ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags5i20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
2dbj|AK067865.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
4emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123... 72 2e-09
5gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, co... 44 0.37
6gb|AC158683.2| Mus musculus 6 BAC RP23-328P16 (Roswell Park Canc... 44 0.37
7emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.37
8gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, com... 42 1.5
9gb|AF442300.1| Kluyveromyces delphensis small subunit ribosomal ... 42 1.5
10gb|AC026774.7| Homo sapiens chromosome 5 clone CTC-235G5, comple... 42 1.5
11gb|AC120113.2| Homo sapiens chromosome 5 clone CTD-2324F19, comp... 42 1.5
12gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence 42 1.5
13gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, comp... 42 1.5
14gb|AC134463.3| Mus musculus BAC clone RP23-425N12 from 5, comple... 42 1.5
15ref|XM_656095.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 5.7
16gb|AE017199.1| Nanoarchaeum equitans Kin4-M, complete genome 40 5.7
17gb|AC125057.5| Mus musculus BAC clone RP23-399K1 from chromosome... 40 5.7
18gb|AC123869.4| Mus musculus BAC clone RP23-245M16 from 12, compl... 40 5.7
19emb|AL591502.10| Human DNA sequence from clone RP11-199C17 on ch... 40 5.7
20emb|BX572083.6| Zebrafish DNA sequence from clone DKEY-232J4 in ... 40 5.7
21gb|AF291662.1| Aspergillus nidulans Kex2-like dibasic endoprotea... 40 5.7
22gb|AC096763.2| Homo sapiens BAC clone RP11-625A6 from 4, complet... 40 5.7
23gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome 40 5.7
24gb|AC102443.11| Mus musculus chromosome 3, clone RP24-191D1, com... 40 5.7
25gb|AF250284.1|AF250284 Amsacta moorei entomopoxvirus, complete g... 40 5.7
26dbj|AB056726.1| Emericella nidulans kexB mRNA for kexin like pro... 40 5.7
27emb|BX323557.8| Zebrafish DNA sequence from clone DKEYP-86B9 in ... 40 5.7
28emb|BX072549.4| Zebrafish DNA sequence from clone CH211-114A17 i... 40 5.7
29emb|AL732544.12| Zebrafish DNA sequence from clone BUSM1-6I1 in ... 40 5.7
30dbj|AP001547.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 5.7
31gb|AC147597.2| Gallus gallus BAC clone CH261-100D18 from chromos... 40 5.7
32dbj|AP004941.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 5.7

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                            
Query: 280      ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 339
                |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 22167421 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 22167480

                                                                            
Query: 340      tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 399
                 |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 22167481 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 22167540

                                    
Query: 400      agctttgtatgagctgatca 419
                |  | |||||||||||||||
Sbjct: 22167541 aattctgtatgagctgatca 22167560



to top

>dbj|AK067865.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013124K14, full
            insert sequence
          Length = 2169

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                        
Query: 280  ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 339
            |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 1833 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 1774

                                                                        
Query: 340  tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 399
             |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 1773 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 1714

                                
Query: 400  agctttgtatgagctgatca 419
            |  | |||||||||||||||
Sbjct: 1713 aattctgtatgagctgatca 1694



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                            
Query: 280      ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 339
                |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 22095766 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 22095825

                                                                            
Query: 340      tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 399
                 |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 22095826 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 22095885

                                    
Query: 400      agctttgtatgagctgatca 419
                |  | |||||||||||||||
Sbjct: 22095886 aattctgtatgagctgatca 22095905



to top

>emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123_B09 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 155585

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                         
Query: 280   ttctcgaggccctggagagtcgccctacagatgctagcttcaatgctgccctgatcttga 339
             |||||||||| |||||||| |  || |||||||| |||||||  ||||||||||||||||
Sbjct: 85589 ttctcgaggctctggagagcctacccacagatgccagcttcagcgctgccctgatcttga 85530

                                                                         
Query: 340   tccacttacgtggcgacaaaggtgtcgctgccccttcactgctaaaaagctgagaaatga 399
              |||||| ||||| ||||| ||   |||  | | |||  ||||| ||| |||||||||||
Sbjct: 85529 cccacttgcgtggggacaatggcaccgcaactctttcgttgctagaaaactgagaaatga 85470

                                 
Query: 400   agctttgtatgagctgatca 419
             |  | |||||||||||||||
Sbjct: 85469 aattctgtatgagctgatca 85450



to top

>gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, complete sequence
          Length = 154129

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 100    gtactgctatttttaactaact 121
              ||||||||||||||||||||||
Sbjct: 147838 gtactgctatttttaactaact 147859



to top

>gb|AC158683.2| Mus musculus 6 BAC RP23-328P16 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 203488

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 100    gtactgctatttttaactaact 121
              ||||||||||||||||||||||
Sbjct: 144638 gtactgctatttttaactaact 144617



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 350     tggcgacaaaggtgtcgctgcc 371
               ||||||||||||||||||||||
Sbjct: 1642451 tggcgacaaaggtgtcgctgcc 1642472



to top

>gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, complete sequence
          Length = 236536

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 101    tactgctatttttaactaact 121
              |||||||||||||||||||||
Sbjct: 151714 tactgctatttttaactaact 151694



to top

>gb|AF442300.1| Kluyveromyces delphensis small subunit ribosomal RNA gene, partial
           sequence; mitochondrial gene for mitochondrial product
          Length = 594

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 107 tatttttaactaactatattattagattatata 139
           ||||| ||| ||| |||||||||||||||||||
Sbjct: 65  tatttataattaaatatattattagattatata 33



to top

>gb|AC026774.7| Homo sapiens chromosome 5 clone CTC-235G5, complete sequence
          Length = 108451

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 390   tgagaaatgaagctttgtatg 410
             |||||||||||||||||||||
Sbjct: 89575 tgagaaatgaagctttgtatg 89595



to top

>gb|AC120113.2| Homo sapiens chromosome 5 clone CTD-2324F19, complete sequence
          Length = 129346

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 390    tgagaaatgaagctttgtatg 410
              |||||||||||||||||||||
Sbjct: 127250 tgagaaatgaagctttgtatg 127230



to top

>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence
          Length = 339089

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 386   aagctgagaaatgaagctttg 406
             |||||||||||||||||||||
Sbjct: 39822 aagctgagaaatgaagctttg 39802



to top

>gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, complete sequence
          Length = 173710

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 376    cactgctaaaaagctgagaaatgaa 400
              |||| ||||||||||||||||||||
Sbjct: 136065 cacttctaaaaagctgagaaatgaa 136041



to top

>gb|AC134463.3| Mus musculus BAC clone RP23-425N12 from 5, complete sequence
          Length = 200629

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 376   cactgctaaaaagctgagaaatgaa 400
             |||| ||||||||||||||||||||
Sbjct: 89236 cacttctaaaaagctgagaaatgaa 89212



to top

>ref|XM_656095.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3583.2), mRNA
          Length = 2460

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 351  ggcgacaaaggtgtcgctgc 370
            ||||||||||||||||||||
Sbjct: 1522 ggcgacaaaggtgtcgctgc 1541



to top

>gb|AE017199.1| Nanoarchaeum equitans Kin4-M, complete genome
          Length = 490885

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 114   aactaactatattattagattata 137
             ||||||||||||||||| ||||||
Sbjct: 11008 aactaactatattattaaattata 10985



to top

>gb|AC125057.5| Mus musculus BAC clone RP23-399K1 from chromosome 12, complete sequence
          Length = 182276

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 213   cacactattcagcagggtcatgtt 236
             |||| |||||||||||||||||||
Sbjct: 18743 cacaatattcagcagggtcatgtt 18766



to top

>gb|AC123869.4| Mus musculus BAC clone RP23-245M16 from 12, complete sequence
          Length = 167795

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 213   cacactattcagcagggtcatgtt 236
             |||| |||||||||||||||||||
Sbjct: 20937 cacaatattcagcagggtcatgtt 20914



to top

>emb|AL591502.10| Human DNA sequence from clone RP11-199C17 on chromosome 9 Contains the
             5' end of the TBC1D2 gene for TBC1 domain family, member 2
             (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823), the 3' end
             of the GPR51 gene for G protein-coupled receptor 51 (HG20,
             GABBR2, GPRC3B, GABABR2) and a CpG island, complete
             sequence
          Length = 156753

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   gtaccagccttgcccttccc 260
             ||||||||||||||||||||
Sbjct: 13872 gtaccagccttgcccttccc 13891



to top

>emb|BX572083.6| Zebrafish DNA sequence from clone DKEY-232J4 in linkage group 13,
             complete sequence
          Length = 99030

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    ctgttgctaacaaatcacaa 31
             ||||||||||||||||||||
Sbjct: 98774 ctgttgctaacaaatcacaa 98793



to top

>gb|AF291662.1| Aspergillus nidulans Kex2-like dibasic endoprotease ANPC gene,
            complete cds
          Length = 4688

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 351  ggcgacaaaggtgtcgctgc 370
            ||||||||||||||||||||
Sbjct: 2268 ggcgacaaaggtgtcgctgc 2287



to top

>gb|AC096763.2| Homo sapiens BAC clone RP11-625A6 from 4, complete sequence
          Length = 168710

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 117   taactatattattagattatatac 140
             |||||||||||| |||||||||||
Sbjct: 49772 taactatattatgagattatatac 49749



to top

>gb|CP000235.1| Anaplasma phagocytophilum HZ, complete genome
          Length = 1471282

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 399    aagctttgtatgagctgatc 418
              ||||||||||||||||||||
Sbjct: 306895 aagctttgtatgagctgatc 306876



to top

>gb|AC102443.11| Mus musculus chromosome 3, clone RP24-191D1, complete sequence
          Length = 147088

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 384   aaaagctgagaaatgaagct 403
             ||||||||||||||||||||
Sbjct: 62951 aaaagctgagaaatgaagct 62970



to top

>gb|AF250284.1|AF250284 Amsacta moorei entomopoxvirus, complete genome
          Length = 232392

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tatattattagattatatac 140
              ||||||||||||||||||||
Sbjct: 136710 tatattattagattatatac 136691



to top

>dbj|AB056726.1| Emericella nidulans kexB mRNA for kexin like processing protease,
            complete cds
          Length = 2785

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 351  ggcgacaaaggtgtcgctgc 370
            ||||||||||||||||||||
Sbjct: 1622 ggcgacaaaggtgtcgctgc 1641



to top

>emb|BX323557.8| Zebrafish DNA sequence from clone DKEYP-86B9 in linkage group 5,
             complete sequence
          Length = 223754

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   tgtcacaattgttatccaca 216
             ||||||||||||||||||||
Sbjct: 35337 tgtcacaattgttatccaca 35318



to top

>emb|BX072549.4| Zebrafish DNA sequence from clone CH211-114A17 in linkage group 5,
             complete sequence
          Length = 167182

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   tgtcacaattgttatccaca 216
             ||||||||||||||||||||
Sbjct: 71794 tgtcacaattgttatccaca 71775



to top

>emb|AL732544.12| Zebrafish DNA sequence from clone BUSM1-6I1 in linkage group 7, complete
              sequence
          Length = 135141

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    actatattattagattatat 138
              ||||||||||||||||||||
Sbjct: 101378 actatattattagattatat 101359



to top

>dbj|AP001547.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-802F5, complete
              sequence
          Length = 144493

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     attagaacacaagctccaca 84
              ||||||||||||||||||||
Sbjct: 101873 attagaacacaagctccaca 101854



to top

>gb|AC147597.2| Gallus gallus BAC clone CH261-100D18 from chromosome unknown, complete
              sequence
          Length = 168372

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 392    agaaatgaagctttgtatgagctgatca 419
              |||||||||||||| ||||| |||||||
Sbjct: 161343 agaaatgaagctttatatgaactgatca 161316



to top

>dbj|AP004941.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT25N10, TM0109,
             complete sequence
          Length = 75234

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   taactatattattagattat 136
             ||||||||||||||||||||
Sbjct: 46809 taactatattattagattat 46828


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,849,954
Number of Sequences: 3902068
Number of extensions: 3849954
Number of successful extensions: 72456
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72337
Number of HSP's gapped (non-prelim): 119
length of query: 427
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 405
effective length of database: 17,147,199,772
effective search space: 6944615907660
effective search space used: 6944615907660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top