ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags5h01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 56 4e-05
2gb|AY165036.1| Lolium perenne methyl pectinesterase mRNA, partia... 56 4e-05
3dbj|AP003722.3| Oryza sativa (japonica cultivar-group) genomic D... 56 4e-05
4dbj|AK105998.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 4e-05
5ref|NM_183704.1| Oryza sativa (japonica cultivar-group), predic... 54 2e-04
6gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis thaliana... 42 0.62
7gb|AC051627.4|AC051627 Genomic Sequence For Arabidopsis thaliana... 42 0.62
8gb|AC123844.4| Mus musculus BAC clone RP23-416P14 from chromosom... 40 2.4
9gb|AC116659.3| Mus musculus BAC clone RP24-147E15 from 7, comple... 40 2.4
10ref|XM_649609.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 40 2.4
11gb|AC124600.5| Mus musculus BAC clone RP23-25H7 from chromosome ... 38 9.6
12emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 38 9.6
13gb|CP000107.1| Ehrlichia canis str. Jake, complete genome 38 9.6
14emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B... 38 9.6
15gb|AC134698.10| Homo sapiens chromosome 8, clone RP11-359P18, co... 38 9.6
16gb|AE011667.1| Xanthomonas axonopodis pv. citri str. 306, secti... 38 9.6
17gb|AF499777.1| Xanthomonas axonopodis pv. glycines strain 8ra hr... 38 9.6
18gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp ... 38 9.6
19gb|AC008094.5|AC008094 Drosophila melanogaster, chromosome 3R, r... 38 9.6
20dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic D... 38 9.6
21dbj|AP004233.3| Oryza sativa (japonica cultivar-group) genomic D... 38 9.6
22gb|AC010087.3| Homo sapiens BAC clone RP11-241M13 from 2, comple... 38 9.6
23gb|AY691911.1| Uncultured bacterium clone HZ28 unknown sequence 38 9.6
24gb|AY875714.2| Xanthomonas oryzae pv. oryzicola hrp gene cluster... 38 9.6
25gb|AE003677.3| Drosophila melanogaster chromosome 3R, section 15... 38 9.6
26dbj|AP000943.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 9.6
27dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 38 9.6
28gb|AC122217.4| Mus musculus BAC clone RP23-118J3 from 16, comple... 38 9.6
29gb|M99173.1|XANHRPA1A Xanthomonas campstris HrpA1 gene, complete... 38 9.6
30dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-... 38 9.6
31dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 38 9.6
32dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 38 9.6

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                           
Query: 73       gtcacagcccggcggagaangggatggacgtgccggcgagcca 115
                ||||||||||| ||| ||| |||| ||||||||||||||||||
Sbjct: 11733364 gtcacagcccgacggtgaaggggacggacgtgccggcgagcca 11733322



 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 38       tttatatgatatgatgata 56
                |||||||||||||||||||
Sbjct: 20016026 tttatatgatatgatgata 20016044



to top

>gb|AY165036.1| Lolium perenne methyl pectinesterase mRNA, partial cds
          Length = 970

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 98/124 (79%), Gaps = 1/124 (0%)
 Strand = Plus / Minus

                                                                       
Query: 71  cggtcacagcccggcggagaangggatggacgtgccggcgagccagnnnnnnnnnatcga 130
           |||||||| ||||| |||||| |||||||| |||||||| ||||||          ||||
Sbjct: 685 cggtcacaacccggtggagaaggggatggaagtgccggctagccagacgtcgccg-tcga 627

                                                                       
Query: 131 tgaaggagcccaccgcgaaggtgctggcctccgatgcgctggtgangacgcggnacccct 190
           |||| || ||||| | |||||||||||||||||| | |||| |||  |||||| | ||||
Sbjct: 626 tgaatgaccccacagtgaaggtgctggcctccgacgagctgctgatcacgcggtaaccct 567

               
Query: 191 tcca 194
           ||||
Sbjct: 566 tcca 563



to top

>dbj|AP003722.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1011A07
          Length = 150590

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                        
Query: 73    gtcacagcccggcggagaangggatggacgtgccggcgagcca 115
             ||||||||||| ||| ||| |||| ||||||||||||||||||
Sbjct: 72532 gtcacagcccgacggtgaaggggacggacgtgccggcgagcca 72490



to top

>dbj|AK105998.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-H08, full
            insert sequence
          Length = 1488

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 73   gtcacagcccggcggagaangggatggacgtgccggcgagcca 115
            ||||||||||| ||| ||| |||| ||||||||||||||||||
Sbjct: 1288 gtcacagcccgacggtgaaggggacggacgtgccggcgagcca 1246



to top

>ref|NM_183704.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 888

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 74  tcacagcccggcggagaangggatggacgtgccggcgagcca 115
           |||||||||| ||| ||| |||| ||||||||||||||||||
Sbjct: 888 tcacagcccgacggtgaaggggacggacgtgccggcgagcca 847



to top

>gb|AC069328.1|AC069328 Genomic Sequence For Arabidopsis thaliana Clone T28N17 From Chromosome
             V, complete sequence
          Length = 75593

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 35    tgctttatatgatatgatgat 55
             |||||||||||||||||||||
Sbjct: 14997 tgctttatatgatatgatgat 15017



to top

>gb|AC051627.4|AC051627 Genomic Sequence For Arabidopsis thaliana Clone T1A4 From Chromosome V,
             complete sequence
          Length = 85746

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 35    tgctttatatgatatgatgat 55
             |||||||||||||||||||||
Sbjct: 74036 tgctttatatgatatgatgat 74056



to top

>gb|AC123844.4| Mus musculus BAC clone RP23-416P14 from chromosome 7, complete sequence
          Length = 198721

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    tgatagaagaagaattggtc 71
             ||||||||||||||||||||
Sbjct: 49412 tgatagaagaagaattggtc 49431



to top

>gb|AC116659.3| Mus musculus BAC clone RP24-147E15 from 7, complete sequence
          Length = 140476

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    tgatagaagaagaattggtc 71
             ||||||||||||||||||||
Sbjct: 96651 tgatagaagaagaattggtc 96670



to top

>ref|XM_649609.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (46.t00028)
           partial mRNA
          Length = 528

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  atgatatgatgatagaagaa 62
           ||||||||||||||||||||
Sbjct: 461 atgatatgatgatagaagaa 480



to top

>gb|AC124600.5| Mus musculus BAC clone RP23-25H7 from chromosome 16, complete sequence
          Length = 225102

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 35     tgctttatatgatatgatg 53
              |||||||||||||||||||
Sbjct: 198284 tgctttatatgatatgatg 198302



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 153    gctggcctccgatgcgctggtga 175
              ||||||||||||||||| |||||
Sbjct: 484206 gctggcctccgatgcgccggtga 484228



to top

>gb|CP000107.1| Ehrlichia canis str. Jake, complete genome
          Length = 1315030

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     atatgatgatagaagaaga 64
              |||||||||||||||||||
Sbjct: 667303 atatgatgatagaagaaga 667321



to top

>emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B3 on chromosome 6q16.1-16.3
             Contains part of the GRIK2 gene for glutamate receptor
             ionotropic kainate 2, complete sequence
          Length = 147603

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 44    tgatatgatgatagaagaa 62
             |||||||||||||||||||
Sbjct: 65266 tgatatgatgatagaagaa 65248



to top

>gb|AC134698.10| Homo sapiens chromosome 8, clone RP11-359P18, complete sequence
          Length = 173305

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 140    ccaccgcgaaggtgctggcctcc 162
              |||||| ||||||||||||||||
Sbjct: 153432 ccaccgggaaggtgctggcctcc 153454



to top

>gb|AE011667.1| Xanthomonas axonopodis pv. citri str. 306,  section 45 of 469 of the
            complete genome
          Length = 11789

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 153  gctggcctccgatgcgctggtga 175
            ||||||||||||||||| |||||
Sbjct: 1049 gctggcctccgatgcgccggtga 1071



to top

>gb|AF499777.1| Xanthomonas axonopodis pv. glycines strain 8ra hrp pathogenicity
            island, complete sequence
          Length = 29206

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 153  gctggcctccgatgcgctggtga 175
            ||||||||||||||||| |||||
Sbjct: 5969 gctggcctccgatgcgccggtga 5947



to top

>gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp gene cluster, partial
            sequence
          Length = 16929

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 153  gctggcctccgatgcgctggtga 175
            ||||||||||||||||| |||||
Sbjct: 7005 gctggcctccgatgcgccggtga 7027



to top

>gb|AC008094.5|AC008094 Drosophila melanogaster, chromosome 3R, region 84F-84F, BAC clone
             BACR45A07, complete sequence
          Length = 170498

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    tatatgatatgatgataga 58
             |||||||||||||||||||
Sbjct: 35991 tatatgatatgatgataga 36009



to top

>dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBa0062A24
          Length = 148362

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     tttatatgatatgatgata 56
              |||||||||||||||||||
Sbjct: 118935 tttatatgatatgatgata 118953



to top

>dbj|AP004233.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0065J17
          Length = 139014

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    tttatatgatatgatgata 56
             |||||||||||||||||||
Sbjct: 13988 tttatatgatatgatgata 14006



to top

>gb|AC010087.3| Homo sapiens BAC clone RP11-241M13 from 2, complete sequence
          Length = 202029

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 49     tgatgatagaagaagaattggtc 71
              |||||||||||||||||| ||||
Sbjct: 148035 tgatgatagaagaagaatgggtc 148013



to top

>gb|AY691911.1| Uncultured bacterium clone HZ28 unknown sequence
          Length = 5608

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 98  ggacgtgccggcgagccag 116
           |||||||||||||||||||
Sbjct: 465 ggacgtgccggcgagccag 483



to top

>gb|AY875714.2| Xanthomonas oryzae pv. oryzicola hrp gene cluster, partial sequence
          Length = 9612

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 153  gctggcctccgatgcgctggtga 175
            ||||||||||||||||| |||||
Sbjct: 1999 gctggcctccgatgcgccggtga 1977



to top

>gb|AE003677.3| Drosophila melanogaster chromosome 3R, section 15 of 118 of the complete
              sequence
          Length = 228314

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 40     tatatgatatgatgataga 58
              |||||||||||||||||||
Sbjct: 186249 tatatgatatgatgataga 186267



to top

>dbj|AP000943.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-867G2, complete
             sequence
          Length = 192299

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 22    aggacgaatngggtgctttata 43
             ||||||||| ||||||||||||
Sbjct: 89481 aggacgaattgggtgctttata 89460



to top

>dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-482B5, complete
              sequence
          Length = 188161

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     tgatatgatgatagaagaa 62
              |||||||||||||||||||
Sbjct: 121050 tgatatgatgatagaagaa 121068



to top

>gb|AC122217.4| Mus musculus BAC clone RP23-118J3 from 16, complete sequence
          Length = 222795

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    tgctttatatgatatgatg 53
             |||||||||||||||||||
Sbjct: 11049 tgctttatatgatatgatg 11067



to top

>gb|M99173.1|XANHRPA1A Xanthomonas campstris HrpA1 gene, complete cds
          Length = 1824

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 153  gctggcctccgatgcgctggtga 175
            ||||||||||||||||| |||||
Sbjct: 978  gctggcctccgatgcgccggtga 1000



to top

>dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region,
             section 2/4
          Length = 300000

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    tgatatgatgatagaagaa 62
             |||||||||||||||||||
Sbjct: 30797 tgatatgatgatagaagaa 30815



to top

>dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:706L14, complete
              sequence
          Length = 156242

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 44     tgatatgatgatagaagaa 62
              |||||||||||||||||||
Sbjct: 124024 tgatatgatgatagaagaa 124042



to top

>dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:515A4, complete
             sequence
          Length = 194732

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 44    tgatatgatgatagaagaa 62
             |||||||||||||||||||
Sbjct: 20718 tgatatgatgatagaagaa 20736


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,118,591
Number of Sequences: 3902068
Number of extensions: 1118591
Number of successful extensions: 65527
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65331
Number of HSP's gapped (non-prelim): 196
length of query: 194
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 172
effective length of database: 17,147,199,772
effective search space: 2949318360784
effective search space used: 2949318360784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top