mRNA, complete cds Length = 1035 Score = 71.9 bits (36), Expect = 2e-09 Identities = 102/124 (82%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 459 |||||||||| || || |||||||| || |||||||| || ||||| || || || || Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactag 562 Query: 460 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | |||||||| || ||||| |||||||| || ||||| || |||||||||||||| |||| Sbjct: 561 cgttcttgggatcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacga 502 Query: 520 tctc 523 |||| Sbjct: 501 tctc 498
>emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic protein Length = 1168 Score = 69.9 bits (35), Expect = 9e-09 Identities = 134/167 (80%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| || ||| |||||| |||||| | || || ||||| || || ||||| Sbjct: 708 gggttcatggaagccccgtcgaaggcaccgccggccagaatattggcacccactatgaaa 649 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 ||||| || | ||| || ||||| |||||||| ||| | || | |||| ||| |||||| Sbjct: 648 ccgatcgcaaggggggctatggttcccaggctcccccttttagcatcgatggccgtggcg 589 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 532 || || ||||| ||||||||||| ||||| ||||||||||| ||||| Sbjct: 588 tatacagtgtaaaccagcccgaacgtcatcacgatctccagcaccac 542
>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA, complete cds Length = 1255 Score = 67.9 bits (34), Expect = 4e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 423 ||||||||||||||||||| |||| ||||||| ||||| ||||||||||||| |||| Sbjct: 743 gggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686
>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZE09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 573 Score = 67.9 bits (34), Expect = 4e-08 Identities = 135/166 (81%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124 Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgac-ggc 478 ||||| || |||||||| || ||||| || || || || || ||||||||||| || ||| Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgggc 64 Query: 479 ggtggcgtacac-cgtgtacaccagcccgaaggtcatgacgatctc 523 |||||||| || ||||| || |||||||||||||| |||||||| Sbjct: 63 tgtggcgtagacgggtgtagacgagcccgaaggtcatcacgatctc 18
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 |||||||||||||||||| |||||||||||||| || || || ||||||| ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacacca 501 ||||||||| ||||||||||| || |||||||||| Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgtacacca 224
>gb|DQ237285.1| Panax ginseng tonoplast intrinsic protein (TIP1) mRNA, complete cds Length = 940 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 |||||||| ||||||| |||||| ||||| || ||||| |||||||| ||||||||||| Sbjct: 561 cccttctttgggtcgatggcggttgcgtaaacggtgtaaaccagcccaaaggtcatgaca 502 Query: 519 atctc 523 ||||| Sbjct: 501 atctc 497
>gb|AF271662.1|AF271662 Vitis berlandieri x Vitis rupestris putative aquaporin TIP2 (TIP2) mRNA, partial cds Length = 304 Score = 63.9 bits (32), Expect = 6e-07 Identities = 98/120 (81%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||| || |||||||| || || || ||||| || ||| |||| | | ||||||| Sbjct: 274 gatgttggcacccacgatgaaaccaattgcaatgggtgcaatgatgccgatgttgccctt 215 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 ||| ||||| | ||| || ||||| || ||||| ||||| |||||||||||||| ||||| Sbjct: 214 cttcgggtcaatggctgttgcgtatacagtgtaaaccaggccgaaggtcatgacaatctc 155
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 63.9 bits (32), Expect = 6e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 207 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 266 ||||| || |||||||| |||||||||||||||||| | |||||||| | ||||||| Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358 Query: 267 atgacgccggcgaggccgccgccgatgagggggccgacccagta 310 |||| || ||||| || || ||||| ||||| ||||||||||| Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314 Score = 63.9 bits (32), Expect = 6e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 441 gcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacacc 500 ||||| || |||| ||| ||||| ||||| || ||||| ||||||||||| ||||||||| Sbjct: 183 gcgattgttcccaagcttccctttttgggatcaacggctgtggcgtacactgtgtacacc 124 Query: 501 agcccgaaggtcatgacgat 520 | ||||||||||| ||||| Sbjct: 123 aatccgaaggtcatcacgat 104
>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA Length = 756 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 420 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 590 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 795 cagccgacgagcgccgggccgaa 773 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 728 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680
>ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA Length = 576 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453 Query: 333 cagctgacgag 343 |||| |||||| Sbjct: 452 cagccgacgag 442
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 26168 cagccgacgagcgccgggccgaa 26190 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Plus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 26235 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 18186893 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836 Query: 333 cagctgacgag 343 |||| |||||| Sbjct: 25641837 cagccgacgag 25641847
>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane protein 1 mRNA, complete cds Length = 1162 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 ||||||||||| || ||||| |||||||| || |||||||||| || |||||||| ||| Sbjct: 562 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 503 Query: 519 atctcca 525 ||||||| Sbjct: 502 atctcca 496 Score = 42.1 bits (21), Expect = 2.1 Identities = 39/45 (86%) Strand = Plus / Minus Query: 332 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 376 |||||| |||| ||| || ||||| || ||||||||||||||||| Sbjct: 689 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 645
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0594D10 Length = 143200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | | Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809 Query: 333 cagctgacgag 343 |||| |||||| Sbjct: 95810 cagccgacgag 95820
>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full insert sequence Length = 1200 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 804 cagccgacgagcgccgggccgaa 782 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 737 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689
>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast intrinsic protein, complete cds Length = 1178 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 787 cagccgacgagcgccgggccgaa 765 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 720 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672
>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full insert sequence Length = 1787 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 199 cagccgacgagcgccgggccgaa 221 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Plus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 266 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314
>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full insert sequence Length = 1055 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 420 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 636 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582
>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full insert sequence Length = 1059 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 420 ||||||||||||||||||| || ||||||||| ||| | ||||||||||||||| Sbjct: 639 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 332 |||||||||||| |||||| || |||||||| |||||||||||| |||| || ||| | Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214 Query: 333 cagctgacgagggcggggccgaa 355 |||| |||||| || |||||||| Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 |||| ||||||||||||| || |||||||| ||||| ||||||||||| Sbjct: 18196146 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098
>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b, complete sequence Length = 41820 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 ||||||||||| || ||||| |||||||| || |||||||||| || |||||||| ||| Sbjct: 10234 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 10293 Query: 519 atctcca 525 ||||||| Sbjct: 10294 atctcca 10300 Score = 42.1 bits (21), Expect = 2.1 Identities = 39/45 (86%) Strand = Plus / Plus Query: 332 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 376 |||||| |||| ||| || ||||| || ||||||||||||||||| Sbjct: 10107 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 10151
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549
>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA Length = 969 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1099 Score = 58.0 bits (29), Expect = 3e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 207 gcttagtagtcggtggtggggagctgctcgtgggtgc 243 ||||||||||| | ||||||||||||||||||||||| Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823 Score = 56.0 bits (28), Expect = 1e-04 Identities = 86/104 (82%), Gaps = 1/104 (0%) Strand = Plus / Minus Query: 420 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 479 ||||| ||||||||||||| |||||| ||||||| | ||||||||||| || | || Sbjct: 642 atgaaaccgatggcgatgg-cgcgattgtgcccaaatttcccttcttgggatcaatagcc 584 Query: 480 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 523 || ||||| || |||||||| || |||||||||||||| ||||| Sbjct: 583 gtcgcgtagactgtgtacacgaggccgaaggtcatgactatctc 540
>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483F08 Length = 148985 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 |||||||||||| ||||||||| ||| |||| |||||||||||| |||| Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141
>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI) mRNA, complete cds Length = 1035 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 |||||||||||||| || || |||||||| || ||||| || |||||||||||||| || Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagacaagcccgaaggtcatcaca 517 Query: 519 atctc 523 ||||| Sbjct: 516 atctc 512
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||||||| || || ||||||||||||||||| || |||||||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695
>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZB01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 676 Score = 56.0 bits (28), Expect = 1e-04 Identities = 100/124 (80%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 459 |||||||||| || || |||||||| || | |||||| || ||||| || || || | | Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178 Query: 460 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 519 | ||||||||||| ||||| ||||||| || ||||| || ||||||| |||||| |||| Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacgagcccgagggtcatcacga 118 Query: 520 tctc 523 |||| Sbjct: 117 tctc 114
>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence Length = 1237 Score = 54.0 bits (27), Expect = 5e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 259 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 318 ||||||||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821 Query: 319 ggt 321 ||| Sbjct: 820 ggt 818
>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP) Length = 933 Score = 54.0 bits (27), Expect = 5e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 270 ||||||||||||| |||||||||||||| ||| | |||||||| | |||||||||| Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728 Query: 271 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 || |||| || ||||||| ||| || ||| ||||||||||||| |||| Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcat 373 |||||||| |||||||||||||||| |||||||||||| Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcat 373 |||||||| |||||||||||||||| |||||||||||| Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628
>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 gene, complete cds Length = 1442 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 462 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 521 |||||||| || |||||||||||||| || ||||| || ||||| || ||||| |||||| Sbjct: 996 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 937 Query: 522 tc 523 || Sbjct: 936 tc 935 Score = 46.1 bits (23), Expect = 0.13 Identities = 89/111 (80%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 270 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188 Query: 271 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137
>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-2 mRNA, partial cds Length = 599 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 462 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 521 |||||||| || |||||||||||||| || ||||| || ||||| || ||||| |||||| Sbjct: 275 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 216 Query: 522 tc 523 || Sbjct: 215 tc 214 Score = 46.1 bits (23), Expect = 0.13 Identities = 89/111 (80%) Strand = Plus / Minus Query: 211 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 270 |||||||||||||||||||||| || || ||| | |||||||| | ||||||||||| Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467 Query: 271 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||||| || |||||||| || || || ||||||| ||||| |||| Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggc 433 |||||||||||||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA, partial cds Length = 408 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 332 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 376 ||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.009 Identities = 25/25 (100%) Strand = Plus / Minus Query: 411 gcgccgacgatgaagccgatggcga 435 ||||||||||||||||||||||||| Sbjct: 314 gcgccgacgatgaagccgatggcga 290
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 408 ttggcgccgacgatgaagccgatggcgat 436 |||||||||||||| |||||||||||||| Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 703 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 644 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 643 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 584 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 583 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 544
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Plus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 1172 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 1231 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 1232 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 1291 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 1292 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 1331
>emb|X95952.1|HAAP H.annuus mRNA for aquaporin Length = 931 Score = 48.1 bits (24), Expect = 0.034 Identities = 39/44 (88%) Strand = Plus / Minus Query: 458 gcccttcttggggtcgacggcggtggcgtacaccgtgtacacca 501 ||||||||||||||| || ||||||||||| || ||||||||| Sbjct: 553 gcccttcttggggtcaactgcggtggcgtaaacgttgtacacca 510
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 593 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 534 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 533 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 474 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 473 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 434
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 664 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 605 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 604 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 545 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 544 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 505
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 48.1 bits (24), Expect = 0.034 Identities = 42/48 (87%) Strand = Plus / Minus Query: 335 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgcc 382 |||||||| ||| |||||||| ||| ||| ||||||||||||||||| Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 641 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 582 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 581 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 522 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 521 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 482
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 646 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 587 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 586 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 527 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 526 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 487
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 643 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 584 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 583 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 524 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 523 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 484
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 665 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 606 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 605 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 546 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 545 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 506
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 19492 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 19433 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 19432 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 19373 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 19372 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 19333
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 48.1 bits (24), Expect = 0.034 Identities = 33/36 (91%) Strand = Plus / Minus Query: 409 tggcgccgacgatgaagccgatggcgatgggcgcga 444 |||||||||||||||||||| || ||||||| |||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 411 gcgccgacgatgaagccgatg 431 ||||||||||||||||||||| Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 48.1 bits (24), Expect = 0.034 Identities = 126/160 (78%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 425 ||||||||||| | |||||||| | ||| || ||||||||||||| || ||||| | Sbjct: 610 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 551 Query: 426 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 485 || ||||||| || |||||||| || || ||||||||||| || ||||||||||| Sbjct: 550 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 491 Query: 486 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || || ||||| |||| ||||||| |||| |||||||| Sbjct: 490 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 451
>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA Length = 336 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259
>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds Length = 175 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Minus Query: 407 gttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 453 |||||| || || ||||| ||||||||||| |||||||| ||||||| Sbjct: 62 gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16
>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein Length = 936 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593
>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26) Length = 543 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200
>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene) Length = 1120 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Minus Query: 210 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 256 |||||||| || || ||||||||||||||||||| | ||||||||| Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene tip1-1) Length = 1104 Score = 46.1 bits (23), Expect = 0.13 Identities = 137/175 (78%) Strand = Plus / Minus Query: 351 ccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttg 410 ||||| || ||||||||||||||||| || |||| |||||| || || || | ||||| Sbjct: 686 ccgaatgacacggcggggttcatggatgctccggtgaaggctccaccaaccaaaatgtta 627 Query: 411 gcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttgggg 470 || || |||||||| || || || || || ||||| | || | | |||||||| ||| Sbjct: 626 gcaccaacgatgaaaccaatagcaataggtgcgataattccaatattacccttctttggg 567 Query: 471 tcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 525 || ||||| || |||||||| |||||||||| ||||| ||||| || ||||||| Sbjct: 566 tcaacggctgtagcgtacacagtgtacaccaaaccgaaagtcatcacaatctcca 512
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 272 gccggcgaggccgccgccgatga 294 ||||||||||||||||||||||| Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 271 cgccggcgaggccgccgccgatga 294 ||||||||||||| |||||||||| Sbjct: 505314 cgccggcgaggccaccgccgatga 505291
>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 46.1 bits (23), Expect = 0.13 Identities = 56/67 (83%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 ||||||||||| || ||||||||||||| || ||||| |||| ||||||| |||| | Sbjct: 555 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 496 Query: 519 atctcca 525 ||||||| Sbjct: 495 atctcca 489
>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence Length = 134793 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 179 cgggcgggcggggggcaggcggc 201 ||||||||||||||||||||||| Sbjct: 78789 cgggcgggcggggggcaggcggc 78811
>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens fiber (Mip), mRNA Length = 2075 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643
>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds Length = 9803 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 cgggcgggcggggggcaggcggc 201 ||||||||||||||||||||||| Sbjct: 1449 cgggcgggcggggggcaggcggc 1427
>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L Length = 1057 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 209 ttagtagtcggtggtggggagctgctcgtgggtgc 243 ||||||||| ||||| ||||||||||| ||||||| Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770
>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence Length = 479 Score = 46.1 bits (23), Expect = 0.13 Identities = 53/63 (84%) Strand = Plus / Plus Query: 259 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 318 ||||| ||| |||||||| ||||||| |||||| | ||| || |||||||||||||| | Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338 Query: 319 ggt 321 ||| Sbjct: 339 ggt 341
>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial cds Length = 2235 Score = 46.1 bits (23), Expect = 0.13 Identities = 56/67 (83%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 ||||||||||| || ||||||||||||| || ||||| |||| ||||||| |||| | Sbjct: 2150 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 2091 Query: 519 atctcca 525 ||||||| Sbjct: 2090 atctcca 2084
>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM) mRNA, partial cds Length = 789 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Minus Query: 279 aggccgccgccgatgagggggccgacccagtacacccactggt 321 ||||| |||||||||| ||||| |||||||||||||| |||| Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599
>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA Length = 6870 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 179 cgggcgggcggggggcaggcggc 201 ||||||||||||||||||||||| Sbjct: 688 cgggcgggcggggggcaggcggc 666
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Minus Query: 402 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||||| |||||||||| || ||||||| ||| |||||||| Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552
>ref|XM_476227.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 756 Score = 44.1 bits (22), Expect = 0.52 Identities = 49/58 (84%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 423 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 596 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 539
>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complete sequence Length = 162959 Score = 44.1 bits (22), Expect = 0.52 Identities = 49/58 (84%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 423 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 86935 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 86878
>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12 Length = 329100 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 273 ccggcgaggccgccgccgatga 294 |||||||||||||||||||||| Sbjct: 213784 ccggcgaggccgccgccgatga 213805
>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 11 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 1 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 10 (LOC479191), mRNA Length = 4663 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 9 (LOC479191), mRNA Length = 4438 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 7 (LOC479191), mRNA Length = 4777 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 6 (LOC479191), mRNA Length = 4696 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript variant 3 (LOC479191), mRNA Length = 4681 Score = 44.1 bits (22), Expect = 0.52 Identities = 31/34 (91%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggggggcaggcggcgg 203 |||||||||||||| ||||||| || |||||||| Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcg 365 |||||||||||||||||||||| Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcg 365 |||||||||||||||||||||| Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.52 Identities = 49/58 (84%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 423 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 7902160 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 7902103
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 44.1 bits (22), Expect = 0.52 Identities = 79/98 (80%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 463 ||||||||| || || ||||| || || || ||||| || |||||||||| |||| | Sbjct: 637 gatgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccct 578 Query: 464 cttggggtcgacggcggtggcgtacaccgtgtacacca 501 ||||||||| || ||||||||||| || ||||| |||| Sbjct: 577 cttggggtcaactgcggtggcgtagacggtgtagacca 540
>dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O04, full insert sequence Length = 1252 Score = 44.1 bits (22), Expect = 0.52 Identities = 49/58 (84%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 423 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 787 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 730
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 416 gacgatgaagccgatggcgatgggcg 441 ||||||| |||||||||||||||||| Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139
>dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-001-E07, full insert sequence Length = 1100 Score = 44.1 bits (22), Expect = 0.52 Identities = 49/58 (84%) Strand = Plus / Minus Query: 366 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 423 |||||||| ||||||||||||||| ||| || ||| | ||||||| |||||||||| Sbjct: 786 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 729
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcg 365 |||||||||||||||||||||| Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcg 365 |||||||||||||||||||||| Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083
>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 146444 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcg 365 |||||||||||||||||||||| Sbjct: 80400 ggcggggccgaaggagacggcg 80379 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcg 365 |||||||||||||||||||||| Sbjct: 67884 ggcggggccgaaggagacggcg 67863
>gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds Length = 993 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 |||||||| || || || || ||||| ||||| ||||| ||||| ||||||||||| || Sbjct: 553 cccttctttggatccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcaca 494 Query: 519 atctc 523 ||||| Sbjct: 493 atctc 489
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 316 actggtacccccactcccagc 336 ||||||||||||||||||||| Sbjct: 290624 actggtacccccactcccagc 290604
>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence Length = 136354 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 94084 acggacggacgggcgggcggg 94104
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccg 428 ||||||| ||||||||||||||||| Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061
>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105), mRNA Length = 2606 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 281 gccgccgccgatgagggggcc 301 ||||||||||||||||||||| Sbjct: 22 gccgccgccgatgagggggcc 42
>gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral protein-like mRNA, partial sequence Length = 555 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 359 gacggcggggttcatggacgcgccggaga 387 |||||||||||||||| ||||||||||| Sbjct: 425 gacggcggggttcatgtgcgcgccggaga 397
>ref|NM_002457.1| Homo sapiens mucin 2, oligomeric mucus/gel-forming (MUC2), mRNA Length = 15720 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 aggtgccggtggggagcccgc 585 ||||||||||||||||||||| Sbjct: 15523 aggtgccggtggggagcccgc 15503
>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor (omaA) gene, complete cds Length = 1435 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 273 ccggcgaggccgccgccgatg 293 ||||||||||||||||||||| Sbjct: 698 ccggcgaggccgccgccgatg 678
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatgga 376 |||||||||||||||| ||| ||||||||||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatgga 376 |||||||||||||||| ||| ||||||||||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541
>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete sequence Length = 160805 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 155955 acggacggacgggcgggcggg 155935
>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNK00920) partial mRNA Length = 2340 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 316 actggtacccccactcccagc 336 ||||||||||||||||||||| Sbjct: 2133 actggtacccccactcccagc 2113
>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence Length = 166421 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 7846 acggacggacgggcgggcggg 7826
>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence Length = 240151 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 37973 acggacggacgggcgggcggg 37953
>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence Length = 148259 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 37509 acggacggacgggcgggcggg 37489 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 167 cacacggacggacgggcgggcggg 190 ||||||||||||||| |||||||| Sbjct: 37516 cacacggacggacggacgggcggg 37493
>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA clone MGC:19255 IMAGE:3967218), complete cds Length = 2176 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 23 acggacggacgggcgggcggg 43
>gb|AY258323.1| Rubella virus strain BRD-II, complete genome Length = 9778 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 179 cgggcgggcggggggcaggcggcgg 203 ||||||||| ||||||||||||||| Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303
>ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predicted mRNA Length = 2157 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 448 tgcccaggctgcccttcttgg 468 ||||||||||||||||||||| Sbjct: 1060 tgcccaggctgcccttcttgg 1040
>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta), mRNA Length = 2547 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C (LOC654951), mRNA Length = 3244 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 271 cgccggcgaggccgccgccga 291 ||||||||||||||||||||| Sbjct: 1642 cgccggcgaggccgccgccga 1622
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 275 ggcgaggccgccgccgatgag 295 ||||||||||||||||||||| Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 404 gatgttggcgccgacgatgaagccg 428 ||||| ||||||||||||||||||| Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 404 gatgttggcgccgacgatgaagccg 428 ||||| ||||||||||||||||||| Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442
>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1 Length = 68478 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 42894 acggacggacgggcgggcggg 42914 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 167 cacacggacggacgggcgggcggg 190 ||||||||||||||| |||||||| Sbjct: 42887 cacacggacggacggacgggcggg 42910
>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip gene) Length = 716 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Minus Query: 210 tagtagtcggtggtggggagctgctcgtgggtg 242 |||||||| ||||| ||||| |||||||||||| Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396 Score = 40.1 bits (20), Expect = 8.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 348 gggccgaaggagacggcggggttcatggacgcgccggagaaggc 391 |||||||| || ||||| ||||||||||| || |||| |||||| Sbjct: 290 gggccgaatgacacggctgggttcatggatgctccggtgaaggc 247
>gb|AC139749.4| Homo sapiens chromosome 11, clone RP13-870H17, complete sequence Length = 131676 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 565 aggtgccggtggggagcccgc 585 ||||||||||||||||||||| Sbjct: 40001 aggtgccggtggggagcccgc 40021
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 27616 acggacggacgggcgggcggg 27596
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 42.1 bits (21), Expect = 2.1 Identities = 42/49 (85%) Strand = Plus / Minus Query: 400 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||||||| || |||||||| || || ||||| || |||||||| Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695
>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920074L06 product:Rab geranylgeranyl transferase, a subunit, full insert sequence Length = 2422 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 41 acggacggacgggcgggcggg 61
>gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3) mRNA, complete cds Length = 1133 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Minus Query: 459 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 518 |||||||| || || || || ||||| ||||| ||||| ||||| ||||||||||| || Sbjct: 573 cccttctttggatccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcaca 514 Query: 519 atctc 523 ||||| Sbjct: 513 atctc 509
>ref|XM_926004.1| PREDICTED: Homo sapiens similar to Mucin-2 precursor (Intestinal mucin 2) (LOC642507), mRNA Length = 8604 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 565 aggtgccggtggggagcccgc 585 ||||||||||||||||||||| Sbjct: 8410 aggtgccggtggggagcccgc 8390
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 42.1 bits (21), Expect = 2.1 Identities = 39/45 (86%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||| || || |||||||||||||| ||||| || ||||| Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 548
>gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral protein ZmNIP2-3 mRNA, complete cds Length = 1300 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 359 gacggcggggttcatggacgcgccggaga 387 |||||||||||||||| ||||||||||| Sbjct: 442 gacggcggggttcatgtgcgcgccggaga 414
>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA, complete cds Length = 1045 Score = 42.1 bits (21), Expect = 2.1 Identities = 63/77 (81%) Strand = Plus / Minus Query: 344 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 403 |||||| |||||||| ||| ||||||||||| |||||||| | |||| ||||| ||| Sbjct: 714 ggcgggcccgaaggacctggccgggttcatggaggcgccggacagggcggcgccggcgac 655 Query: 404 gatgttggcgccgacga 420 | |||||| ||||||| Sbjct: 654 ggagttggccccgacga 638
>gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral protein ZmNIP2-2 mRNA, complete cds Length = 1387 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 359 gacggcggggttcatggacgcgccggaga 387 |||||||||||||||| ||||||||||| Sbjct: 452 gacggcggggttcatgtgcgcgccggaga 424
>emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB64ZD05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 503 Score = 42.1 bits (21), Expect = 2.1 Identities = 63/77 (81%) Strand = Plus / Minus Query: 360 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 419 ||||| ||||||||||| || ||| ||| || || ||| |||||||||| || || ||| Sbjct: 95 acggctgggttcatggaagcaccgctgaaagctccaccggcgaggatgttagctccaacg 36 Query: 420 atgaagccgatggcgat 436 ||||| || |||||||| Sbjct: 35 atgaaacctatggcgat 19
>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11, complete sequence Length = 126040 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 56775 acggacggacgggcgggcggg 56755
>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1), mRNA Length = 1544 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 171 cggacggacgggcgggcggggggca 195 |||||||||||||||||||| |||| Sbjct: 56 cggacggacgggcgggcgggcggca 80
>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete genome Length = 11864 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 271 cgccggcgaggccgccgccga 291 ||||||||||||||||||||| Sbjct: 2650 cgccggcgaggccgccgccga 2630
>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2466 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2435 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2492 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2547 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) pseudogene, complete sequence Length = 2338 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) mRNA, complete cds, alternatively spliced Length = 2395 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha subunit (Rabggta) gene, complete cds, alternatively spliced Length = 2685 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 18 acggacggacgggcgggcggg 38
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 271 cgccggcgaggccgccgccga 291 ||||||||||||||||||||| Sbjct: 2570348 cgccggcgaggccgccgccga 2570368 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 271 cgccggcgaggccgccgccgatga 294 ||||||| |||||||||||||||| Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 271 cgccggcgaggccgccgccga 291 ||||||||||||||||||||| Sbjct: 1841115 cgccggcgaggccgccgccga 1841095
>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2, fertilization-independent endosperm proteins, hypothetical protein, putative non-LTR retroelement reverse transcriptase, OCL5 protein, tryptophan synthase beta-subunit, hypothetical proteins, putative AP endonuclease, putative RNA polymerase II complex component SRB7, putative beta-1,3-glucanase, hypothetical protein, TNP2-like protein, hypothetical protein, putative phosphate/phosphoenolpyruvate translocator, putative protein, hypothetical proteins, putative galactosyltransferase family, hypothetical protein, putative cytochrome P450 family, putative lipid transfer protein, putative photoreceptor-interacting protein, and hypothetical protein genes, complete cds; and hypothetical protein gene, partial cds Length = 202197 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 377 cgcgccggagaaggcgccgccgacg 401 ||||||||||||||||||| ||||| Sbjct: 146358 cgcgccggagaaggcgccggcgacg 146382
>emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in linkage group 20, complete sequence Length = 80017 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 44968 acggacggacgggcgggcggg 44988
>gb|AY109651.1| Zea mays CL6730_1 mRNA sequence Length = 899 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 359 gacggcggggttcatggacgcgccggaga 387 |||||||||||||||| ||||||||||| Sbjct: 430 gacggcggggttcatgtgcgcgccggaga 402
>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds Length = 316 Score = 42.1 bits (21), Expect = 2.1 Identities = 39/45 (86%) Strand = Plus / Minus Query: 404 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 448 ||||||||| || || |||||||||||||| ||||| || ||||| Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 245
>emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in linkage group 23, complete sequence Length = 142417 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 45131 acggacggacgggcgggcggg 45151
>gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate repressor (gnuR), gluconate kinase (gnuK), and gluconate permease (gnuT) genes, complete cds Length = 3554 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 271 cgccggcgaggccgccgccga 291 ||||||||||||||||||||| Sbjct: 427 cgccggcgaggccgccgccga 407
>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence Length = 207280 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 170 acggacggacgggcgggcggg 190 ||||||||||||||||||||| Sbjct: 13760 acggacggacgggcgggcggg 13780
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 181 ggcgggcggggggcaggcggcggtg 205 ||||||||||||||| ||||||||| Sbjct: 2074504 ggcgggcggggggcatgcggcggtg 2074480 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,027,136 Number of Sequences: 3902068 Number of extensions: 5027136 Number of successful extensions: 124356 Number of sequences better than 10.0: 360 Number of HSP's better than 10.0 without gapping: 364 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 118905 Number of HSP's gapped (non-prelim): 5386 length of query: 602 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 579 effective length of database: 17,143,297,704 effective search space: 9925969370616 effective search space used: 9925969370616 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
