ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags5k09 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X59873.1|TAHISTH2B T.aestivum L mRNA for histone H2B Length = 712 Score = 591 bits (298), Expect = e-165 Identities = 361/380 (95%), Gaps = 9/380 (2%) Strand = Plus / Minus Query: 179 gaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 238 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 519 gaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 460 Query: 239 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 298 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 459 ccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtgggcttcttg 400 Query: 299 ttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 358 ||||| || || |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 ttgtaccgcgccagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 340 Query: 359 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagc 418 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 339 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcagc 280 Query: 419 accttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgc 478 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | Sbjct: 279 accttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttcttgcc---c 223 Query: 479 ttcttctcgccgccctccttgccggaggcggtcttcttgcccgccggcagccgcttctcc 538 ||||| |||||||||||||| || ||||| |||| ||||||||||||||||||||| Sbjct: 222 ttcttgtcgccgccctcctt---ggcggcggacttc---cccgccggcagccgcttctcc 169 Query: 539 gccttgggcttcttcccggc 558 |||||||||||||||||||| Sbjct: 168 gccttgggcttcttcccggc 149
>dbj|D37943.1|WHTPH2B8B Triticum aestivum mRNA for protein H2B-8, complete cds Length = 592 Score = 565 bits (285), Expect = e-158 Identities = 311/319 (97%), Gaps = 3/319 (0%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 473 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 414 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 413 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 354 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 353 gtagcgggcgagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaagga 294 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 293 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 234 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgctt 480 ||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||| Sbjct: 233 cttgaagatgtagatcttgtacgtctccacgctcttcttcgacttcttcttccc---ctt 177 Query: 481 cttctcgccgccctccttg 499 ||| ||||||||||||||| Sbjct: 176 cttgtcgccgccctccttg 158
>gb|BT009118.1| Triticum aestivum clone wl1n.pk0003.e12:fis, full insert mRNA sequence Length = 764 Score = 531 bits (268), Expect = e-148 Identities = 359/389 (92%), Gaps = 9/389 (2%) Strand = Plus / Minus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 545 gaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcgccg 486 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 485 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 426 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 425 taccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggag 366 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 365 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacc 306 Query: 422 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttc 481 |||||||||||||||||||| ||||||||||||||||| | ||||||| | || |||| Sbjct: 305 ttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttcctacc---cttc 249 Query: 482 ttctcgccgccctccttgccggaggcggtcttcttgcccgccggcagccgcttctccgcc 541 || ||||||||||||||||||| || ||||||||| || ||||||||||||||| Sbjct: 248 ttgtcgccgccctccttgccggcgg------acttgcccgcaggtagccgcttctccgcc 195 Query: 542 ttgggcttcttcccggccggggacttctc 570 |||||||||||||| || |||| |||||| Sbjct: 194 ttgggcttcttccccgcgggggccttctc 166
>dbj|D37945.1|WHTPH2B15D Triticum aestivum gene for protein H2B153, complete cds Length = 3209 Score = 517 bits (261), Expect = e-143 Identities = 305/319 (95%), Gaps = 3/319 (0%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1699 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 1640 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1639 tgggaggacgaggcggacggaggtctggatctcccgggatgtgatggtgggcttcttgtt 1580 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 ||| || || |||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 1579 gtaccgcgccagcttggcggactcgccggcgagcttctcgaagatgtcgttgatgaagga 1520 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1519 gttcgtgatggacatggccttggaggagatgccgatgtccgggtgcacctgcttcagcac 1460 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgctt 480 ||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||| Sbjct: 1459 cttgaagatgtagatcttgtacgtctccatgctcttcttggacttcttcttccc---ctt 1403 Query: 481 cttctcgccgccctccttg 499 ||||||||||||||||||| Sbjct: 1402 cttctcgccgccctccttg 1384 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 532 cttctccgccttgggcttctt 552 ||||||||||||||||||||| Sbjct: 1369 cttctccgccttgggcttctt 1349
>gb|BT016429.1| Zea mays clone Contig262 mRNA sequence Length = 564 Score = 515 bits (260), Expect = e-143 Identities = 364/399 (91%), Gaps = 6/399 (1%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 407 agcctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 348 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 347 gagctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtggg 288 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 287 cttcttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 228 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| Sbjct: 227 gatgaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctg 168 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttctt 471 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| Sbjct: 167 cttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttccg 108 Query: 472 gccctgcttcttctcgccgccctccttgccggaggcggtcttcttgcccgccggcagccg 531 |||| ||| |||||||||||||||||||| || |||||| || || | || Sbjct: 107 gcccctctttccctcgccgccctccttgccggcgg------acttgcctgctgggacacg 54 Query: 532 cttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||||||| | |||||| Sbjct: 53 cttctccgccttgggcttcttcccggccggcgccttctc 15
>emb|X57313.1|ZMH2B221 Z.mays mRNA for H2B histone (clone cH2B221) Length = 653 Score = 515 bits (260), Expect = e-143 Identities = 364/399 (91%), Gaps = 6/399 (1%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 473 agcctaggacgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 414 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||| Sbjct: 413 gagctccccggggaggacgaggcgcacggaggtctggatctcacgggaggtgatggtggg 354 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 353 cttcttgttgtaccgcgcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 294 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| Sbjct: 293 gatgaaggagttcatgatggacatggccttagaggagatgccgatgtccgggtgcacctg 234 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttctt 471 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| Sbjct: 233 cttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttccg 174 Query: 472 gccctgcttcttctcgccgccctccttgccggaggcggtcttcttgcccgccggcagccg 531 |||| ||| |||||||||||||||||||| || |||||| || || | || Sbjct: 173 gcccctctttccctcgccgccctccttgccggcgg------acttgcctgctgggacacg 120 Query: 532 cttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||||||| | |||||| Sbjct: 119 cttctccgccttgggcttcttcccggccggcgccttctc 81
>gb|U08226.1|ZMU08226 Zea mays W-22 histone H2B mRNA, complete cds Length = 678 Score = 515 bits (260), Expect = e-143 Identities = 357/389 (91%), Gaps = 9/389 (2%) Strand = Plus / Minus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 478 gaggtgaacttggtgacggccttggtaccctccgagacggcgtgcttggcgagctcgccg 419 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 418 gggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttg 359 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 358 taccgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggag 299 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 298 ttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttcaggacc 239 Query: 422 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttc 481 |||||||||||||||||||| ||||||||||||||||| | ||||||| | || |||| Sbjct: 238 ttgaagatgtagatcttgtaggtctccacgctcttcttcgccttcttcctacc---cttc 182 Query: 482 ttctcgccgccctccttgccggaggcggtcttcttgcccgccggcagccgcttctccgcc 541 || || |||||||||||||||| || ||||||||| || ||||||||||||||| Sbjct: 181 ttgtccccgccctccttgccggcgg------acttgcccgcaggtagccgcttctccgcc 128 Query: 542 ttgggcttcttcccggccggggacttctc 570 |||||||||||||| || |||| |||||| Sbjct: 127 ttgggcttcttccccgcgggggccttctc 99
>gb|BT017477.1| Zea mays clone EL01N0408F05.c mRNA sequence Length = 574 Score = 513 bits (259), Expect = e-142 Identities = 289/299 (96%) Strand = Plus / Minus Query: 171 gagcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttgg 230 |||| ||||| |||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct: 530 gagcttaggacgaggtgaacttggtgacggccttggtgccctccgagacggcgtgcttgg 471 Query: 231 cgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 470 cgagctcgccgggtagaacgaggcggacggaggtctggatctcccgggaggtgatggtgg 411 Query: 291 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 350 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 410 gcttcttgttgtagcgggcgagcttggccgcctcgccggcgagcttctcgaagatgtcgt 351 Query: 351 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 410 ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 350 tgatgaatgagttcatgatggacatggccttggaggagatgccgatgtccgggtgcacct 291 Query: 411 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 290 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 232 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 518 cccgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||| ||||||||||||||||| ||||||||||| || |||| |||||| Sbjct: 189 cccgccgggagccgcttctccgccttcggcttcttcccagcgggggccttctc 137
>dbj|D37942.1|WHTPH2B6A Triticum aestivum mRNA for protein H2B-6, complete cds Length = 564 Score = 509 bits (257), Expect = e-141 Identities = 287/297 (96%) Strand = Plus / Minus Query: 175 ctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgag 234 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 414 ctaggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgag 355 Query: 235 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 294 ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| Sbjct: 354 ctcgccggggaggacgaggcgcacggcggtctggatctcccgggaggtgatggtgggctt 295 Query: 295 cttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 354 |||||||||||| || |||||||| | ||||||||||||||||||||||||||||||||| Sbjct: 294 cttgttgtagcgcgccagcttggccgactcgccggcgagcttctcgaagatgtcgttgat 235 Query: 355 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 234 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 175 Query: 415 cagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttctt 471 |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| Sbjct: 174 gagcaccttgaagatgtagatcttgtacgtctcgacgctcttcttggccttcttctt 118 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttc 553 |||||||| ||||||||||||||| Sbjct: 83 cgcttctcggccttgggcttcttc 60
>gb|BT009535.1| Triticum aestivum clone wr1.pk0136.c2:fis, full insert mRNA sequence Length = 940 Score = 504 bits (254), Expect = e-139 Identities = 281/290 (96%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 ||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 782 agcctaggatgaggtgaacttggtgacggccttggtgccctctgagacggcgtgcttggc 723 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 722 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggacgtgatggtggg 663 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||| Sbjct: 662 cttcttgttgtagcgggcgagcttggcggactccccagcgagcttctcgaagatgtcgtt 603 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 602 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 543 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttgg 461 ||| ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 542 cttgagcaccttgaagatgtagatcttgtacgtctccacgcccttcttgg 493 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggctt 549 ||||||| ||||||||||||||||||||| Sbjct: 436 cgccggcgcccgcttctccgccttgggctt 407
>gb|BT016519.1| Zea mays clone Contig352 mRNA sequence Length = 789 Score = 502 bits (253), Expect = e-139 Identities = 306/323 (94%), Gaps = 3/323 (0%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| || || Sbjct: 522 ggtgaacttggtgacggccttggttccctcggagacggcgtgtttggcgagctctcctgg 463 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 462 gaggacgaggcgcacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 403 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 402 ccgggcgagcttagcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 343 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 342 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcaggacctt 283 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttctt 483 |||||||||||| ||||| ||||||||||||||||||| ||||||||| || |||||| Sbjct: 282 gaagatgtagattttgtaggtctccacgctcttcttggccttcttcttccc---cttctt 226 Query: 484 ctcgccgccctccttgccggagg 506 ||||||||||||||||||||||| Sbjct: 225 ctcgccgccctccttgccggagg 203
>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10, complete sequence Length = 187034 Score = 500 bits (252), Expect = e-138 Identities = 279/288 (96%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 176410 agcctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 176351 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 176350 gagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtggg 176291 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 176290 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 176231 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 176230 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 176171 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 176170 cttgagaaccttgaagatgtagatcttgtaggtctccacgctcttctt 176123 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 518 cccgccggcagccgcttctccgccttgggcttcttcccggccg 560 ||||| || ||||||||||||||||||||||||||||| |||| Sbjct: 176067 cccgcggggagccgcttctccgccttgggcttcttccccgccg 176025
>gb|AC098832.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1268_B08, complete sequence Length = 119500 Score = 500 bits (252), Expect = e-138 Identities = 279/288 (96%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 27092 agcctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 27033 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 27032 gagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtggg 26973 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 26972 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 26913 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 26912 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 26853 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 26852 cttgagaaccttgaagatgtagatcttgtaggtctccacgctcttctt 26805 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 518 cccgccggcagccgcttctccgccttgggcttcttcccggccg 560 ||||| || ||||||||||||||||||||||||||||| |||| Sbjct: 26749 cccgcggggagccgcttctccgccttgggcttcttccccgccg 26707
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 500 bits (252), Expect = e-138 Identities = 279/288 (96%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 28392168 agcctaagcggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 28392109 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 28392108 gagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtggg 28392049 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 28392048 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 28391989 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 28391988 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 28391929 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||| || ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 28391928 cttgagaaccttgaagatgtagatcttgtaggtctccacgctcttctt 28391881 Score = 343 bits (173), Expect = 4e-91 Identities = 269/301 (89%) Strand = Plus / Minus Query: 176 taggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 235 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 22480470 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 22480411 Query: 236 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 295 ||||||||||||||||| || || |||||||||||||| ||||||||||| ||||||||| Sbjct: 22480410 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 22480351 Query: 296 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 355 |||||||| | ||| ||| | |||||||| ||||||||||||| |||||||||| | Sbjct: 22480350 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 22480291 Query: 356 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 415 ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||| Sbjct: 22480290 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 22480231 Query: 416 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccc 475 |||||||||||||||||||| || || ||||||||||| ||||| | ||||||||| ||| Sbjct: 22480230 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttcccc 22480171 Query: 476 t 476 | Sbjct: 22480170 t 22480170 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 408 cctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttg 460 |||||||| ||||||||||||||||||| ||||| ||||||| ||||||||| Sbjct: 6896155 cctgcttctgcaccttgaagatgtagatattgtaggtctccatactcttcttg 6896207 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 518 cccgccggcagccgcttctccgccttgggcttcttcccggccg 560 ||||| || ||||||||||||||||||||||||||||| |||| Sbjct: 28391825 cccgcggggagccgcttctccgccttgggcttcttccccgccg 28391783 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 331 gagcttctcgaagatgtcgttgatgaa 357 ||||||||||||||||||||||||||| Sbjct: 3720743 gagcttctcgaagatgtcgttgatgaa 3720769 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Plus Query: 330 cgagcttctcgaagatgtcgttgatgaa 357 ||||||||||| |||||||||||||||| Sbjct: 29356934 cgagcttctcggagatgtcgttgatgaa 29356961 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Minus Query: 330 cgagcttctcgaagatgtcgttgatgaa 357 |||||||||||||||||||||| ||||| Sbjct: 18422090 cgagcttctcgaagatgtcgttaatgaa 18422063 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 418 caccttgaagatgtagatcttgt 440 ||||||||||||||||||||||| Sbjct: 25447111 caccttgaagatgtagatcttgt 25447133 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 332 agcttctcgaagatgtcgttgatgaa 357 ||||||||||||||||| |||||||| Sbjct: 6238958 agcttctcgaagatgtctttgatgaa 6238933 Score = 40.1 bits (20), Expect = 7.8 Identities = 35/40 (87%) Strand = Plus / Plus Query: 330 cgagcttctcgaagatgtcgttgatgaaggagttcatgat 369 ||||||||| |||||| ||| | | ||||||||||||||| Sbjct: 6889823 cgagcttcttgaagatatcgataaagaaggagttcatgat 6889862
>ref|XM_475912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 459 Score = 498 bits (251), Expect = e-137 Identities = 272/279 (97%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 453 ggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 394 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 393 ggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgtt 334 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 333 gtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaagga 274 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| || || Sbjct: 273 gttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagaac 214 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||||||||||||||||||||| ||||||||||||||||| Sbjct: 213 cttgaagatgtagatcttgtaggtctccacgctcttctt 175 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 518 cccgccggcagccgcttctccgccttgggcttcttcccggccg 560 ||||| || ||||||||||||||||||||||||||||| |||| Sbjct: 119 cccgcggggagccgcttctccgccttgggcttcttccccgccg 77
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 496 bits (250), Expect = e-137 Identities = 286/298 (95%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2673943 agcctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 2673884 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 2673883 gagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtggg 2673824 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| Sbjct: 2673823 cttcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgtt 2673764 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 2673763 gatgaaggagttcatgatggacatggccttggaggagatgccgatatcggggtggacctg 2673704 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 2673703 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2673646 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Plus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2856595 agcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 2856654 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 2856655 aagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 2856714 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 2856715 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 2856774 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 2856775 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 2856834 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||| |||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 2856835 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttctt 2856882 Score = 488 bits (246), Expect = e-134 Identities = 285/298 (95%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | |||||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 2686266 agcctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggc 2686207 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2686206 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 2686147 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| || Sbjct: 2686146 cttcttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcatt 2686087 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 2686086 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctg 2686027 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 2686026 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2685969 Score = 482 bits (243), Expect = e-133 Identities = 285/299 (95%) Strand = Plus / Minus Query: 171 gagcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttgg 230 ||||||| | ||||||||| ||||| || ||||||||||||||||||||||||||||||| Sbjct: 2871659 gagcctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttgg 2871600 Query: 231 cgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 290 | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 2871599 caagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 2871540 Query: 291 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 350 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 2871539 gcttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 2871480 Query: 351 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 410 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2871479 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacct 2871420 Query: 411 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 2871419 gcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2871361 Score = 472 bits (238), Expect = e-130 Identities = 283/298 (94%) Strand = Plus / Plus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 2837043 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 2837102 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 2837103 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 2837162 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| || || Sbjct: 2837163 cttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcatt 2837222 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 2837223 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 2837282 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 2837283 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2837340 Score = 470 bits (237), Expect = e-129 Identities = 261/269 (97%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2843675 ttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 2843734 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2843735 aggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 2843794 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2843795 agcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 2843854 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 2843855 gacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaagatg 2843914 Query: 431 tagatcttgtacgtctccacgctcttctt 459 ||||||||||| ||||| ||||||||||| Sbjct: 2843915 tagatcttgtaggtctcgacgctcttctt 2843943 Score = 470 bits (237), Expect = e-129 Identities = 276/289 (95%) Strand = Plus / Plus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2819241 ggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgcc 2819300 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 2819301 ggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgtt 2819360 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 2819361 gtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaagga 2819420 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 2819421 gttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcac 2819480 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 2819481 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 2819529 Score = 385 bits (194), Expect = e-103 Identities = 239/254 (94%) Strand = Plus / Plus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 17421734 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 17421793 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 ||||||||||||||||||||||| |||||| ||||||||| | |||||||||||||||| Sbjct: 17421794 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 17421853 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 17421854 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 17421913 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 17421914 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 17421973 Query: 424 gaagatgtagatct 437 |||||||||||||| Sbjct: 17421974 gaagatgtagatct 17421987 Score = 363 bits (183), Expect = 4e-97 Identities = 282/315 (89%) Strand = Plus / Plus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 36007442 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 36007501 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||| Sbjct: 36007502 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 36007561 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 36007562 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 36007621 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 36007622 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 36007681 Query: 425 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttcttc 484 || ||||||||||| || || || ||||||||||||| ||||||||| |||| ||||| Sbjct: 36007682 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 36007741 Query: 485 tcgccgccctccttg 499 |||||||||||||| Sbjct: 36007742 ccgccgccctccttg 36007756 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 514 cttgcccgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||| || || ||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 2871316 cttgccggcggggagccgcttctccgccttgggcttcttcccggccggggccttctc 2871260 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Plus Query: 332 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggcct 380 ||||||||||| | ||||||||||||||| |||||||| |||||||||| Sbjct: 30942127 agcttctcgaaaacgtcgttgatgaaggatttcatgatagacatggcct 30942175 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 2856947 cgcttctccgccttgggcttcttccccgccggggccttctc 2856987 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 2837395 cgcttctccgccttgggcttcttccccgccggggccttctc 2837435 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 2844008 cgcttctccgccttgggcttcttccccgcgggggccttctc 2844048 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 2819584 cgcttctccgccttgggcttcttccccgccagggccttctc 2819624 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 2685914 cgcttctccgccttgggcttcttccccgcgggggccttctc 2685874 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 2673591 cgcttctccgccttgggcttcttccccgcgggggccttctc 2673551 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 526 cagccgcttctccgccttgggcttcttc 553 |||||||||||||||||||||||||||| Sbjct: 17422064 cagccgcttctccgccttgggcttcttc 17422091 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 410 tgcttcagcaccttgaagatgtagatcttgtac 442 |||||| ||||||||||||||| |||||||||| Sbjct: 30476519 tgcttctgcaccttgaagatgttgatcttgtac 30476487 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 522 ccggcagccgcttctccgccttgggcttcttc 553 |||||| ||||||||| ||||||||||||||| Sbjct: 36007761 ccggcacccgcttctcggccttgggcttcttc 36007792 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Plus Query: 425 aagatgtagatcttgtacgtctccacgctc 454 |||||||||||||||||| | ||||||||| Sbjct: 19885823 aagatgtagatcttgtacatttccacgctc 19885852 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 416 agcaccttgaagatgtagatcttgta 441 |||||||||||||| ||||||||||| Sbjct: 12269803 agcaccttgaagatatagatcttgta 12269778 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 335 ttctcgaagatgtcgttgatgaaggagtt 363 |||| |||||||||||||||||| ||||| Sbjct: 80259 ttcttgaagatgtcgttgatgaatgagtt 80287 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 caccttgaagatgtagatct 437 |||||||||||||||||||| Sbjct: 20051339 caccttgaagatgtagatct 20051320
>dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0434B04 Length = 167029 Score = 496 bits (250), Expect = e-137 Identities = 286/298 (95%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 123718 agcctaagcggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 123659 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 123658 gagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtggg 123599 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| Sbjct: 123598 cttcttgttgtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgtt 123539 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 123538 gatgaaggagttcatgatggacatggccttggaggagatgccgatatcggggtggacctg 123479 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 123478 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 123421 Score = 488 bits (246), Expect = e-134 Identities = 285/298 (95%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| | |||||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 136041 agcctaagcggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggc 135982 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 135981 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 135922 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| || Sbjct: 135921 cttcttgttgtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcatt 135862 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 135861 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctg 135802 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 135801 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 135744 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 135689 cgcttctccgccttgggcttcttccccgcgggggccttctc 135649 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 123366 cgcttctccgccttgggcttcttccccgcgggggccttctc 123326
>ref|NM_184371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 494 bits (249), Expect = e-136 Identities = 279/289 (96%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 456 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 397 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 396 ggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgtt 337 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 336 gtagcgggcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaagga 277 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 |||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| Sbjct: 276 gttcatgatggacatggccttggaggagatgccgatatcggggtggacctgcttgagcac 217 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 216 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 113 cgcttctccgccttgggcttcttccccgcgggggccttctc 73
>dbj|AP003045.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0030H07 Length = 168253 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Plus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 63593 agcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 63652 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 63653 aagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 63712 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 63713 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 63772 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 63773 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 63832 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||| |||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 63833 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttctt 63880 Score = 482 bits (243), Expect = e-133 Identities = 285/299 (95%) Strand = Plus / Minus Query: 171 gagcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttgg 230 ||||||| | ||||||||| ||||| || ||||||||||||||||||||||||||||||| Sbjct: 78657 gagcctaagcggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttgg 78598 Query: 231 cgagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 290 | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 78597 caagctcgccggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgg 78538 Query: 291 gcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgt 350 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 78537 gcttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgt 78478 Query: 351 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacct 410 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 78477 tgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacct 78418 Query: 411 gcttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 78417 gcttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 78359 Score = 472 bits (238), Expect = e-130 Identities = 283/298 (94%) Strand = Plus / Plus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 44041 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 44100 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 44101 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 44160 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| || || Sbjct: 44161 cttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcatt 44220 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 44221 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 44280 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 44281 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 44338 Score = 470 bits (237), Expect = e-129 Identities = 261/269 (97%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 50673 ttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 50732 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 50733 aggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 50792 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 50793 agcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 50852 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 50853 gacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaagatg 50912 Query: 431 tagatcttgtacgtctccacgctcttctt 459 ||||||||||| ||||| ||||||||||| Sbjct: 50913 tagatcttgtaggtctcgacgctcttctt 50941 Score = 470 bits (237), Expect = e-129 Identities = 276/289 (95%) Strand = Plus / Plus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 26239 ggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgcc 26298 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 26299 ggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgtt 26358 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 26359 gtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaagga 26418 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 26419 gttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcac 26478 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 26479 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 26527 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 514 cttgcccgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||| || || ||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 78314 cttgccggcggggagccgcttctccgccttgggcttcttcccggccggggccttctc 78258 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 63945 cgcttctccgccttgggcttcttccccgccggggccttctc 63985 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 44393 cgcttctccgccttgggcttcttccccgccggggccttctc 44433 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 51006 cgcttctccgccttgggcttcttccccgcgggggccttctc 51046 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 26582 cgcttctccgccttgggcttcttccccgccagggccttctc 26622
>dbj|AP002522.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0009G03 Length = 163526 Score = 492 bits (248), Expect = e-136 Identities = 278/288 (96%) Strand = Plus / Plus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 162272 agcctaagaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 162331 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 162332 aagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 162391 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 162392 cttcttgttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgtt 162451 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 162452 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 162511 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||| |||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 162512 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttctt 162559 Score = 472 bits (238), Expect = e-130 Identities = 283/298 (94%) Strand = Plus / Plus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 142720 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 142779 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 142780 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 142839 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||||||||| ||||||||||||| ||| |||||||||||||||||||| || || Sbjct: 142840 cttcttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcatt 142899 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 142900 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctg 142959 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||| |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 142960 cttgagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 143017 Score = 470 bits (237), Expect = e-129 Identities = 261/269 (97%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 149352 ttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 149411 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 149412 aggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 149471 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 149472 agcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 149531 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 149532 gacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaagatg 149591 Query: 431 tagatcttgtacgtctccacgctcttctt 459 ||||||||||| ||||| ||||||||||| Sbjct: 149592 tagatcttgtaggtctcgacgctcttctt 149620 Score = 470 bits (237), Expect = e-129 Identities = 276/289 (95%) Strand = Plus / Plus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 124918 ggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgcc 124977 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 124978 ggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgtt 125037 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 125038 gtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaagga 125097 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 125098 gttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcac 125157 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 125158 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 125206 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 162624 cgcttctccgccttgggcttcttccccgccggggccttctc 162664 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 143072 cgcttctccgccttgggcttcttccccgccggggccttctc 143112 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 149685 cgcttctccgccttgggcttcttccccgcgggggccttctc 149725 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 125261 cgcttctccgccttgggcttcttccccgccagggccttctc 125301
>ref|NM_184407.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 486 bits (245), Expect = e-134 Identities = 272/281 (96%) Strand = Plus / Minus Query: 179 gaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcg 238 ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 458 gaggaagtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcg 399 Query: 239 ccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttg 298 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 398 ccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggcttcttg 339 Query: 299 ttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaag 358 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 338 ttgtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaag 279 Query: 359 gagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagc 418 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| Sbjct: 278 gagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagc 219 Query: 419 accttgaagatgtagatcttgtacgtctccacgctcttctt 459 ||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 218 accttgaagatgtagatcttgtaggtctcgacgctcttctt 178 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 113 cgcttctccgccttgggcttcttccccgccggggccttctc 73
>ref|NM_184374.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 486 bits (245), Expect = e-134 Identities = 278/289 (96%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 456 ggaggtgaatttagtgacggccttggtgccctcagagacggcgtgcttggcgagctcgcc 397 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 396 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 337 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||| Sbjct: 336 gtagcgggcgagcttggcggactctccggcgagcttctcgaagatgtcattgatgaagga 277 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 276 gttcatgatggacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcac 217 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 216 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 113 cgcttctccgccttgggcttcttccccgcgggggccttctc 73
>ref|NM_184409.1| Oryza sativa (japonica cultivar-group), mRNA Length = 468 Score = 478 bits (241), Expect = e-131 Identities = 277/289 (95%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| ||||| || |||||||||||||||||||||||||||||||| |||||||| Sbjct: 462 ggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcaagctcgcc 403 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 402 ggggaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgtt 343 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 342 gtagcgggcgagcttggcggcctcggcggcgagcttctcgaagatgtcgttgatgaagga 283 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 282 gttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcac 223 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 222 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 174 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 514 cttgcccgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||| || || ||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 129 cttgccggcggggagccgcttctccgccttgggcttcttcccggccggggccttctc 73
>ref|NM_184405.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 470 bits (237), Expect = e-129 Identities = 261/269 (97%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 446 ttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 387 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 386 aggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 327 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 326 agcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 267 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 266 gacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaagatg 207 Query: 431 tagatcttgtacgtctccacgctcttctt 459 ||||||||||| ||||| ||||||||||| Sbjct: 206 tagatcttgtaggtctcgacgctcttctt 178 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 113 cgcttctccgccttgggcttcttccccgcgggggccttctc 73
>ref|NM_184399.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 470 bits (237), Expect = e-129 Identities = 276/289 (95%) Strand = Plus / Minus Query: 181 ggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgcc 240 ||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct: 456 ggaggtgaacttggtcacagccttggtgccctcggagacggcgtgcttggcgagctcgcc 397 Query: 241 ggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgtt 300 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 396 ggggaggacgaggcggacggaggtctggatctcccgtgaggtgatggtgggcttcttgtt 337 Query: 301 gtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaagga 360 |||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||| Sbjct: 336 gtagcgcgcgagcttggcggactccccggcgagcttctcgaagatgtcgttgatgaagga 277 Query: 361 gttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 276 gttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgcttgagcac 217 Query: 421 cttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 ||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 216 cttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||| ||| |||||| Sbjct: 113 cgcttctccgccttgggcttcttccccgccagggccttctc 73
>dbj|AB075378.1| Oryza sativa OsH2B mRNA for histone H2B, complete cds Length = 552 Score = 470 bits (237), Expect = e-129 Identities = 261/269 (97%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 462 ttggtgacggccttcgtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 403 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 402 aggcggacggaggtctgaatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 343 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 342 agcttggcggactccccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 283 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 282 gacatggccttggaggagatgccgatgtcggggtgaacctgcttgagcaccttgaagatg 223 Query: 431 tagatcttgtacgtctccacgctcttctt 459 ||||||||||| ||||| ||||||||||| Sbjct: 222 tagatcttgtaggtctcgacgctcttctt 194 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| || |||| |||||| Sbjct: 129 cgcttctccgccttgggcttcttccccgcgggggccttctc 89
>ref|NM_184403.1| Oryza sativa (japonica cultivar-group), mRNA Length = 462 Score = 466 bits (235), Expect = e-128 Identities = 280/295 (94%) Strand = Plus / Minus Query: 175 ctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgag 234 ||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 462 ctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggcgag 403 Query: 235 ctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggctt 294 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 402 ctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtgggctt 343 Query: 295 cttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgat 354 |||||||||||| ||||||||||||| ||| |||||||||||||||||||| || ||||| Sbjct: 342 cttgttgtagcgcgcgagcttggcggactctccggcgagcttctcgaagatatcattgat 283 Query: 355 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgctt 414 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 282 gaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtggacctgctt 223 Query: 415 cagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||||||||||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 222 gagcaccttgaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 168 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||| ||||||| |||||| Sbjct: 113 cgcttctccgccttgggcttcttccccgccggggccttctc 73
>ref|XM_483094.1| Oryza sativa (japonica cultivar-group), mRNA Length = 453 Score = 466 bits (235), Expect = e-128 Identities = 277/291 (95%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 444 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 385 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 384 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 325 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 324 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 265 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 264 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 205 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcc 474 ||||||||| |||||||| ||||| ||||||||||||| ||||||| |||| Sbjct: 204 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttcctgcc 154 Score = 73.8 bits (37), Expect = 6e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggcttcttcccggccg 560 |||||||||||||||||| |||||||||||||||||||||| Sbjct: 114 cgccggcagccgcttctcggccttgggcttcttcccggccg 74
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 466 bits (235), Expect = e-128 Identities = 277/291 (95%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 24254615 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 24254556 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 24254555 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 24254496 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 24254495 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 24254436 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 24254435 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 24254376 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcc 474 ||||||||| |||||||| ||||| ||||||||||||| ||||||| |||| Sbjct: 24254375 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttcctgcc 24254325 Score = 212 bits (107), Expect = 9e-52 Identities = 143/155 (92%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| |||||||||||||| | |||||||||||||| |||||||||||||||||| || Sbjct: 24251113 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 24251054 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 24251053 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 24250994 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctc 339 |||||||||||||||||||| ||| | |||||||| Sbjct: 24250993 cgggcgagcttggcggcctcaccgacaagcttctc 24250959 Score = 97.6 bits (49), Expect = 4e-17 Identities = 106/125 (84%) Strand = Plus / Minus Query: 332 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatg 391 ||||||| ||||||| ||||||||||||||||||| |||||||||||||| ||||| ||| Sbjct: 21802131 agcttcttgaagatgccgttgatgaaggagttcataatggacatggccttagaggatatg 21802072 Query: 392 ccgatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacg 451 || |||| || | || |||||| |||||||| || ||||||||||| |||||||| Sbjct: 21802071 ccaatgttcatatgtatctacttcagtaccttgaacatatagatcttgtatgtctccaca 21802012 Query: 452 ctctt 456 ||||| Sbjct: 21802011 ctctt 21802007 Score = 83.8 bits (42), Expect = 6e-13 Identities = 105/126 (83%) Strand = Plus / Plus Query: 335 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 394 ||||||| ||| || ||||||||||||||||||||||||||| ||||||| || ||||| Sbjct: 11770130 ttctcgaggatttcattgatgaaggagttcatgatggacatgaccttggacgatatgcca 11770189 Query: 395 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 454 || || | |||| || || ||| |||||||| |||| ||||||||| ||||| | ||| Sbjct: 11770190 atatccagatgcatctactccagtaccttgaatatgtcgatcttgtatgtctcaatactc 11770249 Query: 455 ttcttg 460 |||||| Sbjct: 11770250 ttcttg 11770255 Score = 73.8 bits (37), Expect = 6e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggcttcttcccggccg 560 |||||||||||||||||| |||||||||||||||||||||| Sbjct: 24254285 cgccggcagccgcttctcggccttgggcttcttcccggccg 24254245 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 350 ttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 399 |||||||||||||||||||||||| | |||||| ||| |||| |||||| Sbjct: 17523219 ttgatgaaggagttcatgatggacgtaaccttgggggatatgctgatgtc 17523268 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 425 aagatgtagatcttgtacgtctccacgctc 454 ||||||||||||||||||||||||| |||| Sbjct: 13970925 aagatgtagatcttgtacgtctccatgctc 13970954 Score = 50.1 bits (25), Expect = 0.008 Identities = 34/37 (91%) Strand = Plus / Plus Query: 331 gagcttctcgaagatgtcgttgatgaaggagttcatg 367 ||||||||||||||||| | ||| ||||||||||||| Sbjct: 11729269 gagcttctcgaagatgttgatgaagaaggagttcatg 11729305 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 428 atgtagatcttgtacgtctccacgctc 454 ||||||||||||||||| ||||||||| Sbjct: 19095973 atgtagatcttgtacgtttccacgctc 19095999 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Plus Query: 420 ccttgaagatgtagatcttgtacgtctccacgctc 454 |||| ||||||||||||||||| ||||| |||||| Sbjct: 2876125 cctttaagatgtagatcttgtaggtctctacgctc 2876159 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Plus Query: 332 agcttctcgaagatgtcgttgatgaa 357 ||||||||||||||||| |||||||| Sbjct: 19095814 agcttctcgaagatgtctttgatgaa 19095839 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 335 ttctcgaagatgtcgttgatgaagga 360 |||||||||||||||||| ||||||| Sbjct: 15287651 ttctcgaagatgtcgttggtgaagga 15287626 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 328 ggcgagcttctcgaagatgtcgttgatga 356 ||||||||||| ||||||||| ||||||| Sbjct: 24608038 ggcgagcttcttgaagatgtctttgatga 24608066 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 334 cttctcgaagatgtcgttgatgaa 357 ||||||||||||||| |||||||| Sbjct: 13969661 cttctcgaagatgtcattgatgaa 13969684
>dbj|AP004620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0605H02 Length = 175547 Score = 466 bits (235), Expect = e-128 Identities = 277/291 (95%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 120954 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 120895 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 120894 gaggacgaggcggacggaggtctggatctccctggaggtgatggtgggcttcttgttgta 120835 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 120834 cctggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaacgagtt 120775 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 120774 catgattgacatggccttggaggagatcccgatgtccgggtgcacctgcttgagcacctt 120715 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgcc 474 ||||||||| |||||||| ||||| ||||||||||||| ||||||| |||| Sbjct: 120714 gaagatgtatatcttgtaggtctcgacgctcttcttggccttcttcctgcc 120664 Score = 212 bits (107), Expect = 9e-52 Identities = 143/155 (92%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| |||||||||||||| | |||||||||||||| |||||||||||||||||| || Sbjct: 117452 gtgaacttggtgacggccttagcaccctcggagacggcatgcttggcgagctcgccgagg 117393 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 117392 aggacgaggcggacagaggtctggatctccctggaggtgatggtgggcttcttgttgtac 117333 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctc 339 |||||||||||||||||||| ||| | |||||||| Sbjct: 117332 cgggcgagcttggcggcctcaccgacaagcttctc 117298 Score = 73.8 bits (37), Expect = 6e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggcttcttcccggccg 560 |||||||||||||||||| |||||||||||||||||||||| Sbjct: 120624 cgccggcagccgcttctcggccttgggcttcttcccggccg 120584
>gb|BT016478.1| Zea mays clone Contig311 mRNA sequence Length = 836 Score = 460 bits (232), Expect = e-126 Identities = 277/292 (94%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| |||||||| ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 542 gtgaacttggtgaccgcctttgtgccttcagagacggcgtgcttggcgagctcgccgggt 483 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 482 aggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgtag 423 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| Sbjct: 422 cgggcgagcttggcggcctccgcggcgagcttctcgaagatgtcgttgatgaaggaattc 363 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| Sbjct: 362 atgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttgagcaccttg 303 Query: 425 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccct 476 ||||||||||||||||| ||||||||||||||||||| ||||||||||||| Sbjct: 302 aagatgtagatcttgtaggtctccacgctcttcttggctttcttcttgccct 251 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 514 cttgcccgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 ||||||||| || || || ||||||||||| ||||||||||| ||||| | |||||| Sbjct: 228 cttgcccgcggggaggcgtttctccgccttcggcttcttccctgccggagccttctc 172
>emb|X69960.1|ZMH2B3A Z.mays gene for H2B histone (gH2B3) Length = 1728 Score = 456 bits (230), Expect = e-125 Identities = 349/389 (89%), Gaps = 6/389 (1%) Strand = Plus / Minus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 489 gaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagctcgccg 430 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 |||||||||||||| || |||||||||||||| |||||||||| ||||||||||||||| Sbjct: 429 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgacggtgggcttcttgtta 370 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 ||||| || |||||||||| |||| | ||||||||||||||||||||||||||||||||| Sbjct: 369 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 310 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 309 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 250 Query: 422 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttc 481 |||||||||||||||||||| ||||||||| |||||| | ||||| || |||| ||| Sbjct: 249 ttgaagatgtagatcttgtaggtctccacggacttcttcgctttctttttccccttcttg 190 Query: 482 ttctcgccgccctccttgccggaggcggtcttcttgcccgccggcagccgcttctccgcc 541 ||||||||||||||| |||| || |||||||||||| || |||||||| ||| Sbjct: 189 ccctcgccgccctccttaccggcgg------acttgcccgccgggaggcgcttctcggcc 136 Query: 542 ttgggcttcttcccggccggggacttctc 570 |||||||||||||| ||||| | |||||| Sbjct: 135 ttgggcttcttccccgccggagccttctc 107
>emb|X69961.1|SMH2B4A Z.mays gene for H2B histone (gH2B4) Length = 2361 Score = 446 bits (225), Expect = e-122 Identities = 290/311 (93%), Gaps = 3/311 (0%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct: 1362 ttggtaacggccttggtgccctcggagacggcgtgcttggcgagctcgccaggaaggacg 1303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| || || |||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 1302 aggcgcaccgaagtctggatctcccgggaggttatggtgggcttcttgttgtagcgggcg 1243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 ||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||| Sbjct: 1242 agcttggcggcctcggcagccagcttctcgaagatgtcgttgatgaaggagttcatgatg 1183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 |||||||||||||| ||||| || ||||| |||||||||||||| ||||||||||||||| Sbjct: 1182 gacatggccttggacgagataccaatgtccgggtgcacctgcttgagcaccttgaagatg 1123 Query: 431 tagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttcttctcgccg 490 ||||||||||||||||| ||||||||||||| ||||||||| || ||||||||||||| Sbjct: 1122 tagatcttgtacgtctcgacgctcttcttggccttcttcttccc---cttcttctcgccg 1066 Query: 491 ccctccttgcc 501 ||||||||||| Sbjct: 1065 ccctccttgcc 1055 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggcc 559 |||||||||||| ||||||||||| ||||| Sbjct: 1047 cgcttctccgccctgggcttcttctcggcc 1018
>gb|BT016350.1| Zea mays clone Contig183 mRNA sequence Length = 706 Score = 444 bits (224), Expect = e-121 Identities = 302/328 (92%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 517 agcctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 458 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||| || Sbjct: 457 gagctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtagg 398 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||| ||||| ||||||||||||||||| | ||||||||||||||||| ||||| Sbjct: 397 cttcttgttatagcgcgcgagcttggcggcctcagcagcgagcttctcgaagatatcgtt 338 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 ||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 337 aatgaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctg 278 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttctt 471 |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 277 cttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttgcccttcttctt 218 Query: 472 gccctgcttcttctcgccgccctccttg 499 |||| ||| |||||||||||||||| Sbjct: 217 gcccctcttgccctcgccgccctccttg 190 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 529 ccgcttctccgccttgggcttcttcccggc 558 ||||||||||||||| |||||||||||||| Sbjct: 166 ccgcttctccgccttcggcttcttcccggc 137
>gb|AY581839.1| Cynodon dactylon putative histone H2B mRNA, partial cds Length = 427 Score = 432 bits (218), Expect = e-118 Identities = 269/286 (94%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 289 ggtgaacttggtgacggccttagttccctcggagacggcgtgcttggcgagctcgccggg 230 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 229 gaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 170 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||| ||||| || ||||||||||||||||||||||||||||||||||| Sbjct: 169 gcgggcgaggcgtgcggcttcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 110 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 109 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttgagcacctt 50 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 49 gaagatgtagatcttgtacgtctccacgctcttcttggccttcttc 4
>emb|X57312.1|ZMH2B214 Z.mays mRNA for H2B histone (clone cH2B214) Length = 580 Score = 432 bits (218), Expect = e-118 Identities = 293/318 (92%) Strand = Plus / Minus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| || || |||||||| |||||||||||||||||||||||||||||||| ||| Sbjct: 452 gaggtgaacttcgtaacggccttagtgccctcggagacggcgtgcttggcgagctccccg 393 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 |||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||| Sbjct: 392 gggaggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtgggcttcttgttg 333 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 ||||| || |||||||||| |||| | ||||||||||||||||||||||||||||||||| Sbjct: 332 tagcgcgccagcttggcggactcggccgcgagcttctcgaagatgtcgttgatgaaggag 273 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 272 ttcatgatggacatggccttggacgagatgccgatgtcggggtgcacctgcttcagcacc 213 Query: 422 ttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttc 481 |||||||||||||||||||| ||||||||| |||||| | |||||| || |||| ||| Sbjct: 212 ttgaagatgtagatcttgtaggtctccacggacttcttcgccttctttttccccttcttg 153 Query: 482 ttctcgccgccctccttg 499 |||||||||||||||| Sbjct: 152 ccctcgccgccctccttg 135 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 514 cttgcccgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||| || |||||||| ||||||||||||||||| ||||| | |||||| Sbjct: 132 cttgcccgccgggaggcgcttctcggccttgggcttcttccccgccggagccttctc 76
>gb|BT017438.1| Zea mays clone EL01N0404D07.c mRNA sequence Length = 574 Score = 428 bits (216), Expect = e-117 Identities = 279/300 (93%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 309 agcctaggccgaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggc 250 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 |||||| ||||| ||||||||||| ||||||||||||||||| |||||||||||||| || Sbjct: 249 gagctccccgggaaggacgaggcgcacggaggtctggatctcacgggaggtgatggtagg 190 Query: 292 cttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgtt 351 ||||||||| ||||| || |||||||||||||| | ||||||||||||||||| ||||| Sbjct: 189 cttcttgttatagcgcgccagcttggcggcctcagcagcgagcttctcgaagatatcgtt 130 Query: 352 gatgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctg 411 ||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 129 aatgaaggagttcatgatcgacatggccttggaggagatgccaatgtccgggtgcacctg 70 Query: 412 cttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttctt 471 |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| Sbjct: 69 cttcagcaccttgaagatgtagatcttgtaggtctccacgctcttcttggccttcttctt 10
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 424 bits (214), Expect = e-115 Identities = 268/286 (93%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9465324 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9465265 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 9465264 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9465205 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 9465204 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9465145 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 9465144 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9465085 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 9465084 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 9465039 Score = 89.7 bits (45), Expect = 9e-15 Identities = 99/117 (84%) Strand = Plus / Plus Query: 334 cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 393 ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| Sbjct: 11567062 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgcc 11567121 Query: 394 gatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccac 450 ||||| | | | || ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 11567122 aatgtccagatttatctatttcagtaccttgaatatgtagatcttatacgtctccac 11567178 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||||||||||||| ||||| | |||||| Sbjct: 9464991 cgccggcagccgcttctccgccttgggcttcttccccgccggcgccttctc 9464941 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 330 cgagcttctcgaagatgtcgttgatgaaggagttcatg 367 |||||||||||||||||||| |||||||||||||||| Sbjct: 25627557 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25627594 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 419 accttgaagatgtagatcttgtacgtct 446 |||||||||||||||||||||||||||| Sbjct: 25627644 accttgaagatgtagatcttgtacgtct 25627671 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Minus Query: 328 ggcgagcttctcgaagatgtcgttgatgaa 357 |||||||||||| |||||||| |||||||| Sbjct: 23486139 ggcgagcttctcaaagatgtctttgatgaa 23486110 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 418 caccttgaagatgtagatcttgtacgtct 446 ||||||||| |||||||||||||| |||| Sbjct: 28216459 caccttgaaaatgtagatcttgtaggtct 28216431 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 422 ttgaagatgtagatcttgtacgtct 446 |||||||||||||||||||| |||| Sbjct: 27003474 ttgaagatgtagatcttgtaggtct 27003450 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 421 cttgaagatgtagatcttgtacgtc 445 |||||||||||||||||| |||||| Sbjct: 24070005 cttgaagatgtagatcttatacgtc 24069981 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 caccttgaagatgtagatct 437 |||||||||||||||||||| Sbjct: 27003565 caccttgaagatgtagatct 27003546
>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0002D01, from chromosome 3, complete sequence Length = 187589 Score = 424 bits (214), Expect = e-115 Identities = 268/286 (93%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 162724 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 162665 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 162664 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 162605 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 162604 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 162545 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 162544 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 162485 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 162484 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 162439 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||||||||||||| ||||| | |||||| Sbjct: 162391 cgccggcagccgcttctccgccttgggcttcttccccgccggcgccttctc 162341
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 424 bits (214), Expect = e-115 Identities = 268/286 (93%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9463445 ggtgaacttggtgaccgccttggtgccctcggagacggcgtgcttggcgagctcgccggg 9463386 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 9463385 gaggacgaggcggacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 9463326 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 9463325 gcgggcgaggcgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 9463266 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||||||||||||| |||||||| ||||||||||||||||| ||||| Sbjct: 9463265 catgatcgacatggccttggaggagattccgatgtccgggtgcacctgcttcaggacctt 9463206 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttc 469 |||||||||||||||||| ||||| ||||||||||| | ||||||| Sbjct: 9463205 gaagatgtagatcttgtaggtctcgacgctcttcttcgccttcttc 9463160 Score = 89.7 bits (45), Expect = 9e-15 Identities = 99/117 (84%) Strand = Plus / Plus Query: 334 cttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgcc 393 ||||| |||||| ||||||||||||||||| ||||||| ||||||||| ||||| ||||| Sbjct: 11563825 cttcttgaagatatcgttgatgaaggagttgatgatggtcatggccttagaggatatgcc 11563884 Query: 394 gatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccac 450 ||||| | | | || ||||| |||||||| ||||||||||| ||||||||||| Sbjct: 11563885 aatgtccagatttatctatttcagtaccttgaatatgtagatcttatacgtctccac 11563941 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 520 cgccggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 |||||||||||||||||||||||||||||||||||| ||||| | |||||| Sbjct: 9463112 cgccggcagccgcttctccgccttgggcttcttccccgccggcgccttctc 9463062 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 330 cgagcttctcgaagatgtcgttgatgaaggagttcatg 367 |||||||||||||||||||| |||||||||||||||| Sbjct: 25718866 cgagcttctcgaagatgtcgaggatgaaggagttcatg 25718903 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 419 accttgaagatgtagatcttgtacgtct 446 |||||||||||||||||||||||||||| Sbjct: 25718953 accttgaagatgtagatcttgtacgtct 25718980 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Minus Query: 328 ggcgagcttctcgaagatgtcgttgatgaa 357 |||||||||||| |||||||| |||||||| Sbjct: 23479167 ggcgagcttctcaaagatgtctttgatgaa 23479138 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 418 caccttgaagatgtagatcttgtacgtct 446 ||||||||| |||||||||||||| |||| Sbjct: 28307783 caccttgaaaatgtagatcttgtaggtct 28307755 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 422 ttgaagatgtagatcttgtacgtct 446 |||||||||||||||||||| |||| Sbjct: 27094797 ttgaagatgtagatcttgtaggtct 27094773 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 421 cttgaagatgtagatcttgtacgtc 445 |||||||||||||||||| |||||| Sbjct: 23987474 cttgaagatgtagatcttatacgtc 23987450 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 caccttgaagatgtagatct 437 |||||||||||||||||||| Sbjct: 27094888 caccttgaagatgtagatct 27094869
>gb|BT016885.1| Zea mays clone Contig718 mRNA sequence Length = 568 Score = 410 bits (207), Expect = e-111 Identities = 299/329 (90%), Gaps = 3/329 (0%) Strand = Plus / Minus Query: 173 gcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcg 232 ||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||| Sbjct: 337 gcctaggagctggtgaacttggtgacggctttggtgccctcggagacggcgtgcttggcg 278 Query: 233 agctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggc 292 ||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||| Sbjct: 277 agctcgccggggaggacgaggcgaacggaggtctggatctcgcgggacgtaatggtaggc 218 Query: 293 ttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttg 352 ||||||||||| || || |||||||| ||||| | || ||||||||||||||||||||| Sbjct: 217 ttcttgttgtaccgcgccagcttggccgcctccgccgccagcttctcgaagatgtcgttg 158 Query: 353 atgaaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgc 412 |||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| Sbjct: 157 atgaaggagttcatgatggacatggccttggacgagatgccaatgtccgggtgcacctgc 98 Query: 413 ttcagcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttg 472 |||||||||||||||||||||||||||||||||||||| |||||| | ||||||||| Sbjct: 97 ttcagcaccttgaagatgtagatcttgtacgtctccaccgacttctttgccttcttcttc 38 Query: 473 ccctgcttcttctcgccgccctccttgcc 501 || |||||||||||| ||||||||||| Sbjct: 37 cc---cttcttctcgccaccctccttgcc 12
>dbj|AP003144.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0507H06 Length = 136351 Score = 385 bits (194), Expect = e-103 Identities = 239/254 (94%) Strand = Plus / Plus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 75126 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 75185 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 ||||||||||||||||||||||| |||||| ||||||||| | |||||||||||||||| Sbjct: 75186 gaggacgaggcggacggaggtctagatctcgcgggaggtggcgatgggcttcttgttgta 75245 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 75246 gcgggcgaggtgggcggcctcctgcgcgagcttctcgaagatgtcgttgatgaaggagtt 75305 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 75306 catgatcgacatggccttggaggagatgccgatgtccgggtgcacctgcttcaggacctt 75365 Query: 424 gaagatgtagatct 437 |||||||||||||| Sbjct: 75366 gaagatgtagatct 75379 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 526 cagccgcttctccgccttgggcttcttc 553 |||||||||||||||||||||||||||| Sbjct: 75456 cagccgcttctccgccttgggcttcttc 75483
>ref|NM_190523.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 420 Score = 363 bits (183), Expect = 4e-97 Identities = 282/315 (89%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 410 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 351 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||| Sbjct: 350 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 291 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 290 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 231 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 230 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 171 Query: 425 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttcttc 484 || ||||||||||| || || || ||||||||||||| ||||||||| |||| ||||| Sbjct: 170 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 111 Query: 485 tcgccgccctccttg 499 |||||||||||||| Sbjct: 110 ccgccgccctccttg 96 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Minus Query: 522 ccggcagccgcttctccgccttgggcttcttc 553 |||||| ||||||||| ||||||||||||||| Sbjct: 91 ccggcacccgcttctcggccttgggcttcttc 60
>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408C03 Length = 141273 Score = 363 bits (183), Expect = 4e-97 Identities = 282/315 (89%) Strand = Plus / Plus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 20167 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 20226 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||| Sbjct: 20227 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 20286 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 20287 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 20346 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 20347 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 20406 Query: 425 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttcttc 484 || ||||||||||| || || || ||||||||||||| ||||||||| |||| ||||| Sbjct: 20407 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 20466 Query: 485 tcgccgccctccttg 499 |||||||||||||| Sbjct: 20467 ccgccgccctccttg 20481 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 522 ccggcagccgcttctccgccttgggcttcttc 553 |||||| ||||||||| ||||||||||||||| Sbjct: 20486 ccggcacccgcttctcggccttgggcttcttc 20517
>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0031D11 Length = 138108 Score = 363 bits (183), Expect = 4e-97 Identities = 282/315 (89%) Strand = Plus / Plus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 106120 gtgaacttggtgacggccttggtgccctcagagacggcgtgcttggcgagctcgccgggg 106179 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||| Sbjct: 106180 aggacgaggcgcaccgaggtctggatctcgcgggaggtgatggtcggcttcttgttgtag 106239 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 |||||||| ||||||||| |||||||||||||||||| ||||||||||| |||||| Sbjct: 106240 cgggcgagacgggcggcctcctgggcgagcttctcgaagatatcgttgatgaacgagttc 106299 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 ||||| |||||||||||||| || || ||||| ||||| ||||||||||| || |||||| Sbjct: 106300 atgatcgacatggccttggacgatatcccgatatcgggatgcacctgcttgaggaccttg 106359 Query: 425 aagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccctgcttcttc 484 || ||||||||||| || || || ||||||||||||| ||||||||| |||| ||||| Sbjct: 106360 aaaatgtagatcttataagtttcgacgctcttcttggccttcttcttccccttcttctcg 106419 Query: 485 tcgccgccctccttg 499 |||||||||||||| Sbjct: 106420 ccgccgccctccttg 106434 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 522 ccggcagccgcttctccgccttgggcttcttc 553 |||||| ||||||||| ||||||||||||||| Sbjct: 106439 ccggcacccgcttctcggccttgggcttcttc 106470
>ref|XM_475367.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 375 Score = 343 bits (173), Expect = 4e-91 Identities = 269/301 (89%) Strand = Plus / Minus Query: 176 taggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 235 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 374 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 315 Query: 236 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 295 ||||||||||||||||| || || |||||||||||||| ||||||||||| ||||||||| Sbjct: 314 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 255 Query: 296 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 355 |||||||| | ||| ||| | |||||||| ||||||||||||| |||||||||| | Sbjct: 254 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 195 Query: 356 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 415 ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||| Sbjct: 194 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 135 Query: 416 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccc 475 |||||||||||||||||||| || || ||||||||||| ||||| | ||||||||| ||| Sbjct: 134 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttcccc 75 Query: 476 t 476 | Sbjct: 74 t 74
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 343 bits (173), Expect = 4e-91 Identities = 269/301 (89%) Strand = Plus / Minus Query: 176 taggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagc 235 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 69877 taggaggaggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcaagc 69818 Query: 236 tcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttc 295 ||||||||||||||||| || || |||||||||||||| ||||||||||| ||||||||| Sbjct: 69817 tcgccggggaggacgagacgaacagaggtctggatctcgcgggaggtgattgtgggcttc 69758 Query: 296 ttgttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatg 355 |||||||| | ||| ||| | |||||||| ||||||||||||| |||||||||| | Sbjct: 69757 ttgttgtacctggcaagcctcgcggcctcctgctcgagcttctcgaaaatgtcgttgacg 69698 Query: 356 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 415 ||||| ||||||||||||||||||||||||||||| || ||||| || ||||||||||| Sbjct: 69697 aaggaattcatgatggacatggccttggaggagattcctatgtctggatgcacctgcttg 69638 Query: 416 agcaccttgaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgccc 475 |||||||||||||||||||| || || ||||||||||| ||||| | ||||||||| ||| Sbjct: 69637 agcaccttgaagatgtagattttataggtctccacgcttttcttcgccttcttcttcccc 69578 Query: 476 t 476 | Sbjct: 69577 t 69577
>emb|X82362.1|AOHIS2B A.officinalis mRNA for histone 2B Length = 492 Score = 337 bits (170), Expect = 2e-89 Identities = 248/274 (90%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 452 ggtgaacttggtgacggccttggtgccctcggagacggcgtgcttggcgagctccccggg 393 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 ||||||||| | |||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 392 gaggacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 333 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 |||||| || || |||||| ||| |||||||||||||||||||||||||| ||||| Sbjct: 332 gcgggccaggcgggaggcctcctgggccagcttctcgaagatgtcgttgatgaacgagtt 273 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| ||| |||||| ||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 272 catgatccccatcgccttgctcgagatcccgatgtccgggtggacctgcttcaggacctt 213 Query: 424 gaagatgtagatcttgtacgtctccacgctcttc 457 |||||||||||||||||||||||||||||||||| Sbjct: 212 gaagatgtagatcttgtacgtctccacgctcttc 179 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 523 cggcagccgcttctccgccttgggcttcttcccggccggggacttctc 570 ||||||||||||||||||||| ||||||||||| || |||| |||||| Sbjct: 119 cggcagccgcttctccgccttcggcttcttccccgcgggggccttctc 72
>gb|AY389709.1| Hyacinthus orientalis histone H2B mRNA, partial cds Length = 627 Score = 313 bits (158), Expect = 3e-82 Identities = 245/274 (89%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 519 ggtgaacttggtcacggccttggtgccgtcggagacggcgtgcttggcgagctcgccggg 460 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 ||| ||||| | |||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 459 gagcacgagcctgacggaggtctggatctcgcgggaggtgatggtgggcttcttgttgta 400 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 |||||| || | || ||| |||||||||||||||||||||||||||||||||||| Sbjct: 399 gcgggccaggcgagaggactcctgggcgagcttctcgaagatgtcgttgatgaaggagtt 340 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||| ||||| || ||||| ||||| ||||||||||||||||| Sbjct: 339 catgatccccatggccttgctcgagatccctatgtccgggtggacctgcttcagcacctt 280 Query: 424 gaagatgtagatcttgtacgtctccacgctcttc 457 ||| ||||||||||||||||||||||||| |||| Sbjct: 279 gaatatgtagatcttgtacgtctccacgcccttc 246 Score = 48.1 bits (24), Expect = 0.032 Identities = 37/40 (92%), Gaps = 1/40 (2%) Strand = Plus / Minus Query: 532 cttctccgccttgggcttc-ttcccggccggggacttctc 570 ||||||||||||||||||| |||||||| |||| |||||| Sbjct: 186 cttctccgccttgggcttctttcccggcgggggtcttctc 147
>dbj|D37944.1|WHTPH2B12C Triticum aestivum gene for protein H2B123, complete cds Length = 2901 Score = 305 bits (154), Expect = 8e-80 Identities = 256/290 (88%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 ||||||| |||| ||||||||||| ||||||||||||||||||||||| |||||||| || Sbjct: 1993 ggtgaatctggtaacggccttggttccctcggagacggcgtgcttggcaagctcgcctgg 1934 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 | ||| ||||| |||| |||||||||||||| |||||||||||||||||||||||||| Sbjct: 1933 aaagacaaggcgcacggcagtctggatctcccgagaggtgatggtgggcttcttgttgta 1874 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 ||| |||||||| || | ||| ||||||||||||||||||||||||||||||| |||||| Sbjct: 1873 gcgtgcgagctttgccgactctccggcgagcttctcgaagatgtcgttgatgatggagtt 1814 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||||||| | ||||||||||| || |||| |||| | |||||| |||||||| Sbjct: 1813 gatgatggacattgatttggaggagatacccatgttcgggtcaatctgcttgagcacctt 1754 Query: 424 gaagatgtagatcttgtacgtctccacgctcttcttggacttcttcttgc 473 |||||||||||||||||||||||| ||||||||||| ||||||||||| Sbjct: 1753 gaagatgtagatcttgtacgtctcgttgctcttcttggccttcttcttgc 1704 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Minus Query: 530 cgcttctccgccttgggcttcttcccggcc 559 ||||||||| |||||||||||||| ||||| Sbjct: 1677 cgcttctccaccttgggcttcttctcggcc 1648
>gb|AF356817.1|AF356817 Lolium perenne histone H2B-1 mRNA, partial cds Length = 410 Score = 299 bits (151), Expect = 5e-78 Identities = 190/203 (93%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 203 gtgaacttggtgacggccttggtgccctcagacacggcgtgcttggcgagctcgccgggg 144 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 143 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtac 84 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 | |||||||||||||| ||| || || | ||||||||||||||| |||||||||||||| Sbjct: 83 ctggcgagcttggcggactcaccagccaatttctcgaagatgtcgctgatgaaggagttc 24 Query: 365 atgatggacatggccttggagga 387 ||||||||||||||| ||||||| Sbjct: 23 atgatggacatggccctggagga 1
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 258 bits (130), Expect = 2e-65 Identities = 235/270 (87%) Strand = Plus / Minus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||| ||||||||||||||||| || || ||||||||||| ||||||||| Sbjct: 4211 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 4152 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 || || || ||||| |||| |||||||||||| |||||||| | |||||||||||||||| Sbjct: 4151 ggcagcaccaggcgcacggcggtctggatctcgcgggaggtcacggtgggcttcttgttg 4092 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 |||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 4091 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 4032 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 ||||||||||||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 4031 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3972 Query: 422 ttgaagatgtagatcttgtacgtctccacg 451 ||| ||||||| | |||||| ||||||||| Sbjct: 3971 ttgtagatgtacagcttgtaggtctccacg 3942
>gb|AF356821.1|AF356821 Lolium perenne histone H2B-5 mRNA, partial cds Length = 375 Score = 256 bits (129), Expect = 7e-65 Identities = 210/235 (89%), Gaps = 9/235 (3%) Strand = Plus / Minus Query: 335 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 394 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 359 ttctcgaagatgtcgttgatgaaggagctcatgatggacatggccttggaggagatgccg 300 Query: 395 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 454 |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | Sbjct: 299 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctccacggac 240 Query: 455 ttcttggacttcttcttgccctgcttcttctcgccgccctccttgccggaggcggtcttc 514 ||||| | |||||||||||||| |||||||||||||||||||| ||| |||||||| Sbjct: 239 ttctttgccttcttcttgccct---tcttctcgccgccctccttggcgg---cggtcttc 186 Query: 515 ttgcccgccggcagccgcttctccgccttgggcttcttcccggccggggacttct 569 || || ||||| | |||| |||||||||||||||| |||| |||| ||||| Sbjct: 185 ---ccggcgggcaggctcttccccgccttgggcttcttggcggcgggggtcttct 134
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 242 bits (122), Expect = 1e-60 Identities = 233/270 (86%) Strand = Plus / Plus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||| ||||||||||||||||| || || ||||||||||| |||||||| Sbjct: 3040 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgcca 3099 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 || || || ||||| |||| |||||||||||| |||||||| | |||||||||||||||| Sbjct: 3100 ggcagcaccaggcgcacggcggtctggatctcacgggaggtcacggtgggcttcttgttg 3159 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 |||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 3160 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 3219 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 |||||||| |||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 3220 ttcatgatagacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 3279 Query: 422 ttgaagatgtagatcttgtacgtctccacg 451 ||| ||||||| | |||||| ||||||||| Sbjct: 3280 ttgtagatgtacagcttgtaggtctccacg 3309
>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III), histone H2B (ch2b-III) and histone H2A (ch2a-III) genes, complete cds Length = 4582 Score = 242 bits (122), Expect = 1e-60 Identities = 233/270 (86%) Strand = Plus / Plus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||| ||||||||||||||||| || || ||||||||||| ||||||||| Sbjct: 2338 gaggtgaacttggtcacggccttggtgccctccgacaccgcgtgcttggccagctcgccg 2397 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 || || || ||||| || | |||||||||||| |||||||| | |||||||||||||||| Sbjct: 2398 ggcagcaccaggcgcaccgcggtctggatctcgcgggaggtcacggtgggcttcttgttg 2457 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 |||||| ||||||| |||||| ||| | |||||| |||||||||||||||||| | Sbjct: 2458 tagcggctcagcttggaggcctcagtggccaccttctcaaagatgtcgttgatgaagctg 2517 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 ||||||||||||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 2518 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2577 Query: 422 ttgaagatgtagatcttgtacgtctccacg 451 ||| ||||||| | |||||| ||||||||| Sbjct: 2578 ttgtagatgtacagcttgtaggtctccacg 2607
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 226 bits (114), Expect = 6e-56 Identities = 231/270 (85%) Strand = Plus / Plus Query: 182 gaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccg 241 |||||||| ||||| ||||||||||||||||| || || |||||||| || ||||| ||| Sbjct: 2456 gaggtgaacttggtcacggccttggtgccctctgacaccgcgtgcttagccagctcaccg 2515 Query: 242 gggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttg 301 || || || ||||| |||| |||||||||||| || ||||| | |||||||||||||||| Sbjct: 2516 ggcagcaccaggcgcacggcggtctggatctcgcgagaggtcacggtgggcttcttgttg 2575 Query: 302 tagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggag 361 |||||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| | Sbjct: 2576 tagcggctcagcttggaggcctcggtggccaccttctcaaagatgtcgttgatgaagctg 2635 Query: 362 ttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacc 421 ||||||||||||||||||||| | ||||||| ||||||||||||||||||| |||||| Sbjct: 2636 ttcatgatggacatggccttgctgctgatgccggtgtcggggtgcacctgcttgagcacc 2695 Query: 422 ttgaagatgtagatcttgtacgtctccacg 451 ||| | ||||| | |||||| ||||||||| Sbjct: 2696 ttgtatatgtacagcttgtaggtctccacg 2725
>gb|AF356819.1|AF356819 Lolium perenne histone H2B-3 mRNA, partial cds Length = 397 Score = 224 bits (113), Expect = 2e-55 Identities = 192/218 (88%), Gaps = 9/218 (4%) Strand = Plus / Minus Query: 335 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 381 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 322 Query: 395 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 454 ||||||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||| Sbjct: 321 atgtcggggtggacctgcttgagcaccttgaaaatgtagatcttgtaggtctcgacgctc 262 Query: 455 ttcttggacttcttcttgccctgcttcttctcgccgccctccttgccggaggcggtcttc 514 |||||| ||||||| ||||| | ||||| |||||||||||| ||| || || Sbjct: 261 ttcttgcccttcttcctgccccg---tttctcaccgccctccttggcggcgg------tc 211 Query: 515 ttgcccgccggcagccgcttctccgccttgggcttctt 552 |||||||||||||| | |||| | |||||||||||||| Sbjct: 210 ttgcccgccggcaggctcttcccggccttgggcttctt 173
>gb|AF356818.1|AF356818 Lolium perenne histone H2B-2 mRNA, partial cds Length = 402 Score = 224 bits (113), Expect = 2e-55 Identities = 131/137 (95%) Strand = Plus / Minus Query: 335 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 386 ttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccg 327 Query: 395 atgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctccacgctc 454 |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | Sbjct: 326 atgtcggggtgcacctgcttgagcaccttgaagatgtagatcttgtacgtctcgacggac 267 Query: 455 ttcttggacttcttctt 471 |||||| ||||||||| Sbjct: 266 ttcttgttcttcttctt 250
>dbj|AK059159.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D03, full insert sequence Length = 288 Score = 224 bits (113), Expect = 2e-55 Identities = 125/129 (96%) Strand = Plus / Minus Query: 172 agcctaggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggc 231 |||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct: 137 agcctaggaggaagtgaacttggtaacggccttggtgccctcggagacggcgtgcttggc 78 Query: 232 gagctcgccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtggg 291 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 77 gagctcgccggggaggacgaggcggacggcggtctggatctcccgggaggtgatggtggg 18 Query: 292 cttcttgtt 300 ||||||||| Sbjct: 17 cttcttgtt 9
>ref|XM_540291.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC483173), mRNA Length = 2193 Score = 218 bits (110), Expect = 2e-53 Identities = 203/234 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 378 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 319 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||||||||||||||||| ||||||||| | || Sbjct: 318 aggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgtaatgcgcc 259 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 258 aggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 199 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 198 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 145
>ref|XM_540282.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC483164), mRNA Length = 659 Score = 218 bits (110), Expect = 2e-53 Identities = 203/234 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 385 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 326 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||||||||||||||||| ||||||||| | || Sbjct: 325 aggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgtaatgcgcc 266 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 265 aggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 206 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 205 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 152
>ref|XM_540287.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 1 (LOC483169), mRNA Length = 432 Score = 218 bits (110), Expect = 2e-53 Identities = 203/234 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 372 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 313 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||||||||||||||||| ||||||||| | || Sbjct: 312 aggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgtaatgcgcc 253 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 252 aggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 193 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 192 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 139
>ref|XM_844635.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 2 (LOC483169), mRNA Length = 516 Score = 218 bits (110), Expect = 2e-53 Identities = 203/234 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 410 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 351 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||||||||||||||||| ||||||||| | || Sbjct: 350 aggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgtaatgcgcc 291 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 290 aggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 231 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 230 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 177
>ref|XM_854499.1| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 5 (LOC483170), mRNA Length = 415 Score = 218 bits (110), Expect = 2e-53 Identities = 203/234 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||||||||||||||||| ||||||||| | || Sbjct: 302 aggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgtaatgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 242 aggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 182 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 129
>ref|XM_540288.2| PREDICTED: Canis familiaris similar to H2B histone family, member F, transcript variant 4 (LOC483170), mRNA Length = 597 Score = 218 bits (110), Expect = 2e-53 Identities = 203/234 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 410 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 351 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||||||||||||||||| ||||||||| | || Sbjct: 350 aggcgcacggccgtctggatctcccgggaggtgatggtggagcgcttgttgtaatgcgcc 291 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 290 aggcgggaggcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 231 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 230 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 177
>gb|AF048824.1|AF048824 Malus domestica histone H2B mRNA, partial cds Length = 478 Score = 194 bits (98), Expect = 2e-46 Identities = 230/274 (83%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||| || || ||||||||||| || || || || ||||||||||||||||| || || Sbjct: 274 ggtgaacttagtcacggccttggtcccttccgaaacagcgtgcttggcgagctcaccagg 215 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 ||| ||||| | |||||||||||||| |||||||| ||||| || || ||||||||||| Sbjct: 214 gagcacgagcctcacggaggtctggatttcccgggaagtgatcgtcggtttcttgttgta 155 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | |||||| ||| | ||| ||||||||||||||| ||||||||||||||| ||| Sbjct: 154 cctcgcgagcctggacgactcctgggcgagcttctcgaaaatgtcgttgatgaagctgtt 95 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 |||||| |||||||||| |||||| |||||||| ||||| ||||||||||||||||| Sbjct: 94 catgattcccatggccttgctggagatcccgatgtcagggtggacctgcttcagcacctt 35 Query: 424 gaagatgtagatcttgtacgtctccacgctcttc 457 ||| ||||| |||||||| ||||| ||||||||| Sbjct: 34 gaaaatgtaaatcttgtaggtctcaacgctcttc 1
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 180 bits (91), Expect = 3e-42 Identities = 220/263 (83%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| |||||||| ||||||||||||||||| |||||||||||||| |||||||| || Sbjct: 1583 gtgaacttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgcccgga 1524 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 || || ||||| || | ||||| || || || || || | ||||||||||||||||||| Sbjct: 1523 agaaccaggcgcacagcagtctgaatttcgcgcgacgtcacggtgggcttcttgttgtag 1464 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 ||| ||||||| ||||||| ||| | |||||| |||||||||||||||||| |||| Sbjct: 1463 cggctcagcttggaggcctcggtggcaaccttctcaaagatgtcgttgatgaagctgttc 1404 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 || || ||||||||||| ||| ||||||| | ||||||||||||||||||| ||||||| Sbjct: 1403 ataatcgacatggccttcgagctgatgccggtatcggggtgcacctgcttcaacaccttg 1344 Query: 425 aagatgtagatcttgtacgtctc 447 | ||||| | |||||| ||||| Sbjct: 1343 taaatgtaaagcttgtaggtctc 1321
>emb|X14731.1|CMHIST2B Duck H2B histone gene Length = 1179 Score = 172 bits (87), Expect = 8e-40 Identities = 200/235 (85%), Gaps = 2/235 (0%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga-c 249 |||||||| |||||||||||||||||||||||||||||||| ||||||||||| || | | Sbjct: 1035 ttggtgaccgccttggtgccctcggagacggcgtgcttggccagctcgccgggcagcagc 976 Query: 250 gaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggc 309 || || |||| |||||||||||||| ||||||||||| | |||||||||| | || Sbjct: 975 gac-cgcacggccgtctggatctcccgcgaggtgatggtcgagcgcttgttgtagtgcgc 917 Query: 310 gagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgat 369 || | ||||||||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 916 caggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaaggagttcatgat 857 Query: 370 ggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 | |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 856 gcccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 802
>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds Length = 1442 Score = 172 bits (87), Expect = 8e-40 Identities = 219/263 (83%) Strand = Plus / Minus Query: 185 gtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccgggg 244 ||||| |||||||| |||||||| |||||||| || ||||||||||| |||||||| || Sbjct: 1264 gtgaacttggtgacagccttggttccctcggacacagcgtgcttggccagctcgcctggc 1205 Query: 245 aggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 ||||| ||||| |||| |||||||| || || || |||| ||| |||||||||||||| Sbjct: 1204 aggacaaggcgcacggcagtctggatttcgcgagacgtgacggtcggcttcttgttgtaa 1145 Query: 305 cgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttc 364 ||| ||||| | |||||| ||||| |||||| || ||||||||||||||| |||| Sbjct: 1144 cggctaagctttgaagcctcggtggcgaccttctcaaatatgtcgttgatgaagctgttc 1085 Query: 365 atgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||| ||||||||| ||||||| |||| ||||||||||||||||||||||| Sbjct: 1084 atgatgctcatcgccttggagctgatgccggtgtcagggtgcacctgcttcagcacctta 1025 Query: 425 aagatgtagatcttgtacgtctc 447 ||||||| | |||||| ||||| Sbjct: 1024 tagatgtacagcttgtaggtctc 1002
>ref|NM_175055.2| Homo sapiens histone 3, H2bb (HIST3H2BB), mRNA Length = 452 Score = 170 bits (86), Expect = 3e-39 Identities = 197/234 (84%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 385 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 326 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | || ||||| |||||||||| |||||||||| | || Sbjct: 325 aggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgtagtgtgcc 266 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 265 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 206 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 205 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 152
>gb|BC100857.1| Homo sapiens cDNA clone IMAGE:40002416, partial cds Length = 435 Score = 170 bits (86), Expect = 3e-39 Identities = 197/234 (84%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 384 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 325 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | || ||||| |||||||||| |||||||||| | || Sbjct: 324 aggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgtagtgtgcc 265 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 264 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 205 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 204 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 151
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 170 bits (86), Expect = 3e-39 Identities = 197/234 (84%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 99874 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 99933 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | || ||||| |||||||||| |||||||||| | || Sbjct: 99934 aggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgtagtgtgcc 99993 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 99994 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 100053 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 100054 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 100107 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 93986 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 93927 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 93926 gtcggggtgcacctgcttcagcaccttg 93899 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 94133 ttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 94081
>dbj|AK091220.1| Homo sapiens cDNA FLJ33901 fis, clone CTONG2008321, highly similar to HISTONE H2B F Length = 2359 Score = 170 bits (86), Expect = 3e-39 Identities = 197/234 (84%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 385 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 326 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | || ||||| |||||||||| |||||||||| | || Sbjct: 325 aggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgtagtgtgcc 266 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 265 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 206 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 205 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 152
>gb|AY131981.1| Homo sapiens histone H2B (HIST3H2BB) gene, complete cds Length = 1137 Score = 170 bits (86), Expect = 3e-39 Identities = 197/234 (84%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 741 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 682 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | || ||||| |||||||||| |||||||||| | || Sbjct: 681 aggcgaacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgtagtgtgcc 622 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 621 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 562 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 561 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 508
>gb|M14142.1|SUPH2B1 P.miliaris histone H2B-2.1 gene, complete cds Length = 375 Score = 170 bits (86), Expect = 3e-39 Identities = 215/258 (83%) Strand = Plus / Minus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| | ||||||||||||||||||||||| |||||||||||||||||||| || Sbjct: 369 ggaggtggtgtacttggtgacggccttggtgccctcagagacggcgtgcttggcgagttc 310 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||||||||| || | ||| | |||||||| ||| ||| | ||||||||| |||||| Sbjct: 309 accggggaggagaagtctgacagcggtctggacctcacggctgctgatggtggacttctt 250 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 ||||||| |||| || || ||||| ||||||| |||||||| ||||||| ||| Sbjct: 249 gttgtagtgggcaagacgggaagcctcaccggcgatgcgctcgaagacatcgttgacgaa 190 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 | |||||||||||||||||| ||| ||||||||| |||||||||| ||||||||||| Sbjct: 189 gctgttcatgatggacatggctttgctggagatgccagtgtcggggtggacctgcttcag 130 Query: 418 caccttgaagatgtagat 435 |||||| |||||||||| Sbjct: 129 aaccttgtagatgtagat 112
>ref|XM_518301.1| PREDICTED: Pan troglodytes similar to histone H2B (LOC462508), mRNA Length = 1026 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| |||||||| | Sbjct: 454 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccggggagcagc 395 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 394 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 335 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 334 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 275 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 274 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 221
>ref|XM_525086.1| PREDICTED: Pan troglodytes similar to Histone H2B F (H2B 291A) (LOC469702), mRNA Length = 381 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||| |||| |||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgacagccttagtgcgctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| || || ||||| |||||||||| |||||||||| | || Sbjct: 302 aggcgcacggccgtctgcatttcgcgggacgtgatggtggagcgcttgttgtagtgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 242 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 182 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 129
>ref|XM_525085.1| PREDICTED: Pan troglodytes similar to histone 3, H2bb (LOC469701), mRNA Length = 399 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| |||||||| || || | Sbjct: 380 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccaggcagcagc 321 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | || ||||| |||||||||| |||||||||| | || Sbjct: 320 aggcgcacggccgtctgcacttcgcgggacgtgatggtggagcgcttgttgtagtgcgcc 261 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| |||||||||||| |||| |||||||||||||||| Sbjct: 260 aggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 201 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 200 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 147
>ref|XM_425468.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427894), mRNA Length = 381 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 302 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 242 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 182 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 129
>ref|XM_425462.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427888), mRNA Length = 381 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 302 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 242 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 182 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 129
>ref|XM_425457.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC427883), mRNA Length = 381 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 302 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 242 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 182 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 129
>ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, H2ac (LOC417955), mRNA Length = 1220 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 274 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 333 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 334 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 393 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 394 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 453 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 454 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 507
>ref|XM_391802.1| Gibberella zeae PH-1 H2B_NEUCR Histone H2B (FG11626.1) partial mRNA Length = 414 Score = 163 bits (82), Expect = 8e-37 Identities = 202/242 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||| ||||||||||||||||||||||| ||||| |||||||||| | Sbjct: 392 ttggtaacggccttggtaccctcggagacggcgtgcttggcaagctcaccggggaggatg 333 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 |||||||| |||||||| ||||| ||||| | |||||||| ||||||||||||| ||| Sbjct: 332 aggcggacagaggtctgaatctctcgggaagagatggtggacttcttgttgtaggcggca 273 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 ||||||| ||||| |||| |||||| |||||||||| ||| ||||||| |||| Sbjct: 272 agcttggaagcctcagaagcgacacgctcgaaaatgtcgttgacgaaagagttcaggatg 213 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 |||||||| | |||||| || |||||||||| |||||||| || |||||| ||||| Sbjct: 212 gacatggcacggttggagataccagtgtcggggtggacctgcttgaggaccttgtagatg 153 Query: 431 ta 432 || Sbjct: 152 ta 151
>ref|XM_787146.1| PREDICTED: Strongylocentrotus purpuratus similar to Histone H2B (LOC587419), mRNA Length = 372 Score = 163 bits (82), Expect = 8e-37 Identities = 214/258 (82%) Strand = Plus / Minus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 366 ggaggtggtgtatttggtgacggccttggtgccctcagagacggcgtgcttggccagctc 307 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||||||||| ||| | ||| | |||||||| ||| ||| ||||||||| | |||||| Sbjct: 306 tccggggaggaggagtctgacagcggtctggacctcacggctggtgatggtagacttctt 247 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 ||||||| |||| || || |||||| |||||| |||||||| ||||||| ||| Sbjct: 246 gttgtagtgggcaagacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaa 187 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 | |||||||||||||||||| | |||||| || |||||||||| ||||||||||| Sbjct: 186 gctgttcatgatggacatggcacggctggagataccagtgtcggggtggacctgcttcag 127 Query: 418 caccttgaagatgtagat 435 |||||| |||||||||| Sbjct: 126 aaccttgtagatgtagat 109
>ref|XM_789621.1| PREDICTED: Strongylocentrotus purpuratus similar to testis-specific histone 2b (LOC589998), mRNA Length = 372 Score = 163 bits (82), Expect = 8e-37 Identities = 214/258 (82%) Strand = Plus / Minus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| | |||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 366 ggaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctc 307 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||||||||| ||| ||||| | |||||||||||| ||| | ||||||||| |||||| Sbjct: 306 tccggggaggaggagacggacagcggtctggatctctcggctgctgatggtggccttctt 247 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 |||||||| || || || ||||| ||||||| |||||||| ||||||| ||| Sbjct: 246 gttgtagcctgcaaggcgggaagcctcaccggcgatacgctcgaagacatcgttgacgaa 187 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 | |||||||||||||||||||||| |||||| || |||||||||| || |||||||| Sbjct: 186 gctgttcatgatggacatggccttgctggagataccagtgtcggggtgaacttgcttcag 127 Query: 418 caccttgaagatgtagat 435 || ||| |||||||||| Sbjct: 126 aactttgtagatgtagat 109
>emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B sequence Length = 1113 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 983 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 924 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 923 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 864 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 863 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 804 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 803 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 750
>emb|X05100.1|GGH2B7 Chicken histone H2B gene (pPP2d-4.0) Length = 374 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 256 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 197 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 196 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 137 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 136 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 77 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 76 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 23
>gb|M57901.1|CHKH2BB Chicken histone H2B gene, complete cds Length = 1298 Score = 163 bits (82), Expect = 8e-37 Identities = 196/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 784 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 725 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 724 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 665 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 664 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 605 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 604 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 551
>gb|BC095697.1| Danio rerio zgc:112234, mRNA (cDNA clone MGC:112234 IMAGE:7223605), complete cds Length = 1265 Score = 161 bits (81), Expect = 3e-36 Identities = 198/237 (83%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| ||||||||||||||||||| |||||||| |||||||| ||||| ||||| ||||| Sbjct: 395 ggtgtatttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccggg 336 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | || || |||| |||||||||||| | |||||||||||||| ||||||||| Sbjct: 335 cagcagcagccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgta 276 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | ||||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 275 gtgggcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 216 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||| |||||||||||||||||||||| |||| || || |||||||||||||| Sbjct: 215 catgatgcccatggccttggaggagatgccggtgtcaggatggacctgcttcagcac 159
>ref|NM_001024398.1| Danio rerio zgc:112234 (zgc:112234), mRNA Length = 1265 Score = 161 bits (81), Expect = 3e-36 Identities = 198/237 (83%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| ||||||||||||||||||| |||||||| |||||||| ||||| ||||| ||||| Sbjct: 395 ggtgtatttggtgacggccttggtaccctcggacacggcgtgtttggccagctctccggg 336 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | || || |||| |||||||||||| | |||||||||||||| ||||||||| Sbjct: 335 cagcagcagccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgta 276 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | ||||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 275 gtgggcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 216 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||| |||||||||||||||||||||| |||| || || |||||||||||||| Sbjct: 215 catgatgcccatggccttggaggagatgccggtgtcaggatggacctgcttcagcac 159
>emb|X05094.1|GGH2B1 Chicken histone H2B gene (pKR1a-1.3) Length = 1467 Score = 157 bits (79), Expect = 5e-35 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 1181 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 1122 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| ||||||||||||| || |||||||| | |||||||||| | || Sbjct: 1121 agccgcacggccntctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 1062 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 1061 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 1002 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 1001 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 948
>dbj|AP006674.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT30L06, TM0369c, complete sequence Length = 68065 Score = 157 bits (79), Expect = 5e-35 Identities = 127/143 (88%) Strand = Plus / Minus Query: 329 gcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggag 388 |||||||||||||||||||| ||||||||| ||||||||| |||||||||| |||| Sbjct: 64320 gcgagcttctcgaagatgtcattgatgaagctgttcatgatccccatggccttgctggag 64261 Query: 389 atgccgatgtcggggtgcacctgcttcagcaccttgaagatgtagatcttgtacgtctcc 448 || |||||||| ||||| ||||||||||||||||||||||||||||||||||| || ||| Sbjct: 64260 attccgatgtcagggtgaacctgcttcagcaccttgaagatgtagatcttgtaagtttcc 64201 Query: 449 acgctcttcttggacttcttctt 471 ||| ||||||| ||| ||||||| Sbjct: 64200 acgttcttcttcgacctcttctt 64178 Score = 79.8 bits (40), Expect = 9e-12 Identities = 97/116 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| || ||||||||||| || || || ||||||||||| |||||||||||||| || Sbjct: 64458 ttggtaaccgccttggtgccttcagacacagcgtgcttggcaagctcgccggggagaacc 64399 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcg 306 | | |||| |||||| ||||||| |||||| || || ||||||||||||||||| Sbjct: 64398 aatctcacggcggtctgaatctccctggaggtaatcgtcggcttcttgttgtagcg 64343
>gb|J00865.1|CHKH2B Chicken histone H2B gene and flanks Length = 766 Score = 157 bits (79), Expect = 5e-35 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 483 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 424 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| ||||||||||||| || |||||||| | |||||||||| | || Sbjct: 423 agccgcacggccntctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 364 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 363 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 304 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 303 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 250
>ref|XM_527280.1| PREDICTED: Pan troglodytes similar to ribosomal protein L24-like; homolog of yeast ribosomal like protein 24; 60S ribosomal protein L30 isolog; my024 protein (LOC471902), mRNA Length = 1131 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 362 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccggaagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| |||||||||||||| |||||||||||| | |||||||||| | || Sbjct: 302 aggcgcacggcggtctggatctccctggaggtgatggtcgagcgcttgttgtagtgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||| ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 242 aggcgggaagcctcgcttgcgaggcgctcgaagatgtcgttgacgaaggagttcatgatt 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 ||||||||| || ||||||||| |||||||||| |||||||||||||||||| Sbjct: 182 cccatggccttagaagagatgccggtgtcggggtggacctgcttcagcaccttg 129
>ref|XM_416197.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC417957), mRNA Length = 833 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 569 ttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagc 510 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 509 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 450 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 449 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 390 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 389 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 336
>ref|XM_416196.1| PREDICTED: Gallus gallus similar to H2B histone family, member F (LOC417956), mRNA Length = 841 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 569 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 510 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 509 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 450 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| || |||||||||||| Sbjct: 449 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacaaacgagttcatgatg 390 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 389 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 336
>ref|XM_539321.2| PREDICTED: Canis familiaris similar to histone 3, H2ba (LOC482202), mRNA Length = 459 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| || ||||||||||| ||||||||||| || | Sbjct: 377 ttggtgacggccttggtgccctcggacaccgcgtgcttggccagctcgccgggcagcagc 318 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| | || Sbjct: 317 aggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgtaatgcgcc 258 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| ||||| ||| ||||||||||||| ||| |||||||||||| Sbjct: 257 aggcgggaggcctcgctggcgatgcgctcaaagatgtcgttgacgaacgagttcatgatg 198 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||| ||||||||||||||||||||||||||||| Sbjct: 197 cccatggccttggacgagatgccggtgtcggggtgcacctgcttcagcaccttg 144
>ref|NM_001031481.1| Gallus gallus histone H2B (LOC427886), mRNA Length = 381 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 302 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 242 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 182 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 129
>emb|V00415.1|GGHI02 Gallus gallus gene coding for histone H2b Length = 842 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||| ||||||||||| ||||||||||| ||||||||||| || | Sbjct: 556 ttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccgggcagcagc 497 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 496 agccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 437 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 436 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 377 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 376 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 323
>emb|X05098.1|GGH2B5 Chicken histone H2B gene (pBBA-3.0) Length = 705 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||| ||||||||||| ||||||||||| ||||||||||| || | Sbjct: 587 ttggtgaccgccttggtaccctcggagaccgcgtgcttggccagctcgccgggcagcagc 528 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 527 agccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 468 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 467 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 408 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 407 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 354
>emb|X05096.1|GGH2B3 Chicken histone H2B gene (pRR3c-3.5) Length = 705 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 587 ttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagc 528 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 527 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 468 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 467 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 408 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 407 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 354
>emb|X05095.1|GGH2B2 Chicken histone H2B gene (pRR2e-3.5) Length = 705 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 587 ttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagc 528 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 527 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 468 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 467 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 408 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 407 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 354
>dbj|D70896.1| Gallus gallus DNA for histone H2B, complete cds Length = 562 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 461 ttggtgaccgccttggtgccctcagagaccgcgtgcttggccagctcgccgggcagcagc 402 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 401 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 342 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 341 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 282 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 281 cccatggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 228
>ref|XM_693375.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573776), mRNA Length = 405 Score = 153 bits (77), Expect = 7e-34 Identities = 197/237 (83%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||| ||||||||||| ||||||||||| |||||||| ||||| ||||| ||||| Sbjct: 363 ggtgtatttagtgacggccttagtgccctcggacacggcgtgtttggccagctctccggg 304 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | || || |||| |||||||||||| | |||||||||||||| ||||||||| Sbjct: 303 cagcagcagccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgta 244 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | ||||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 243 gtgggcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 184 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||||||| |||||||||||||||||||||| |||| || || |||||||||||||| Sbjct: 183 catgatgcccatggccttggaggagatgccggtgtcaggatggacctgcttcagcac 127
>emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B sequence Length = 1017 Score = 151 bits (76), Expect = 3e-33 Identities = 193/232 (83%) Strand = Plus / Minus Query: 193 ggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgag 252 |||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | || Sbjct: 1017 ggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagcag 958 Query: 253 gcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcgag 312 || |||| |||||||||||||| || |||||||| | |||||||||| | || || Sbjct: 957 ccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgccag 898 Query: 313 cttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatgga 372 | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 897 gcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatgcc 838 Query: 373 catggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 837 catggccttggacgagatgcccgtgtcggggtgcacctgcttcagcaccttg 786
>ref|XM_686839.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC573293), mRNA Length = 501 Score = 151 bits (76), Expect = 3e-33 Identities = 196/236 (83%) Strand = Plus / Minus Query: 189 atttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggagga 248 |||| |||||||||||||| |||||||| |||||||| ||||| ||||| ||||| || | Sbjct: 358 atttagtgacggccttggtaccctcggacacggcgtgtttggccagctctccgggcagca 299 Query: 249 cgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcggg 308 || || |||| |||||||||||| | |||||||||||||| |||||||||| ||| Sbjct: 298 gcagccgcacggcggtctggatctctctggaggtgatggtggagcgcttgttgtagtggg 239 Query: 309 cgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatga 368 |||| | ||||| ||||||| ||||||||||||||||| ||| |||||||||| Sbjct: 238 cgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatga 179 Query: 369 tggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 || |||||||||||||||||||||| |||| || || ||||||||||| |||||| Sbjct: 178 tgcccatggccttggaggagatgccggtgtcaggatgaacctgcttcagaaccttg 123
>gb|BC101411.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125414 IMAGE:40021691), complete cds Length = 432 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 362 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 182 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 129
>gb|BC101413.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125416 IMAGE:40021695), complete cds Length = 431 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 362 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 182 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 129
>gb|BC101412.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:125415 IMAGE:40021693), complete cds Length = 431 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 362 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 182 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 129
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 55429 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 55488 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 55489 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 55548 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 55549 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 55608 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 55609 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 55662 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||||||||||||||| ||||||||| || ||||||||| | Sbjct: 86761 ctcgaagatgtcgttgacgaaggagttcatgattcccatggccttagaagagatgccggt 86702 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 86701 gtcggggtggacctgcttcagcaccttg 86674 Score = 103 bits (52), Expect = 6e-19 Identities = 76/84 (90%) Strand = Plus / Plus Query: 341 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 400 ||||||||||||| ||||||||||||||| ||| |||||||| ||||||||| ||||| Sbjct: 79197 aagatgtcgttgacgaaggagttcatgattcccatagccttggaagagatgccggtgtcg 79256 Query: 401 gggtgcacctgcttcagcaccttg 424 ||||| |||||||||||||||||| Sbjct: 79257 gggtggacctgcttcagcaccttg 79280 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 628 ttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccgggcagcagc 687 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 688 aggcgcacggccgtctggatctccctggaggtgatggt 725 Score = 95.6 bits (48), Expect = 2e-16 Identities = 75/84 (89%) Strand = Plus / Plus Query: 341 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 400 |||||||| |||| |||||||||||||||| ||||||||| || ||||||||| ||||| Sbjct: 778 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 837 Query: 401 gggtgcacctgcttcagcaccttg 424 ||||| || ||||||||||||||| Sbjct: 838 gggtggacttgcttcagcaccttg 861 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 86907 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccccggaagcagc 86848 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| |||||||||||||| |||||||||||| Sbjct: 86847 aggcgcacggcggtctggatctccctggaggtgatggt 86810 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| | || ||||| || | Sbjct: 79047 ttggtgacggccttggtgccctcggacacggcgtgcttggccaattccccgggtagcagt 79106 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| || |||||||| Sbjct: 79107 aggcgcacggccgtctggatctccctcgaagtgatggt 79144 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 263 gtctggatctcccgggaggtgatggt 288 ||||||||||||| |||||||||||| Sbjct: 30318 gtctggatctccctggaggtgatggt 30293
>ref|NM_003520.3| Homo sapiens histone 1, H2bn (HIST1H2BN), mRNA Length = 449 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 362 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 182 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 129
>gb|BC011372.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone IMAGE:3871305), with apparent retained intron Length = 2200 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 423 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 364 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 363 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 304 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 303 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 244 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 243 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 190
>gb|AF531297.1| Homo sapiens histone H2B (HIST1H2BN) gene, complete cds Length = 1137 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 742 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 683 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 682 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 623 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 622 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 563 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 562 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 509
>gb|BC009783.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:13513 IMAGE:4132165), complete cds Length = 744 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 484 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 425 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 424 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 365 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 364 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 305 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 304 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 251
>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3 Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ, H2AFN, and H2BFN histone genes, the OR2B2 gene for olfactory receptor 2B2, histone H2B family member I pseudogene H2BFIP, a hypothetical protein pseudogene, ESTs, STSs, GSSs and CpG islands, complete sequence Length = 100374 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 2764 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 2705 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 2704 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 2645 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 2644 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 2585 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 2584 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 2531 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 57565 ttggtgacggcctttgtgccctcggacacggcgtgcttggccagctccccgggcagcagc 57506 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 57505 aggcgcacggccgtctggatctccctggaggtgatggt 57468 Score = 95.6 bits (48), Expect = 2e-16 Identities = 75/84 (89%) Strand = Plus / Minus Query: 341 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 400 |||||||| |||| |||||||||||||||| ||||||||| || ||||||||| ||||| Sbjct: 57415 aagatgtcattgacgaaggagttcatgatgcccatggccttcgatgagatgccggtgtcg 57356 Query: 401 gggtgcacctgcttcagcaccttg 424 ||||| || ||||||||||||||| Sbjct: 57355 gggtggacttgcttcagcaccttg 57332 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Plus Query: 263 gtctggatctcccgggaggtgatggt 288 ||||||||||||| |||||||||||| Sbjct: 27875 gtctggatctccctggaggtgatggt 27900
>emb|Z83336.1|HSZ83336 H.sapiens hH2B/d gene Length = 701 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 592 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 533 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 532 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 473 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 472 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 413 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 412 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 359
>emb|X06640.1|SPH2BL1 Strongylocentrotus purpuratus late histone gene L1 H2b Length = 1497 Score = 147 bits (74), Expect = 5e-32 Identities = 212/258 (82%) Strand = Plus / Minus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| | |||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 1358 ggaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctc 1299 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||||||||| ||| | |||| |||||||| ||| || ||||||||||| |||||| Sbjct: 1298 tccggggaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttctt 1239 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 ||||||| |||| || || |||||| |||||| |||||||| ||||||| ||| Sbjct: 1238 gttgtagtgggcaagacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaa 1179 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 |||||||||||||||||| | ||||||||| |||| ||||| ||||||||||| Sbjct: 1178 actgttcatgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcag 1119 Query: 418 caccttgaagatgtagat 435 ||||||| |||||||||| Sbjct: 1118 caccttgtagatgtagat 1101
>ref|NM_214552.1| Strongylocentrotus purpuratus late histone L1 H2b (LOC373347), mRNA Length = 372 Score = 147 bits (74), Expect = 5e-32 Identities = 212/258 (82%) Strand = Plus / Minus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| | |||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 366 ggaggtggtgtacttggtgacagccttggtgccctcagagacggcgtgcttggccagctc 307 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||||||||| ||| | |||| |||||||| ||| || ||||||||||| |||||| Sbjct: 306 tccggggaggaggagtctgacgacggtctggacctcacgactggtgatggtggacttctt 247 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 ||||||| |||| || || |||||| |||||| |||||||| ||||||| ||| Sbjct: 246 gttgtagtgggcaagacgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaa 187 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 |||||||||||||||||| | ||||||||| |||| ||||| ||||||||||| Sbjct: 186 actgttcatgatggacatggcacggctggagatgccagtgtcagggtgaacctgcttcag 127 Query: 418 caccttgaagatgtagat 435 ||||||| |||||||||| Sbjct: 126 caccttgtagatgtagat 109
>emb|X05099.1|GGH2B6 Chicken histone H2B gene (pBRA-5.4) Length = 705 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 587 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 528 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 527 agccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 468 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 467 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 408 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || || |||||||| ||||||||||||||||||||||||||||| Sbjct: 407 ctcatggctttagatgagatgcccgtgtcggggtgcacctgcttcagcaccttg 354
>emb|X05097.1|GGH2B4 Chicken histone H2B gene (pPP2d-2.3) Length = 705 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||| ||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 587 ttggtgaccgccttggtaccctccgagaccgcgtgcttggccagctcgccgggcagcagc 528 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 527 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 468 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 467 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 408 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 407 cccatggccttggatgagatgcccgtgtcggggtgcacctgcttcagcaccttg 354
>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 Length = 1723 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| || || || | Sbjct: 1264 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctcccctggcagcagc 1205 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 1204 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 1145 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| |||||||||||| |||| |||||||||||||||| Sbjct: 1144 aggcgggaagcctcgccggcgatgcgctcgaagatgtcattgacgaaggagttcatgatg 1085 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||| |||||||||| |||||||||||||||||| Sbjct: 1084 cccatggccttggacgagataccggtgtcggggtggacctgcttcagcaccttg 1031
>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds Length = 2297 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||||||||| ||||||||||| ||||||||||| || | Sbjct: 1428 ttggtgaccgccttggtgccctcggagaccgcgtgcttggccagctcgccgggcagcagc 1369 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 1368 agccgcacggccgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 1309 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 1308 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 1249 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || || |||||||| ||||||||||||||||||||||||||||| Sbjct: 1248 ctcatggctttagatgagatgcccgtgtcggggtgcacctgcttcagcaccttg 1195
>gb|J00864.1|CHKH2A2B Chicken histone H2A/H2B gene pair and flanks Length = 1564 Score = 147 bits (74), Expect = 5e-32 Identities = 194/234 (82%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| || | Sbjct: 1350 ttggtgaccgccttggtgccctccgagaccgcgtgcttggccagctcgccgggcagcagc 1291 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| || |||||||| | |||||||||| | || Sbjct: 1290 agccgcacggctgtctggatctcccgcgacgtgatggtcgagcgcttgttgtagtgcgcc 1231 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||||||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 1230 aggcgcgacgcctcgccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 1171 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||||||||| |||||||| |||||||||||| |||||||||||||||| Sbjct: 1170 cccatggccttggacgagatgcccgtgtcggggtgcagctgcttcagcaccttg 1117
>emb|BX088700.1|CNS09S4S DNA centromeric region sequence from BAC DP26B06, DP34F04, DP16D11, DP09G08, DP35C12 of chromosome 5 of Podospora anserina Length = 322194 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||| || || |||||||||||||| ||||||||||| |||| | Sbjct: 23468 ttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaaggatg 23409 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||| ||| Sbjct: 23408 aggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtaggcggca 23349 Query: 311 agcttgg 317 ||||||| Sbjct: 23348 agcttgg 23342
>emb|AL590462.1|CNS07EGJ DNA centromeric region sequence BAC 34F04 of chromosome 5 of Podospora anserina Length = 103568 Score = 141 bits (71), Expect = 3e-30 Identities = 113/127 (88%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||| || || |||||||||||||| ||||||||||| |||| | Sbjct: 81643 ttggtgacggccttggtgccttcagacacggcgtgcttggcaagctcgccgggaaggatg 81702 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| ||||||||||||||||| ||||| | |||||||| ||||||||||||| ||| Sbjct: 81703 aggcgcacggaggtctggatctcacgggatgagatggtggacttcttgttgtaggcggca 81762 Query: 311 agcttgg 317 ||||||| Sbjct: 81763 agcttgg 81769
>dbj|AB124798.1| Rhacophorus schlegelii histh2b mRNA for histone H2B, complete cds Length = 425 Score = 135 bits (68), Expect = 2e-28 Identities = 92/100 (92%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacggctttggtgccctcggagacggcgtgcttggccagctctccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 |||||||||| ||||||||||||||||||||||||||||| Sbjct: 302 aggcggacggcggtctggatctcccgggaggtgatggtgg 263 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgctcatggccttggaggagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||| ||||||||| Sbjct: 156 gtcggggtggacctgcttgagcaccttg 129
>emb|X06642.1|SPH2BAL3 Strongylocentrotus purpuratus late histone genes L3 H2b - H2a Length = 1980 Score = 133 bits (67), Expect = 7e-28 Identities = 210/258 (81%) Strand = Plus / Plus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| | |||||||| |||||||||||||| |||||||| |||||||| ||||| Sbjct: 280 ggaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctc 339 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||| ||||| ||| | ||| | |||||||| ||| || ||||||||||| |||||| Sbjct: 340 tccggngaggaggagtctgacagcggtctggacctcacgactggtgatggtggacttctt 399 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 ||||||| |||| || || |||||| |||||| |||||||| ||||||| ||| Sbjct: 400 gttgtagtgggcaaggcgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaa 459 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 | |||||||||||||||||| | |||||| || |||||||||| ||||||||||| Sbjct: 460 gctgttcatgatggacatggcacggctggagataccagtgtcggggtgaacctgcttcag 519 Query: 418 caccttgaagatgtagat 435 |||||| |||||||||| Sbjct: 520 aaccttgtagatgtagat 537
>ref|NM_214554.1| Strongylocentrotus purpuratus late histone L3 H2b (LOC373349), mRNA Length = 372 Score = 133 bits (67), Expect = 7e-28 Identities = 210/258 (81%) Strand = Plus / Minus Query: 178 ggaggaggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctc 237 ||||| |||| | |||||||| |||||||||||||| |||||||| |||||||| ||||| Sbjct: 366 ggaggtggtgtacttggtgacagccttggtgccctcagagacggcatgcttggccagctc 307 Query: 238 gccggggaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttctt 297 |||| ||||| ||| | ||| | |||||||| ||| || ||||||||||| |||||| Sbjct: 306 tccggngaggaggagtctgacagcggtctggacctcacgactggtgatggtggacttctt 247 Query: 298 gttgtagcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaa 357 ||||||| |||| || || |||||| |||||| |||||||| ||||||| ||| Sbjct: 246 gttgtagtgggcaaggcgggaagcctcggcggcgatgcgctcgaagacatcgttgacgaa 187 Query: 358 ggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcag 417 | |||||||||||||||||| | |||||| || |||||||||| ||||||||||| Sbjct: 186 gctgttcatgatggacatggcacggctggagataccagtgtcggggtgaacctgcttcag 127 Query: 418 caccttgaagatgtagat 435 |||||| |||||||||| Sbjct: 126 aaccttgtagatgtagat 109
>gb|BC107301.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MGC:130255 IMAGE:40053183), complete cds Length = 465 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 452 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 393 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 392 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 333 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 332 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 273 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 272 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 213 Query: 424 g 424 | Sbjct: 212 g 212
>gb|BC107302.1| Mus musculus histone 3, H2bb, mRNA (cDNA clone MGC:130256 IMAGE:40053184), complete cds Length = 466 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 453 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 394 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 393 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 334 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 333 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 274 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 273 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 214 Query: 424 g 424 | Sbjct: 213 g 213
>gb|BC051921.1| Mus musculus histone 3, H2ba, mRNA (cDNA clone MGC:62161 IMAGE:5684450), complete cds Length = 632 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 389 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 330 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 329 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 270 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 269 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 210 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 209 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 150 Query: 424 g 424 | Sbjct: 149 g 149
>ref|XM_504425.1| Yarrowia lipolytica CLIB122, YALI0E26455g predicted mRNA Length = 420 Score = 129 bits (65), Expect = 1e-26 Identities = 176/213 (82%) Strand = Plus / Minus Query: 220 ggcgtgcttggcgagctcgccggggaggacgaggcggacggaggtctggatctcccggga 279 |||||||||||||||||| |||||||| | ||| ||||| | |||||||||||| || || Sbjct: 369 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 310 Query: 280 ggtgatggtgggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctc 339 |||||||||| ||||||| ||||| ||| ||||||| ||||||| ||||| ||| Sbjct: 309 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 250 Query: 340 gaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 399 ||||||||||||| |||||||||||||| |||||||| || |||||| || |||| Sbjct: 249 aaagatgtcgttgacaaaggagttcatgatagacatggctcgggtggagataccagtgtc 190 Query: 400 ggggtgcacctgcttcagcaccttgaagatgta 432 ||||| |||||||||||||||| ||||||| Sbjct: 189 agggtgggtctgcttcagcaccttgtagatgta 157
>dbj|AK018765.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500011O09 product:HISTONE H2B, full insert sequence Length = 623 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 399 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 340 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 339 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 280 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 279 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 220 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 219 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 160 Query: 424 g 424 | Sbjct: 159 g 159
>ref|NM_030082.1| Mus musculus histone 3, H2ba (Hist3h2ba), mRNA Length = 623 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 399 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 340 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 339 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 280 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 279 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 220 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 219 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 160 Query: 424 g 424 | Sbjct: 159 g 159
>gb|AY158942.1| Mus musculus histone protein Hist3h2ba gene, complete cds Length = 1620 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 898 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 839 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 838 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 779 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 778 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 719 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 718 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 659 Query: 424 g 424 | Sbjct: 658 g 658
>emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chromosome 11, complete sequence Length = 103129 Score = 129 bits (65), Expect = 1e-26 Identities = 197/241 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| ||||| |||||||| ||||| ||||| Sbjct: 33780 ggtgtatttggtgactgccttggtgccctcggacacggcatgcttggccagctccccggg 33721 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 33720 cagcagcaggcgcacggccgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 33661 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 33660 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 33601 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| |||||||||||| ||||||||| |||| || |||||||||||||||||||| Sbjct: 33600 catgatgcccatggccttggacgagatgccggtgtccggatgcacctgcttcagcacctt 33541 Query: 424 g 424 | Sbjct: 33540 g 33540 Score = 113 bits (57), Expect = 6e-22 Identities = 195/241 (80%) Strand = Plus / Plus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||||||||| ||||||||||||||||| || || |||||||| ||||| ||||| Sbjct: 38532 ggtgtatttggtgactgccttggtgccctcggacacagcatgcttggccagctccccggg 38591 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | ||||| |||| ||||| | ||| ||||| |||||||| | ||||||||| Sbjct: 38592 cagcagcaggcgcacggctgtctgcacctcgcgggacgtgatggtcgagcgcttgttgta 38651 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | || || || |||||||| ||||| |||||||||||| |||| ||| ||||| Sbjct: 38652 atgcgccaggcgggaggcctcgctggcgatgcgctcgaagatgtcattgacgaacgagtt 38711 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| ||||||||| || ||||||||| |||| || |||||||||||||||||||| Sbjct: 38712 catgatgcccatggccttagacgagatgccggtgtccggatgcacctgcttcagcacctt 38771 Query: 424 g 424 | Sbjct: 38772 g 38772
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 129 bits (65), Expect = 1e-26 Identities = 176/213 (82%) Strand = Plus / Plus Query: 220 ggcgtgcttggcgagctcgccggggaggacgaggcggacggaggtctggatctcccggga 279 |||||||||||||||||| |||||||| | ||| ||||| | |||||||||||| || || Sbjct: 3141902 ggcgtgcttggcgagctcaccggggagaatgagtcggacagcggtctggatctctcgaga 3141961 Query: 280 ggtgatggtgggcttcttgttgtagcgggcgagcttggcggcctcgccggcgagcttctc 339 |||||||||| ||||||| ||||| ||| ||||||| ||||||| ||||| ||| Sbjct: 3141962 agtgatggtggacttcttggtgtaggtggccagcttggaggcctcggtggcgactcgctc 3142021 Query: 340 gaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtc 399 ||||||||||||| |||||||||||||| |||||||| || |||||| || |||| Sbjct: 3142022 aaagatgtcgttgacaaaggagttcatgatagacatggctcgggtggagataccagtgtc 3142081 Query: 400 ggggtgcacctgcttcagcaccttgaagatgta 432 ||||| |||||||||||||||| ||||||| Sbjct: 3142082 agggtgggtctgcttcagcaccttgtagatgta 3142114
>gb|DQ215263.1| Taeniopygia guttata clone 0058P0013D11 histone 1 H2be -like mRNA, complete sequence Length = 838 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| |||||||| | Sbjct: 263 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgcccgt 204 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 203 gtcggggtgcacctgcttcagcaccttg 176 Score = 111 bits (56), Expect = 3e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 409 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 350 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| |||||||||||||| ||||||||||||| Sbjct: 349 aggcgcacggccgtctggatctcccgcgaggtgatggtgg 310
>gb|BC107084.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129733 IMAGE:40014260), complete cds Length = 459 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 217 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 158 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 157 gtcggggtggacctgcttcagcaccttg 130 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 363 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 304 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 303 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 264
>gb|BC107085.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:129734 IMAGE:40014264), complete cds Length = 459 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 217 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 158 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 157 gtcggggtggacctgcttcagcaccttg 130 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 363 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 304 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 303 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 264
>ref|XM_524860.1| PREDICTED: Pan troglodytes LOC469477 (LOC469477), mRNA Length = 1068 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 97.6 bits (49), Expect = 4e-17 Identities = 89/101 (88%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 191 ttggtgacg-gccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggac 249 ||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 363 ttggtgacgcgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcag 304 Query: 250 gaggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 303 caggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>ref|XM_513763.1| PREDICTED: Pan troglodytes LOC457260 (LOC457260), mRNA Length = 753 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 231 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 172 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 171 gtcggggtggacctgcttcagcaccttg 144 Score = 111 bits (56), Expect = 3e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 377 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 318 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| |||||||||||||||| Sbjct: 317 aggcgcacggccgtctggatctcgcgggaggtgatggtgg 278
>gb|BC069193.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:78419 IMAGE:3936695), complete cds Length = 2224 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 181 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 180 gtcggggtggacctgcttcagcaccttg 153 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 386 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 327 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 326 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 287
>gb|BC005827.2| Homo sapiens histone 2, H2be, mRNA (cDNA clone IMAGE:2989788), with apparent retained intron Length = 2210 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 228 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 169 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 168 gtcggggtggacctgcttcagcaccttg 141 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 374 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 315 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 314 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 275
>ref|NM_003528.2| Homo sapiens histone 2, H2be (HIST2H2BE), mRNA Length = 2223 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 404 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 345 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 344 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 305
>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of IgG, high affinity Ia, receptor for (CD64), a novel gene similar to histone 2, H2be (HIST2H2BE), a novel gene similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for histone 2, H4, the HIST2H3C gene for histone 2, H3c, the HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene (HIST2H2BC), a novel gene similar to histone 2, H2aa (HIST2H2AA), a novel gene similar to histone 2, H3c (HIST2H3C), a novel gene similar to histone 1, H4 (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for histone 2, H2ab, a novel protein similar to histone 2, a novel gene, the SV2A gene for synaptic vesicle glycoprotein 2A, the 3' end of the SF3B4 gene for splicing factor 3b, subunit 4, 49kDa and five CpG islands, complete sequence Length = 188956 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 148135 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 148194 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 148195 gtcggggtggacctgcttcagcaccttg 148222 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 73823 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 73882 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 73883 gtcggggtggacctgcttcagcaccttg 73910 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 147989 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 148048 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 148049 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 148088 Score = 103 bits (52), Expect = 6e-19 Identities = 79/88 (89%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||| | |||||||| | Sbjct: 112285 ctcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggt 112344 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| ||| |||||||||||||| Sbjct: 112345 gtcggggtggacccgcttcagcaccttg 112372 Score = 103 bits (52), Expect = 6e-19 Identities = 79/88 (89%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||| | |||||||| | Sbjct: 104981 ctcgaagatgtcgttgaggaaggagttcatgatgcccatggccttgcaccagatgccggt 104922 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| ||| |||||||||||||| Sbjct: 104921 gtcggggtggacccgcttcagcaccttg 104894 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 73677 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 73736 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 73737 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 73776 Score = 95.6 bits (48), Expect = 2e-16 Identities = 88/100 (88%), Gaps = 1/100 (1%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 112140 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 112199 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| |||||||||| |||||| |||||||||| Sbjct: 112200 aggcgcacggccgtctggatct-ccgggacgtgatggtgg 112238 Score = 95.6 bits (48), Expect = 2e-16 Identities = 88/100 (88%), Gaps = 1/100 (1%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 105126 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 105067 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| |||||||||| |||||| |||||||||| Sbjct: 105066 aggcgcacggccgtctggatct-ccgggacgtgatggtgg 105028
>emb|X57985.1|HSHIST H.sapiens genes for histones H2B.1 and H2A Length = 2964 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 716 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 657 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 656 gtcggggtggacctgcttcagcaccttg 629 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 862 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 803 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 802 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 763
>emb|CR541895.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0933D for gene HIST2H2BE, histone 2, H2be; complete cds, incl. stopcodon Length = 381 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 302 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>gb|BC096121.1| Homo sapiens histone 2, H2be, mRNA (cDNA clone MGC:116767 IMAGE:40002353), complete cds Length = 430 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 302 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>emb|CR858221.1| Pongo pygmaeus mRNA; cDNA DKFZp469C0528 (from clone DKFZp469C0528) Length = 2237 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 404 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 345 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 344 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 305
>dbj|AK093747.1| Homo sapiens cDNA FLJ36428 fis, clone THYMU2011564, highly similar to HISTONE H2B GL105 Length = 2181 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 258 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 199 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 198 gtcggggtggacctgcttcagcaccttg 171 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggc 222 |||||||| ||||||||||||||||| ||||| Sbjct: 365 ttggtgaccgccttggtgccctcggacacggc 334 Score = 40.1 bits (20), Expect = 7.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 263 gtctggatctcccgggaggtgatggtgg 290 ||||||||||| ||||| |||||||||| Sbjct: 332 gtctggatctcgcgggatgtgatggtgg 305
>ref|XM_684372.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC560974), mRNA Length = 414 Score = 127 bits (64), Expect = 4e-26 Identities = 205/252 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||| ||||| |||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 402 ggtgtatttagtgacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 343 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 342 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 283 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 282 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 223 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| ||| |||||||||||||| ||| ||||||| || |||||||||| |||||| Sbjct: 222 catgatgcccatcgccttggaggagataccggtgtcgggatgaacctgcttcaacacctt 163 Query: 424 gaagatgtagat 435 | ||| |||||| Sbjct: 162 gtagacgtagat 151
>ref|XM_686687.1| PREDICTED: Danio rerio similar to histone 2, H2, like (LOC563318), mRNA Length = 423 Score = 127 bits (64), Expect = 4e-26 Identities = 205/252 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| ||||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 411 ggtgtatttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 352 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 351 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 292 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 291 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 232 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| ||| |||||||||||||| ||| ||||||| || |||||||||| |||||| Sbjct: 231 catgatgcccatcgccttggaggagatcccggtgtcgggatgaacctgcttcaacacctt 172 Query: 424 gaagatgtagat 435 | ||| |||||| Sbjct: 171 gtagacgtagat 160
>ref|NG_002618.1| Homo sapiens histone 3, H2ba (HIST3H2BA) pseudogene on chromosome 1 Length = 1140 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 597 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 538 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 537 gtcggggtgcacctgcttcagcaccttg 510 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 744 ttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 692
>gb|AY131979.1| Homo sapiens histone H2B (HIST2H2BE) gene, complete cds Length = 1137 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 596 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 537 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 536 gtcggggtggacctgcttcagcaccttg 509 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 742 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 683 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 682 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 643
>gb|AY131980.1| Homo sapiens histone H2B (HIST3H2BA) pseudogene, complete sequence Length = 1140 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 597 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 538 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 537 gtcggggtgcacctgcttcagcaccttg 510 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 744 ttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 692
>gb|AY893641.1| Synthetic construct Homo sapiens clone FLH130870.01X histone 2 H2be (HIST2H2BE) mRNA, complete cds Length = 381 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 302 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>emb|AJ329611.1|HSA329611 Homo sapiens genomic sequence surrounding NotI site, clone NR1-RI11C Length = 652 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 342 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 283 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 282 gtcggggtgcacctgcttcagcaccttg 255 Score = 54.0 bits (27), Expect = 5e-04 Identities = 48/54 (88%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgc-ttggcgagctcgccggg 243 |||||||| ||||| ||||||||| | ||||||||| ||||| ||||||||||| Sbjct: 490 ttggtgacagccttagtgccctcgnacacggcgtgctttggccagctcgccggg 437
>gb|BC098289.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119804 IMAGE:40014249), complete cds Length = 456 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 302 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>gb|BC098112.1| Homo sapiens histone 1, H2bn, mRNA (cDNA clone MGC:119802 IMAGE:40014245), complete cds Length = 458 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 156 gtcggggtggacctgcttcagcaccttg 129 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 362 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 302 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 263
>ref|NM_001024599.2| Homo sapiens histone 2, H2bf (HIST2H2BF), mRNA Length = 1858 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 249 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 190 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 189 gtcggggtggacctgcttcagcaccttg 162 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 395 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 336 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 335 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 296
>gb|BC110793.1| Homo sapiens histone 2, H2bf, mRNA (cDNA clone MGC:131639 IMAGE:5224812), complete cds Length = 1858 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 249 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 190 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 189 gtcggggtggacctgcttcagcaccttg 162 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 395 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 336 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 335 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 296
>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25, complete sequence Length = 167326 Score = 127 bits (64), Expect = 4e-26 Identities = 205/252 (81%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| |||| ||||| |||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 67918 ggtgtatttagtgacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 67859 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgta 303 || | || || |||| |||||||||||| | ||| |||||||||| ||||||||| Sbjct: 67858 cagcagcagacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgta 67799 Query: 304 gcgggcgagcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagtt 363 | | ||||| | ||||| ||||||| ||||||||||||||||| ||| ||||| Sbjct: 67798 gtgagcgagacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagtt 67739 Query: 364 catgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcacctt 423 ||||||| ||| |||||||||||||| ||| ||||||| || |||||||||| |||||| Sbjct: 67738 catgatgcccatcgccttggaggagataccggtgtcgggatgaacctgcttcaacacctt 67679 Query: 424 gaagatgtagat 435 | ||| |||||| Sbjct: 67678 gtagacgtagat 67667 Score = 123 bits (62), Expect = 7e-25 Identities = 188/230 (81%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 107395 ttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 107454 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||| Sbjct: 107455 agacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcg 107514 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 107515 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 107574 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||| |||||||||||||| || ||||||| || |||||||||||||| Sbjct: 107575 cccatcgccttggaggagataccagtgtcgggatggacctgcttcagcac 107624 Score = 113 bits (57), Expect = 6e-22 Identities = 198/245 (80%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 81772 ttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 81831 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||| Sbjct: 81832 agacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcg 81891 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 81892 agacgtgaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 81951 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||| |||||||||||||| || ||||||| || |||||||||| ||||||| ||| | Sbjct: 81952 cccatcgccttggaggagataccagtgtcgggatgaacctgcttcaacaccttgtagacg 82011 Query: 431 tagat 435 ||||| Sbjct: 82012 tagat 82016 Score = 107 bits (54), Expect = 4e-20 Identities = 183/226 (80%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| |||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 94905 ttggtgacggcctttgtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 94964 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||| Sbjct: 94965 agacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcg 95024 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 95025 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 95084 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttca 416 ||| |||||||||||||| || ||||||| || |||||||||| Sbjct: 95085 cccatcgccttggaggagataccagtgtcgggatggacctgcttca 95130 Score = 69.9 bits (35), Expect = 9e-09 Identities = 89/107 (83%) Strand = Plus / Minus Query: 184 ggtgaatttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||| ||||||| || |||||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 59323 ggtgtatttggtcacagccttggtgccctcagacacggcgtgtttggccagctcaccggg 59264 Query: 244 gaggacgaggcggacggaggtctggatctcccgggaggtgatggtgg 290 || | || || |||| |||||||||||| | ||| |||||||||| Sbjct: 59263 cagcagcagacgcacggcggtctggatctctctggaagtgatggtgg 59217 Score = 69.9 bits (35), Expect = 9e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||||||||| |||| ||| |||||||||||| ||| || ||||||||||| ||| | Sbjct: 59170 ctcgaagatgtcattgacgaacgagttcatgatgcccatcgctttggaggagatcccggt 59111 Query: 397 gtcggggtgcacctgcttcagcaccttgaagatgtagat 435 ||| ||||| || ||||||| ||| ||| ||| |||||| Sbjct: 59110 gtctgggtgaacttgcttcaacactttgtagacgtagat 59072
>gb|M60756.1|HUMHISH2BA Human histone H2B.1 mRNA, 3' end Length = 2100 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 141 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 82 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 81 gtcggggtggacctgcttcagcaccttg 54 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 287 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 228 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 227 aggcgcacggccgtctggatctcgcgggatgtgatggtgg 188
>emb|AJ343028.1|HSA343028 Homo sapiens genomic sequence surrounding NotI site, clone NR1-GO20C Length = 691 Score = 127 bits (64), Expect = 4e-26 Identities = 82/88 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 122 ctcgaagatgtcattgacgaaggagttcatgatgcccatggccttggacgagatgccggt 63 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 62 gtcggggtgcacctgcttcagcaccttg 35 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggg 243 |||||||| ||||| ||||||||||| |||||||||||||| ||||||||||| Sbjct: 269 ttggtgacagccttagtgccctcggacacggcgtgcttggccagctcgccggg 217
>ref|XM_427116.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429558), mRNA Length = 381 Score = 125 bits (63), Expect = 2e-25 Identities = 87/95 (91%) Strand = Plus / Minus Query: 341 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 400 ||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||| Sbjct: 212 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 153 Query: 401 gggtgcacctgcttcagcaccttgaagatgtagat 435 ||||| |||||||| ||||||||| ||| |||||| Sbjct: 152 gggtggacctgctttagcaccttgtagacgtagat 118 Score = 111 bits (56), Expect = 3e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| |||||||||||||| ||||||||||||| Sbjct: 302 aggcgcacggctgtctggatctcccgcgaggtgatggtgg 263
>ref|XM_427013.1| PREDICTED: Gallus gallus similar to histone H2B.8 - chicken (LOC429457), partial mRNA Length = 628 Score = 125 bits (63), Expect = 2e-25 Identities = 87/95 (91%) Strand = Plus / Minus Query: 341 aagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcg 400 ||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||| Sbjct: 459 aagatgtcgttgacgaaggagttcatgatgcccatggccttggaggagatgccggtgtcg 400 Query: 401 gggtgcacctgcttcagcaccttgaagatgtagat 435 ||||| |||||||| ||||||||| ||| |||||| Sbjct: 399 gggtggacctgctttagcaccttgtagacgtagat 365 Score = 111 bits (56), Expect = 3e-21 Identities = 89/100 (89%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| || | Sbjct: 609 ttggtgacggccttggtgccctcagagacggcgtgcttggccagctctccgggcagcagc 550 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| |||||||||||||| ||||||||||||| Sbjct: 549 aggcgcacggctgtctggatctcccgcgaggtgatggtgg 510
>ref|XM_545375.1| PREDICTED: Canis familiaris similar to testis-specific histone 2b (LOC488253), mRNA Length = 384 Score = 125 bits (63), Expect = 2e-25 Identities = 90/99 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160 Query: 397 gtcggggtgcacctgcttcagcaccttgaagatgtagat 435 ||||||||||||||||||||||||||| |||||||||| Sbjct: 159 gtcggggtgcacctgcttcagcaccttatagatgtagat 121 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 365 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 306 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 305 aggcgcacggccgtctggatctccctggacgtgatggt 268
>ref|XM_518288.1| PREDICTED: Pan troglodytes similar to Histone H2B 291B (LOC462492), mRNA Length = 597 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 563 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 504 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 503 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 444 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 443 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 384 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 383 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 330
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 236012 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 235953 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 235952 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 235893 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 235892 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 235833 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 235832 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 235779 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 168157 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 168098 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 168097 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 168038 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 168037 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 167978 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 167977 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 167924 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||| ||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 183774 ctcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggt 183715 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||| ||||||||| Sbjct: 183714 gtcggggtggacctgctttagcaccttg 183687 Score = 103 bits (52), Expect = 6e-19 Identities = 79/88 (89%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||| |||||||| |||||||||||| ||||||||| | Sbjct: 27384 ctcgaagatgtcgttgacgaaggaattcatgatccccatggccttggatgagatgccggt 27443 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| ||||||||||| |||||| Sbjct: 27444 gtcggggtggacctgcttcagaaccttg 27471 Score = 101 bits (51), Expect = 2e-18 Identities = 191/235 (81%), Gaps = 2/235 (0%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || | Sbjct: 200282 ttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagcagc 200341 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| |||||| ||||| | |||||||||| |||| Sbjct: 200342 agacgcacggcggtctggatctccctggaggtaatggtcgagcgcttgttgtagtgggcc 200401 Query: 311 agcttggcggcctcgccggcga-gcttctcgaagatgtcgttgatgaaggagttcatgat 369 || || |||||||| |||| || | |||||||||||||| | |||||| |||||||| Sbjct: 200402 agacgggaagcctcgcctgcgatgcgt-tcgaagatgtcgttaacgaaggaattcatgat 200460 Query: 370 ggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 | |||||||||||| |||||||| | |||||||| ||||| || ||||||||| Sbjct: 200461 gcccatggccttggatgagatgccagtatcggggtgaacctgttttagcaccttg 200515 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 107485 ttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccgggaagcagc 107544 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 107545 aggcgcacggccgtctggatctccctggaggtgatggt 107582 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||| |||||||||| |||||||||||| || ||| |||||||| ||||||||| | Sbjct: 257191 ctcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggt 257132 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 257131 gtcggggtggacctgcttcagcaccttg 257104 Score = 95.6 bits (48), Expect = 2e-16 Identities = 87/100 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || ||||||||||| || ||||| ||||| || | Sbjct: 183920 ttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccgggcagcagc 183861 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||||| |||||||||||||| Sbjct: 183860 aggcgtacggccgtctggatctccctggaggtgatggtgg 183821 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||| |||||||| ||| |||||||| ||||||||| | Sbjct: 142385 ctcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggt 142326 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||||||||| Sbjct: 142325 gtcgggatggacctgcttcagcaccttg 142298 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||||||||| ||||| || || || | Sbjct: 142531 ttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccggaagcagc 142472 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 142471 aggcgcacggccgtctggatctccctggaggtgatggt 142434 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Plus Query: 344 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 403 |||||||| | ||| || ||||||||| |||||||||||| |||||||| ||||||| Sbjct: 107638 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 107697 Query: 404 tgcacctgcttcagcaccttg 424 || ||||| |||||||||||| Sbjct: 107698 tggacctgtttcagcaccttg 107718 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||| ||||| ||||| ||||| || | Sbjct: 257337 ttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccgggtagcagc 257278 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| || | || |||||||||| ||| |||||||| Sbjct: 257277 aggcgcacagccgtttggatctccctggaagtgatggt 257240
>ref|NM_003524.2| Homo sapiens histone 1, H2bh (HIST1H2BH), mRNA Length = 425 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 362 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 182 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 129
>gb|AF531291.1| Homo sapiens histone H2B (HIST1H2BH) gene, complete cds Length = 1137 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 742 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 683 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 682 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 623 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 622 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 563 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 562 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 509
>gb|AF531288.1| Homo sapiens histone H2B (HIST1H2BE) gene, complete cds Length = 1137 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 742 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 683 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 682 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 623 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 622 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 563 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 562 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 509
>emb|AL357493.8| Human DNA sequence from clone RP11-439A17 on chromosome 1 Contains four novel genes, a novel gene (MGC57827), a ribosomal protein L22 (RPL22) pseudogene, a histone 2 H3c (HIST2H3C) pseudogene, the HIST2H2BB gene for histone 2 H2bb, the FCGR1B gene for Fc fragment of IgG high affinity Ib receptor for (CD64) and three CpG islands, complete sequence Length = 189539 Score = 123 bits (62), Expect = 7e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 159102 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 159043 Query: 397 gtcggggtgcacctgcttcagcacct 422 ||||||||| |||||||||||||||| Sbjct: 159042 gtcggggtggacctgcttcagcacct 159017 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 159248 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 159189 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 159188 aggcgcacggccgtctggatctcacgggatgtgatggtgg 159149
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 90538 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 90479 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 90478 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 90419 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 90418 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 90359 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 90358 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 90305 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 29866 ttggtgacggccttggtgccctccgacacggcgtgcttggccagctctccgggaagcagc 29925 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 29926 aggcgcacggccgtctggatctccctggaggtgatggt 29963 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||| |||||||| ||| |||||||| ||||||||| | Sbjct: 64766 ctcgaagatgtcgttgacgaaggaattcatgatccccattgccttggaagagatgccggt 64707 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||||||||| Sbjct: 64706 gtcgggatggacctgcttcagcaccttg 64679 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||||||||| ||||| || || || | Sbjct: 64912 ttggtgacggccttggtgccctccgacacggcgtgcttggccagctcccccggaagcagc 64853 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| |||||||||||| Sbjct: 64852 aggcgcacggccgtctggatctccctggaggtgatggt 64815 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Plus Query: 344 atgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgatgtcgggg 403 |||||||| | ||| || ||||||||| |||||||||||| |||||||| ||||||| Sbjct: 30019 atgtcgttaacgaaagaattcatgatgcccatggccttggaagagatgccagtgtcggga 30078 Query: 404 tgcacctgcttcagcaccttg 424 || ||||| |||||||||||| Sbjct: 30079 tggacctgtttcagcaccttg 30099
>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2 Contains seventeen histone (pseudo)genes and gene RPS10P1 (40S Ribosomal protein S10 pseudogene 1), three CpG islands, ESTs, STSs and GSSs, complete sequence Length = 89301 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 57394 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 57335 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 57334 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 57275 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 57274 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 57215 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 57214 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 57161 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||| ||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 5156 ctcgaagatatcgttgacgaaggagttcatgatgcccatggccttggatgagatgccggt 5097 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||| ||||||||| Sbjct: 5096 gtcggggtggacctgctttagcaccttg 5069 Score = 101 bits (51), Expect = 2e-18 Identities = 191/235 (81%), Gaps = 2/235 (0%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||| || ||||| || ||||||||||| ||||| ||||| || | Sbjct: 21664 ttggtgacagccttggtaccttcggacactgcgtgcttggccagctctccgggaagcagc 21723 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||||| |||||| ||||| | |||||||||| |||| Sbjct: 21724 agacgcacggcggtctggatctccctggaggtaatggtcgagcgcttgttgtagtgggcc 21783 Query: 311 agcttggcggcctcgccggcga-gcttctcgaagatgtcgttgatgaaggagttcatgat 369 || || |||||||| |||| || | |||||||||||||| | |||||| |||||||| Sbjct: 21784 agacgggaagcctcgcctgcgatgcgt-tcgaagatgtcgttaacgaaggaattcatgat 21842 Query: 370 ggacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 | |||||||||||| |||||||| | |||||||| ||||| || ||||||||| Sbjct: 21843 gcccatggccttggatgagatgccagtatcggggtgaacctgttttagcaccttg 21897 Score = 95.6 bits (48), Expect = 2e-16 Identities = 78/88 (88%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 |||||| |||||||||| |||||||||||| || ||| |||||||| ||||||||| | Sbjct: 78573 ctcgaaaatgtcgttgacgaaggagttcataatccccatagccttggacgagatgccggt 78514 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||||||||| Sbjct: 78513 gtcggggtggacctgcttcagcaccttg 78486 Score = 95.6 bits (48), Expect = 2e-16 Identities = 87/100 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || ||||||||||| || ||||| ||||| || | Sbjct: 5302 ttggtgacggccttggtgccctctgacacggcgtgcttagccagctccccgggcagcagc 5243 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||||| |||||||||||||| Sbjct: 5242 aggcgtacggccgtctggatctccctggaggtgatggtgg 5203 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||| ||||| ||||| ||||| || | Sbjct: 78719 ttggtgaccgccttggtgccctccgacaccgcgtgtttggccagctccccgggtagcagc 78660 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| || | || |||||||||| ||| |||||||| Sbjct: 78659 aggcgcacagccgtttggatctccctggaagtgatggt 78622
>gb|AC092896.9| Homo sapiens 3 BAC RP11-274J15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 170330 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||| |||||||||||||||||| |||||||||||||| | ||| |||| || | Sbjct: 98709 ttggtgatggccttggtgccctcggacacggcgtgcttggccacctcctcgggcagcagc 98768 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| ||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 98769 aggcgctcggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 98828 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || |||||||| |||| | ||| ||||||||||||| ||||||||||||||| Sbjct: 98829 aggcgggaagcctcgcccgcgacgtgctcaaagatgtcgttgacgaaggagttcatgatc 98888 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 ||||||||| |||||||||||| |||| | ||| |||||||||||||||||| Sbjct: 98889 cccatggccttagaggagatgccggtgtcagagtggacctgcttcagcaccttg 98942
>emb|Z80780.1|HSH2BH H.sapiens H2B/h gene Length = 990 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 764 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 705 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 704 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 645 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 644 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 585 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 584 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 531
>gb|BC096116.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116762 IMAGE:40002316), complete cds Length = 425 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 362 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 182 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 129
>gb|BC096119.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116765 IMAGE:40002319), complete cds Length = 425 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 362 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 182 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 129
>gb|BC096117.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116763 IMAGE:40002317), complete cds Length = 425 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 362 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 182 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 129
>gb|BC096118.1| Homo sapiens histone 1, H2bh, mRNA (cDNA clone MGC:116764 IMAGE:40002318), complete cds Length = 425 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| ||||||||||| |||||||||||||| || || || || || | Sbjct: 362 ttggtgacggccttagtgccctcggacacggcgtgcttggccagttccccaggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggctgtctggatctccctggaggtgatggtcgaacgcttgttgtaatgagcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||| ||||||| ||||| |||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatatcgttgacaaaggaattcatgatc 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| ||||||||||||||| |||||||||| || ||||||||||||||| Sbjct: 182 cccatggctttggaggagatgccggtgtcggggtggacttgcttcagcaccttg 129
>ref|NG_002621.1| Homo sapiens histone 2, H2ba (HIST2H2BA) pseudogene on chromosome 1 Length = 1137 Score = 123 bits (62), Expect = 7e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 397 gtcggggtgcacctgcttcagcacct 422 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 741 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 682 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 681 aggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>ref|XM_683203.1| PREDICTED: Danio rerio similar to histone 1, H2bg (LOC559827), mRNA Length = 516 Score = 123 bits (62), Expect = 7e-25 Identities = 188/230 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 497 ttggtgacggccttggtgccctcagacacggcgtgtttggccagctcaccgggcagcagc 438 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || |||| |||||||||||| | ||| |||||||||| |||||||||| | ||| Sbjct: 437 agacgcacggcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcg 378 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 377 agacgagaagcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 318 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 ||| |||||||||||||| || ||||||| || |||||||||||||| Sbjct: 317 cccatcgccttggaggagataccagtgtcgggatggacctgcttcagcac 268
>ref|NG_002652.1| Homo sapiens histone 2, H2bb (HIST2H2BB) pseudogene on chromosome 1 Length = 1137 Score = 123 bits (62), Expect = 7e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 397 gtcggggtgcacctgcttcagcacct 422 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 741 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 682 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 681 aggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>gb|AY131975.1| Homo sapiens histone H2B (HIST2H2BA) pseudogene, complete sequence Length = 1137 Score = 123 bits (62), Expect = 7e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 397 gtcggggtgcacctgcttcagcacct 422 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 741 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 682 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 681 aggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>gb|AY131976.1| Homo sapiens histone H2B (HIST2H2BB) pseudogene, complete sequence Length = 1137 Score = 123 bits (62), Expect = 7e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 595 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 536 Query: 397 gtcggggtgcacctgcttcagcacct 422 ||||||||| |||||||||||||||| Sbjct: 535 gtcggggtggacctgcttcagcacct 510 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 741 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 682 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 681 aggcgcacggccgtctggatctcacgggatgtgatggtgg 642
>gb|BC101750.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MGC:126799 IMAGE:8069256), complete cds Length = 497 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 428 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 369 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 368 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 309 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 308 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 249 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 248 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 195
>gb|BC101748.1| Homo sapiens histone 1, H2be, mRNA (cDNA clone MGC:126797 IMAGE:8069254), complete cds Length = 498 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 429 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 370 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 369 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 310 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 309 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 250 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 249 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 196
>gb|BC106916.1| Homo sapiens similar to histone H2B histone family, mRNA (cDNA clone MGC:126031 IMAGE:40032208), complete cds Length = 520 Score = 123 bits (62), Expect = 7e-25 Identities = 80/86 (93%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 225 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 166 Query: 397 gtcggggtgcacctgcttcagcacct 422 ||||||||| |||||||||||||||| Sbjct: 165 gtcggggtggacctgcttcagcacct 140 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||||||||| || | Sbjct: 371 ttggtgaccgccttggtgccctcggacacggcgtgcttggccagctcgccgggcagcagc 312 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 ||||| |||| ||||||||||| ||||| |||||||||| Sbjct: 311 aggcgcacggccgtctggatctcacgggatgtgatggtgg 272
>ref|NM_003523.2| Homo sapiens histone 1, H2be (HIST1H2BE), mRNA Length = 435 Score = 123 bits (62), Expect = 7e-25 Identities = 191/234 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| ||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 362 ttggtaacggccttggtgccctctgacacagcgtgcttggccagctccccgggaagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 ||||| |||| ||||||||||||| |||||||||||| | ||||||||| | || Sbjct: 302 aggcgcacggccgtctggatctccctggaggtgatggtcgagcgcttgttgtaatgcgcc 243 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || || ||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 242 aggcgggaagcctcgccggcgatgcgctcgaagatgtcgttgacaaaggaattcatgatc 183 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttg 424 |||||| || |||||||||||| |||||||||| ||||| |||||||||||| Sbjct: 182 cccatggctttagaggagatgccggtgtcggggtggacctgtttcagcaccttg 129
>ref|XM_685927.1| PREDICTED: Danio rerio similar to histone 1, H2bg (LOC562547), mRNA Length = 474 Score = 121 bits (61), Expect = 3e-24 Identities = 199/245 (81%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| |||||||| || |||||||| ||||| ||||| ||||| || | Sbjct: 455 ttggtgacggcctttgtgccctcagacacggcgtgtttggccagctctccgggcagcagc 396 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtagcgggcg 310 || || || | |||||||||||| | ||| |||||||||| |||||||||| | ||| Sbjct: 395 agacgcacagcggtctggatctctctggaagtgatggtggagcgcttgttgtagtgagcg 336 Query: 311 agcttggcggcctcgccggcgagcttctcgaagatgtcgttgatgaaggagttcatgatg 370 || | ||||| ||||||| ||||||||||||||||| ||| |||||||||||| Sbjct: 335 agacgagacgcctcaccggcgatgcgctcgaagatgtcgttgacgaacgagttcatgatg 276 Query: 371 gacatggccttggaggagatgccgatgtcggggtgcacctgcttcagcaccttgaagatg 430 ||| |||||||||||||| ||| ||||||| || |||||||||| ||||||| ||| | Sbjct: 275 cccatcgccttggaggagatcccggtgtcgggatggacctgcttcaacaccttgtagacg 216 Query: 431 tagat 435 ||||| Sbjct: 215 tagat 211
>ref|NM_023422.2| Mus musculus histone 1, H2bc (Hist1h2bc), mRNA Length = 730 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 251 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 192 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 191 gtcggggtgcacttgcttcagcaccttg 164 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 397 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 338 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 337 aggcgcacggccgtctggatctcccgggacgtgatggt 300
>ref|NM_178194.2| Mus musculus histone 1, H2be (Hist1h2be), mRNA Length = 2436 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 437 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 378 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 377 gtcggggtgcacttgcttcagcaccttg 350 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 583 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 524 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 523 aggcgcacggccgtctggatctcccgggatgtgatggt 486
>gb|BC060304.1| Mus musculus histone 1, H2bg, mRNA (cDNA clone MGC:70229 IMAGE:4217587), complete cds Length = 661 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 276 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 217 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 216 gtcggggtgcacttgcttcagcaccttg 189 Score = 85.7 bits (43), Expect = 1e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 194 gtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgagg 253 ||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | ||| Sbjct: 419 gtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagcagg 360 Query: 254 cggacggaggtctggatctcccgggaggtgatggt 288 || |||| ||||||||||||||||| |||||||| Sbjct: 359 cgcacggccgtctggatctcccgggacgtgatggt 325
>ref|XM_607722.1| PREDICTED: Bos taurus similar to Histone H2B 291B (LOC529278), mRNA Length = 381 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaaggagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||| ||||| |||||||||||||||||| Sbjct: 156 gtccgggtggacctgcttcagcaccttg 129 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || |||||||||||||| || || ||||| || | Sbjct: 362 ttggtgacggccttggtgccctcagacacggcgtgcttggccagttctccgggaagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctccctggatgtgatggt 265
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 63730 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 63789 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 63790 gtcggggtgcacttgcttcagcaccttg 63817 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 49637 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 49578 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 49577 gtcggggtgcacttgcttcagcaccttg 49550 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||| ||||||||||||||| | Sbjct: 92241 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggt 92182 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 92181 gtcggggtgcacttgcttcagcaccttg 92154 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | || |||||||||||| |||||||||||||||||||||| | Sbjct: 61403 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggagatgccggt 61344 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 61343 gtcggggtgcacttgcttcagcaccttg 61316 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 92387 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 92328 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 92327 aggcgcacggccgtctggatctcccgggacgtgatggt 92290 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 61549 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 61490 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 61489 aggcgcacggccgtctggatctcccgggacgtgatggt 61452 Score = 85.7 bits (43), Expect = 1e-13 Identities = 82/95 (86%) Strand = Plus / Plus Query: 194 gtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgagg 253 ||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | ||| Sbjct: 63587 gtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagcagg 63646 Query: 254 cggacggaggtctggatctcccgggaggtgatggt 288 || |||| ||||||||||||||||| |||||||| Sbjct: 63647 cgcacggccgtctggatctcccgggacgtgatggt 63681 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 49783 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 49724 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 49723 aggcgcacggccgtctggatctcccgggatgtgatggt 49686 Score = 40.1 bits (20), Expect = 7.8 Identities = 41/48 (85%) Strand = Plus / Minus Query: 373 catggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 |||||||||||| |||||| |||| |||| ||||||||||||||| Sbjct: 14498 catggccttggataagatgctcatgttggggctcacctgcttcagcac 14451
>ref|XM_545431.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488309), partial mRNA Length = 705 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_535910.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC478743), mRNA Length = 1047 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 386 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 327 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 326 aggcgcacggccgtctggatctccctggacgtgatggt 289
>ref|XM_843136.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC478743), mRNA Length = 487 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 386 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 327 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 326 aggcgcacggccgtctggatctccctggacgtgatggt 289
>ref|XM_849151.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611482), mRNA Length = 386 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 221 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 162 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 161 gtcggggtgcacctgcttcagcaccttg 134 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 367 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 308 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 307 aggcgcacggccgtctggatctccctggacgtgatggt 270
>ref|XM_849134.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611465), mRNA Length = 388 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 369 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 310 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 309 aggcgcacggccgtctggatctccctggacgtgatggt 272
>ref|XM_545412.2| PREDICTED: Canis familiaris similar to H2B histone family, member T (LOC488290), mRNA Length = 421 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 369 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 310 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 309 aggcgcacggccgtctggatctccctggacgtgatggt 272
>ref|XM_545410.2| PREDICTED: Canis familiaris similar to H2B histone family, member R (LOC488288), mRNA Length = 384 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 159 gtcggggtgcacctgcttcagcaccttg 132 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 365 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 306 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 305 aggcgcacggccgtctggatctccctggacgtgatggt 268
>ref|XM_545401.2| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC488279), mRNA Length = 513 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 285 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 226 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 225 gtcggggtgcacctgcttcagcaccttg 198 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 431 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 372 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 371 aggcgcacggccgtctggatctccctggacgtgatggt 334
>ref|XM_545398.2| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488276), mRNA Length = 438 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 223 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 164 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 163 gtcggggtgcacctgcttcagcaccttg 136 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 369 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 310 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 309 aggcgcacggccgtctggatctccctggacgtgatggt 272
>ref|XM_848802.1| PREDICTED: Canis familiaris similar to H2B histone family, member T (LOC611158), mRNA Length = 883 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 210 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 151 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 150 gtcggggtgcacctgcttcagcaccttg 123 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 356 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 297 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 296 aggcgcacggccgtctggatctccctggacgtgatggt 259
>ref|XM_848767.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC611126), mRNA Length = 751 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 242 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 183 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 182 gtcggggtgcacctgcttcagcaccttg 155 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| ||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 388 ttggtgacagccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 329 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 328 aggcgcacggccgtctggatctccctggacgtgatggt 291
>ref|XM_545418.1| PREDICTED: Canis familiaris similar to Histone H2B 291B (LOC488296), mRNA Length = 381 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_848724.1| PREDICTED: Canis familiaris similar to H2B histone family, member F (LOC611089), mRNA Length = 381 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_545374.2| PREDICTED: Canis familiaris similar to testis-specific histone 2b (LOC488252), mRNA Length = 384 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 219 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 160 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 159 gtcggggtgcacctgcttcagcaccttg 132 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 365 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 306 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 305 aggcgcacggccgtctggatctccctggacgtgatggt 268
>ref|XM_844623.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC608682), mRNA Length = 342 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 177 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 118 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 117 gtcggggtgcacctgcttcagcaccttg 90 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 323 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 264 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 263 aggcgcacggccgtctggatctccctggacgtgatggt 226
>ref|XM_854475.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC608682), mRNA Length = 383 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 218 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 159 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 158 gtcggggtgcacctgcttcagcaccttg 131 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 364 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 305 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 304 aggcgcacggccgtctggatctccctggacgtgatggt 267
>ref|XM_854447.1| PREDICTED: Canis familiaris similar to H2B histone family, member T, transcript variant 3 (LOC488303), mRNA Length = 651 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 232 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 173 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 172 gtcggggtgcacctgcttcagcaccttg 145 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 378 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 319 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 318 aggcgcacggccgtctggatctccctggacgtgatggt 281
>ref|XM_545425.2| PREDICTED: Canis familiaris similar to H2B histone family, member T, transcript variant 2 (LOC488303), mRNA Length = 442 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 156 gtcggggtgcacctgcttcagcaccttg 129 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctccctggacgtgatggt 265
>ref|XM_854265.1| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 2 (LOC488267), mRNA Length = 440 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 224 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 165 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 164 gtcggggtgcacctgcttcagcaccttg 137 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 370 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 311 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 310 aggcgcacggccgtctggatctccctggacgtgatggt 273
>ref|XM_545389.2| PREDICTED: Canis familiaris similar to Histone H2B 291B, transcript variant 1 (LOC488267), mRNA Length = 1108 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 224 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 165 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 164 gtcggggtgcacctgcttcagcaccttg 137 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 370 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 311 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 310 aggcgcacggccgtctggatctccctggacgtgatggt 273
>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 3 (LOC480760), mRNA Length = 862 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 615 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 556 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 555 gtcggggtgcacctgcttcagcaccttg 528 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 761 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 702 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 701 aggcgcacggccgtctggatctccctggacgtgatggt 664
>ref|XM_854116.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 2 (LOC480760), mRNA Length = 487 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 240 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 181 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 180 gtcggggtgcacctgcttcagcaccttg 153 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 386 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 327 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 326 aggcgcacggccgtctggatctccctggacgtgatggt 289
>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted), transcript variant 1 (LOC480760), mRNA Length = 1422 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 615 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 556 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 555 gtcggggtgcacctgcttcagcaccttg 528 Score = 99.6 bits (50), Expect = 1e-17 Identities = 86/98 (87%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 761 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 702 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||| ||| |||||||| Sbjct: 701 aggcgcacggccgtctggatctccctggacgtgatggt 664
>ref|XM_978232.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A) (LOC665622), mRNA Length = 2266 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 297 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 238 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 237 gtcggggtgcacttgcttcagcaccttg 210 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 443 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 384 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 383 aggcgcacggccgtctggatctcccgggacgtgatggt 346
>ref|XM_978035.1| PREDICTED: Mus musculus similar to Histone H2B F (H2B 291A) (LOC665596), mRNA Length = 2266 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 297 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 238 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 237 gtcggggtgcacttgcttcagcaccttg 210 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 443 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 384 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 383 aggcgcacggccgtctggatctcccgggacgtgatggt 346
>gb|BC061044.1| Mus musculus histone 1, H2bp, mRNA (cDNA clone MGC:74154 IMAGE:6742370), complete cds Length = 624 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 243 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 184 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 183 gtcggggtgcacttgcttcagcaccttg 156 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 389 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 330 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 329 aggcgcacggccgtctggatctcccgggacgtgatggt 292
>emb|CR708520.2|CNS0G9N8 Tetraodon nigroviridis full-length cDNA Length = 724 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 220 ctcgaagatgtcgttgacgaacgagttcatgatgctcatggccttggacgagatgcccgt 161 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 160 gtcggggtgcacctgcttcagcaccttg 133 Score = 83.8 bits (42), Expect = 6e-13 Identities = 96/114 (84%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||| |||||||||||||||||||| |||||||||||||| ||||| ||||| || | Sbjct: 366 ttggtcacggccttggtgccctcggacacggcgtgcttggccagctccccgggcagcagc 307 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgggcttcttgttgtag 304 || | |||| ||||||||||||| ||| ||||||||||| |||||||||| Sbjct: 306 agcctcacggccgtctggatctccctggacgtgatggtggggcgcttgttgtag 253
>gb|BC011440.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:19269 IMAGE:3989862), complete cds Length = 2236 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 229 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 170 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 169 gtcggggtgcacttgcttcagcaccttg 142 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 375 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 316 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 315 aggcgcacggcagtctggatctcccgggacgtgatggt 278
>emb|X07762.1|GGH2AB7 Chicken DNA for pCH22.0B histone H2A/H2B sequence Length = 751 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||| | Sbjct: 751 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgcccgt 692 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||||||||||||||||||| Sbjct: 691 gtcggggtgcacctgcttcagcaccttg 664
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 443 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 502 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 503 gtcggggtgcacttgcttcagcaccttg 530 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 297 ttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 356 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 357 aggcgcacggccgtctggatctcccgggacgtgatggt 394
>emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A with genes H1A, H2B, H3 and H4 Length = 8592 Score = 119 bits (60), Expect = 1e-23 Identities = 90/100 (90%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||||||||||||||| |||||||||||||| ||||| || || | || Sbjct: 2056 ttggtgacggccttggtgccctcggacacggcgtgcttggccagctccccaggcaagagc 1997 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggtgg 290 |||||||| | ||||||||||||||||||||||||||||| Sbjct: 1996 aggcggaccgcggtctggatctcccgggaggtgatggtgg 1957 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 356 aaggagttcatgatggacatggccttggaggagatgccgatgtcggggtgcacctgcttc 415 ||||||||||||||| |||||||||||| ||||||||| | ||||||||||||||||| Sbjct: 1891 aaggagttcatgatgctcatggccttggaagagatgccggtatcggggtgcacctgcttg 1832 Query: 416 agcac 420 ||||| Sbjct: 1831 agcac 1827
>emb|X02621.1|MMHISH2B Mouse gene for histone H2b Length = 688 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 386 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 327 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 326 gtcggggtgcacttgcttcagcaccttg 299 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 532 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 473 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 472 aggcgcacggccgtctggatctcccgggacgtgatggt 435
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 164862 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 164803 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 164802 gtcggggtgcacttgcttcagcaccttg 164775 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 66156 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 66215 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 66216 gtcggggtgcacttgcttcagcaccttg 66243 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 52254 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 52195 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 52194 gtcggggtgcacttgcttcagcaccttg 52167 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | || |||||||||||| |||||||||||||||||||||| | Sbjct: 54581 ctcgaagatgtcgttcacaaacgagttcatgatgcccatggccttggaggagatgccggt 54640 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 54641 gtcggggtgcacttgcttcagcaccttg 54668 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||| ||||||||||||||| | Sbjct: 23739 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggctttggaggagatgccggt 23798 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 23799 gtcggggtgcacttgcttcagcaccttg 23826 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 165008 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 164949 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 164948 aggcgcacggccgtctggatctcccgggacgtgatggt 164911 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 54435 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 54494 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 54495 aggcgcacggccgtctggatctcccgggacgtgatggt 54532 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 23593 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 23652 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 23653 aggcgcacggccgtctggatctcccgggacgtgatggt 23690 Score = 85.7 bits (43), Expect = 1e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 194 gtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgagg 253 ||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | ||| Sbjct: 52397 gtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagcagg 52338 Query: 254 cggacggaggtctggatctcccgggaggtgatggt 288 || |||| ||||||||||||||||| |||||||| Sbjct: 52337 cgcacggccgtctggatctcccgggacgtgatggt 52303 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 66010 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 66069 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 66070 aggcgcacggccgtctggatctcccgggatgtgatggt 66107 Score = 40.1 bits (20), Expect = 7.8 Identities = 41/48 (85%) Strand = Plus / Plus Query: 373 catggccttggaggagatgccgatgtcggggtgcacctgcttcagcac 420 |||||||||||| |||||| |||| |||| ||||||||||||||| Sbjct: 101295 catggccttggataagatgctcatgttggggctcacctgcttcagcac 101342
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 34153 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 34094 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 34093 gtcggggtgcacttgcttcagcaccttg 34066 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 10123 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 10182 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 10183 gtcggggtgcacttgcttcagcaccttg 10210 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 34299 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 34240 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 34239 aggcgcacggccgtctggatctcccgggacgtgatggt 34202 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 9977 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 10036 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 10037 aggcgcacggccgtctggatctcccgggacgtgatggt 10074
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 53458 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 53399 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 53398 gtcggggtgcacttgcttcagcaccttg 53371 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||| ||| | Sbjct: 60801 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagataccggt 60742 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 60741 gtcggggtgcacttgcttcagcaccttg 60714 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 60947 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 60888 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 60887 aggcgcacggccgtctggatctcccgggacgtgatggt 60850 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 53604 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 53545 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 53544 aggcgcacggccgtctggatctcccgggacgtgatggt 53507
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 208720 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 208661 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 208660 gtcggggtgcacttgcttcagcaccttg 208633 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 175328 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 175269 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 175268 gtcggggtgcacttgcttcagcaccttg 175241 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 136918 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 136977 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 136978 gtcggggtgcacttgcttcagcaccttg 137005 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 143303 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 143244 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||| ||||||||| Sbjct: 143243 gtcggggtgcacttgctttagcaccttg 143216 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 175474 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 175415 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 175414 aggcgcacggccgtctggatctcccgggatgtgatggt 175377 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 208866 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 208807 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 208806 aggcgcacggccgtctggatctcccgggacgtgatggt 208769 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 143449 ttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 143390 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 143389 aggcgcacggccgtctggatctcccgggacgtgatggt 143352 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 136772 ttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 136831 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 136832 aggcgcacggccgtctggatctcccgggacgtgatggt 136869
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 141368 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 141427 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 141428 gtcggggtgcacttgcttcagcaccttg 141455 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| |||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 141222 ttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccgggcagcagc 141281 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 141282 aggcgcacggccgtctggatctcccgggacgtgatggt 141319
>gb|BC069889.1| Mus musculus histone 1, H2be, mRNA (cDNA clone MGC:78105 IMAGE:4217814), complete cds Length = 657 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 223 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 164 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 163 gtcggggtgcacttgcttcagcaccttg 136 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 369 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 310 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 309 aggcgcacggccgtctggatctcccgggatgtgatggt 272
>gb|BC019673.1| Mus musculus histone 1, H2bc, mRNA (cDNA clone MGC:30336 IMAGE:3993954), complete cds Length = 740 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 232 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 173 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 172 gtcggggtgcacttgcttcagcaccttg 145 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 378 ttggtgaccgccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 319 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 318 aggcgcacggccgtctggatctcccgggacgtgatggt 281
>dbj|AK036389.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830004G03 product:H2B histone family, member S, full insert sequence Length = 1257 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 245 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 186 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 185 gtcggggtgcacttgcttcagcaccttg 158 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 391 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 332 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 331 aggcgcacggccgtctggatctcccgggacgtgatggt 294
>dbj|AK049948.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630013P15 product:H2B histone family, member S, full insert sequence Length = 2410 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 410 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 351 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 350 gtcggggtgcacttgcttcagcaccttg 323 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 556 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 497 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 496 aggcgcacggccgtctggatctcccgggatgtgatggt 459
>dbj|AK005191.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500010J12 product:histone 1, H2bc, full insert sequence Length = 724 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 245 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 186 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 185 gtcggggtgcacttgcttcagcaccttg 158 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 391 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 332 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 331 aggcgcacggccgtctggatctcccgggacgtgatggt 294
>dbj|AK005407.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched library, clone:1600009N02 product:H2B histone family, member S, full insert sequence Length = 723 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 244 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 185 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 184 gtcggggtgcacttgcttcagcaccttg 157 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 390 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 331 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 330 aggcgcacggccgtctggatctcccgggacgtgatggt 293
>dbj|AK030546.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330429M17 product:H2B histone family, member S, full insert sequence Length = 2436 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 437 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 378 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 377 gtcggggtgcacttgcttcagcaccttg 350 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 583 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 524 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 523 aggcgcacggccgtctggatctcccgggatgtgatggt 486
>dbj|AK011516.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610022J01 product:H2B histone family, member S, full insert sequence Length = 730 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 251 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 192 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 191 gtcggggtgcacttgcttcagcaccttg 164 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 397 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 338 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 337 aggcgcacggccgtctggatctcccgggacgtgatggt 300
>ref|NM_178196.2| Mus musculus histone 1, H2bg (Hist1h2bg), mRNA Length = 661 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 276 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 217 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 216 gtcggggtgcacttgcttcagcaccttg 189 Score = 85.7 bits (43), Expect = 1e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 194 gtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacgagg 253 ||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | ||| Sbjct: 419 gtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagcagg 360 Query: 254 cggacggaggtctggatctcccgggaggtgatggt 288 || |||| ||||||||||||||||| |||||||| Sbjct: 359 cgcacggccgtctggatctcccgggacgtgatggt 325
>ref|NM_178199.1| Mus musculus histone 1, H2bl (Hist1h2bl), mRNA Length = 381 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 156 gtcggggtgcacttgcttcagcaccttg 129 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgactgccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctcccgggacgtgatggt 265
>ref|NM_178201.1| Mus musculus histone 1, H2bn (Hist1h2bn), mRNA Length = 381 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 156 gtcggggtgcacttgcttcagcaccttg 129 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacagccttggtgccctccgacacggcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctcccgggatgtgatggt 265
>ref|NM_178202.1| Mus musculus histone 1, H2bp (Hist1h2bp), mRNA Length = 381 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 216 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 156 gtcggggtgcacttgcttcagcaccttg 129 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 362 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 303 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 302 aggcgcacggccgtctggatctcccgggacgtgatggt 265
>ref|XM_220506.2| PREDICTED: Rattus norvegicus histone 3, H2ba (predicted) (Hist3h2ba_predicted), mRNA Length = 585 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||||| ||| |||||||||||| |||||||||||| ||||||||| | Sbjct: 216 ctcgaagatgtcgttgacgaacgagttcatgatgcccatggccttggacgagatgccggt 157 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 ||| |||||||||||||||||||||||| Sbjct: 156 gtccgggtgcacctgcttcagcaccttg 129
>gb|AY158938.1| Mus musculus histone protein Hist1h2bb gene, complete cds Length = 1378 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 716 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 657 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 656 gtcggggtgcacttgcttcagcaccttg 629 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||||||||| |||||||| || |||||||||||||| ||||| ||||| || | Sbjct: 862 ttggtgacggccttagtgccctccgacacggcgtgcttggccagctccccgggcagcagc 803 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 802 aggcgcacggccgtctggatctcccgggacgtgatggt 765
>gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, complete cds Length = 1401 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 799 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 740 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 739 gtcggggtgcacttgcttcagcaccttg 712 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 ||||||||||||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 945 ttggtgacggccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 886 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 885 aggcgcacggccgtctggatctcccgggacgtgatggt 848
>gb|AY158936.1| Mus musculus histone protein Hist1h2be gene, complete cds Length = 1375 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 337 ctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggaggagatgccgat 396 ||||||||||||||| | ||| |||||||||||| |||||||||||||||||||||| | Sbjct: 713 ctcgaagatgtcgttcacgaacgagttcatgatgcccatggccttggaggagatgccggt 654 Query: 397 gtcggggtgcacctgcttcagcaccttg 424 |||||||||||| ||||||||||||||| Sbjct: 653 gtcggggtgcacttgcttcagcaccttg 626 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 191 ttggtgacggccttggtgccctcggagacggcgtgcttggcgagctcgccggggaggacg 250 |||||||| |||||||||||||| || || ||||||||||| ||||| ||||| || | Sbjct: 859 ttggtgacagccttggtgccctccgacaccgcgtgcttggccagctccccgggcagcagc 800 Query: 251 aggcggacggaggtctggatctcccgggaggtgatggt 288 ||||| |||| ||||||||||||||||| |||||||| Sbjct: 799 aggcgcacggccgtctggatctcccgggatgtgatggt 762 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,874,924 Number of Sequences: 3902068 Number of extensions: 4874924 Number of successful extensions: 114779 Number of sequences better than 10.0: 1119 Number of HSP's better than 10.0 without gapping: 1162 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 106602 Number of HSP's gapped (non-prelim): 7975 length of query: 571 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 548 effective length of database: 17,143,297,704 effective search space: 9394527141792 effective search space used: 9394527141792 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
