>gb|AC124918.5| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228052

 Score = 40.1 bits (20), Expect = 0.37
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aatgcccatgctatctaaag 37
              ||||||||||||||||||||
Sbjct: 136595 aatgcccatgctatctaaag 136576

>emb|AL590783.5| Human DNA sequence from clone RP11-397C12 on chromosome 1 Contains a
             novel gene, complete sequence
          Length = 157356

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 15    ccaaatgcccatgctatctaaag 37
             ||||||||||||||| |||||||
Sbjct: 53606 ccaaatgcccatgctttctaaag 53628

>emb|AL035698.12|HS69B13 Human DNA sequence from clone RP1-69B13 on chromosome 6q24.1-25.2
             Contains the 3' end of the GRM1 gene for metabotropic
             glutamate receptor 1, a phosphoribosyl pyrophosphate
             synthetase (PRPS1, PRPS2) pseudogene and a CpG island,
             complete sequence
          Length = 200317

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 17    aaatgcccatgctatctaaagca 39
             |||||||||||||| ||||||||
Sbjct: 70689 aaatgcccatgctagctaaagca 70667

>gb|AC092915.7| Homo sapiens 3 BAC RP11-585F20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 187215

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 17     aaatgcccatgctatctaaagca 39
              |||||||||||||| ||||||||
Sbjct: 166092 aaatgcccatgctacctaaagca 166070

>emb|AL117376.28|HSDJ971B4 Human DNA sequence from clone RP5-971B4 on chromosome 20 Contains the 3'
              end of the C20orf23 gene for a novel protein similar to
              KIF1 type and other kinesin-like proteins, complete
              sequence
          Length = 162213

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     cccatgctatctaaagca 39
              ||||||||||||||||||
Sbjct: 132884 cccatgctatctaaagca 132867

>emb|AL023655.1|HS242N11 Human DNA sequence from clone RP1-242N11 on chromosome 6p22.3-23,
              complete sequence
          Length = 167514

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 5      tcatggacgcccaaatgcccat 26
              ||||||| ||||||||||||||
Sbjct: 145598 tcatggatgcccaaatgcccat 145619

>gb|AC092942.10| Homo sapiens 3 BAC RP11-479J2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109907

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 18    aatgcccatgctatctaaagca 39
             ||||||||||||||| ||||||
Sbjct: 25315 aatgcccatgctatcaaaagca 25294

>gb|AC112510.9| Homo sapiens 3 BAC RP11-432A8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 192749

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 16    caaatgcccatgctatctaaag 37
             ||||||||||| ||||||||||
Sbjct: 98315 caaatgcccatcctatctaaag 98294

>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II,
              complete sequence
          Length = 867699

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 27     gctatctaaagcagctga 44
              ||||||||||||||||||
Sbjct: 718691 gctatctaaagcagctga 718674

>emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chromosome 4, complete
             sequence
          Length = 151555

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 20    tgcccatgctatctaaag 37
             ||||||||||||||||||
Sbjct: 20567 tgcccatgctatctaaag 20584

>emb|AL807250.9| Mouse DNA sequence from clone RP23-99K18 on chromosome X, complete
             sequence
          Length = 141025

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    ctatctaaagcagctgaa 45
             ||||||||||||||||||
Sbjct: 85051 ctatctaaagcagctgaa 85034


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 283,650
Number of Sequences: 3902068
Number of extensions: 283650
Number of successful extensions: 85339
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85316
Number of HSP's gapped (non-prelim): 23
length of query: 46
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 26
effective length of database: 17,155,003,908
effective search space: 446030101608
effective search space used: 446030101608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)