ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags5f20 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 484 bits (244), Expect = e-133 Identities = 244/244 (100%) Strand = Plus / Minus Query: 420 cttggagcaatcggttctggggctgatggcgtaggggatgttgacgccgcacttgctggg 479 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2791 cttggagcaatcggttctggggctgatggcgtaggggatgttgacgccgcacttgctggg 2732 Query: 480 gatgccggcgacgaggtcgggcttgatgccgcccatgccgctcgtctgctgcttgaggca 539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2731 gatgccggcgacgaggtcgggcttgatgccgcccatgccgctcgtctgctgcttgaggca 2672 Query: 540 ggtgcaggtggcttggcggtcggcgggggtggcagccgccgcgttaaggctacgcacgcc 599 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2671 ggtgcaggtggcttggcggtcggcgggggtggcagccgccgcgttaaggctacgcacgcc 2612 Query: 600 cgtgcagcagcccccgccaggtgcacgctccctgcccatagcgtaaccgatacacggcgc 659 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2611 cgtgcagcagcccccgccaggtgcacgctccctgcccatagcgtaaccgatacacggcgc 2552 Query: 660 cagg 663 |||| Sbjct: 2551 cagg 2548
>gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complete sequence Length = 114996 Score = 301 bits (152), Expect = 2e-78 Identities = 197/212 (92%) Strand = Plus / Plus Query: 2 acatgtaactttgcttgtccgctctacgtggggtataatcatagaccgtgcgtgttcgcc 61 ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| | | Sbjct: 62851 acatgcaactttgcttgtccgctctacgtggggtacaatcatagaccgtgcgtgtctgtc 62910 Query: 62 gggcgaacgggtgatacaaatagataaaaaacaaacaatattagtgtccacttaaatcgg 121 |||||||||||||||||||||||||||||||| ||||||||| | |||| || |||||| Sbjct: 62911 aggcgaacgggtgatacaaatagataaaaaacagacaatattattatccatttgaatcgg 62970 Query: 122 tgtgttagagttgttctaatgcagctttcggggccatttctatgttcaaaagaaagctcc 181 || ||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 62971 tgcgttggagttgttctaatgcagctttcggggccatttctatgttcaaaagaaaactcc 63030 Query: 182 tatacgttccatttggtgtatgtggcgctgag 213 ||||||| |||||||||||||||||||||||| Sbjct: 63031 tatacgtgccatttggtgtatgtggcgctgag 63062 Score = 95.6 bits (48), Expect = 2e-16 Identities = 57/60 (95%) Strand = Plus / Plus Query: 364 tctcaagggtaaatatgacccatatatcccaccctcgtgtcttggcttgcttgattcttg 423 ||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||| Sbjct: 63734 tctcaagggaaaatatgacccatatatctcatcctcgtgtcttggcttgcttgattcttg 63793 Score = 60.0 bits (30), Expect = 1e-05 Identities = 33/34 (97%) Strand = Plus / Plus Query: 237 actgaacgtgatggttgcggtgcgtgggacccaa 270 |||||||||||| ||||||||||||||||||||| Sbjct: 63076 actgaacgtgatagttgcggtgcgtgggacccaa 63109 Score = 58.0 bits (29), Expect = 4e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 306 tatagagcgaagcccacatctcctcctga 334 ||||||||||||||||||||||||||||| Sbjct: 63118 tatagagcgaagcccacatctcctcctga 63146
>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA, complete cds Length = 841 Score = 272 bits (137), Expect = 1e-69 Identities = 161/169 (95%) Strand = Plus / Minus Query: 443 tgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcgggct 502 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcgacgaggtcgggct 342 Query: 503 tgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcggtcgg 562 |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| Sbjct: 341 tgatgccgcccatgccgctcgtctgctgcttgaggcagctgcaggtggcctggcggtcgg 282 Query: 563 cgggggtggcagccgccgcgttaaggctacgcacgcccgtgcagcagcc 611 ||| ||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 281 cggtggtggaggccgccgcgttaaggctacgcacgccgctgcagcagcc 233
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 172 bits (87), Expect = 9e-40 Identities = 117/127 (92%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 14437049 gggctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 14436990 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | ||||||||||||||||||||||||||||| ||||| |||||||| ||| || Sbjct: 14436989 ggcctcaggccgcccatgccgctcgtctgctgcttgatgcaggcgcaggtggtctggtgg 14436930 Query: 559 tcggcgg 565 ||||||| Sbjct: 14436929 tcggcgg 14436923 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 84 gataaaaaacaaacaatatt 103 |||||||||||||||||||| Sbjct: 1837529 gataaaaaacaaacaatatt 1837510
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 172 bits (87), Expect = 9e-40 Identities = 117/127 (92%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 45547 gggctgatggcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 45488 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | ||||||||||||||||||||||||||||| ||||| |||||||| ||| || Sbjct: 45487 ggcctcaggccgcccatgccgctcgtctgctgcttgatgcaggcgcaggtggtctggtgg 45428 Query: 559 tcggcgg 565 ||||||| Sbjct: 45427 tcggcgg 45421
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 722712 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 722653 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 722652 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 722593 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 722592 tcggcggtggtggc 722579 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 732602 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 732551 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 745552 gttgacgccgcacttgccggggatgccggcg 745522 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 736726 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 736678 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 |||||||||||| |||| ||||| |||||||||| Sbjct: 760344 gttgacgccgcatttgccggggacgccggcgacg 760311
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 679454 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 679395 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 679394 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 679335 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 679334 tcggcggtggtggc 679321 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 692750 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 692699 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 714842 gttgacgccgcacttgccggggatgccggcg 714812 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 722372 gttgacgccgcacttgccggggacgccggcgacg 722339 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 13090040 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 13089992 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 702424 gctgatggtgtaggggacgctgacgccgcactt 702392
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 415 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 356 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 355 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 296 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 295 tcggcggtggtggc 282
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 3501 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 3442 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 3441 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 3382 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 3381 tcggcggtggtggc 3368
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 417 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 358 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 357 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 298 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 297 tcggcggtggtggc 284
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 419 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 360 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 359 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 300 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 299 tcggcggtggtggc 286
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 679454 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 679395 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 679394 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 679335 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 679334 tcggcggtggtggc 679321 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 692750 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 692699 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 714842 gttgacgccgcacttgccggggatgccggcg 714812 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 722372 gttgacgccgcacttgccggggacgccggcgacg 722339 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 13170219 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 13170171 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 702424 gctgatggtgtaggggacgctgacgccgcactt 702392
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 722712 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 722653 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 722652 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 722593 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 722592 tcggcggtggtggc 722579 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 732602 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 732551 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 745552 gttgacgccgcacttgccggggatgccggcg 745522 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 736726 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 736678 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 |||||||||||| |||| ||||| |||||||||| Sbjct: 760344 gttgacgccgcatttgccggggacgccggcgacg 760311
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Plus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 56422 gggctgatagcgtaggggatgttgacgccgcacttggaggggatgccggcgacgaggtcg 56481 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 56482 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 56541 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 56542 tcggcggtggtggc 56555 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 46532 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 46583 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 33582 gttgacgccgcacttgccggggatgccggcg 33612 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Plus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 42408 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 42456 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Plus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 |||||||||||| |||| ||||| |||||||||| Sbjct: 18790 gttgacgccgcatttgccggggacgccggcgacg 18823
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 170 bits (86), Expect = 4e-39 Identities = 122/134 (91%) Strand = Plus / Plus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 63518 gggctgatggcgtaggggatgttgacgtcgcacttggaggggatgccggcgacgaggtcg 63577 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 63578 ggcctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 63637 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 63638 tcggcggtggtggc 63651 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 50222 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 50273 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 28130 gttgacgccgcacttgccggggatgccggcg 28160 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 20600 gttgacgccgcacttgccggggacgccggcgacg 20633 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 40548 gctgatggtgtaggggacgctgacgccgcactt 40580
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein Length = 372 Score = 143 bits (72), Expect = 8e-31 Identities = 112/126 (88%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 ||||||||| ||||||||||||||||| |||||||| |||||||||| ||||||||||| Sbjct: 126 gggctgatgccgtaggggatgttgacgtcgcacttggaggggatgccgncgacgaggtcg 67 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 | | | | |||||||||| |||| ||||||||||||||||||| |||||||| |||||| Sbjct: 66 gncctcaggccgcccatggcgctggtctgctgcttgaggcaggcgcaggtggtctggcgg 7 Query: 559 tcggcg 564 |||||| Sbjct: 6 tcggcg 1
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds Length = 766 Score = 123 bits (62), Expect = 8e-25 Identities = 116/134 (86%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcgacgaggtcg 498 |||||||| ||||||||||||||||| ||||||||| |||||||||||||||| ||||| Sbjct: 369 gggctgatagcgtaggggatgttgaccccgcacttggaggggatgccggcgacgtggtcg 310 Query: 499 ggcttgatgccgcccatgccgctcgtctgctgcttgaggcaggtgcaggtggcttggcgg 558 ||| | | | ||||||| | | ||||||||||||||||||| |||||||| |||||| Sbjct: 309 ggcctcagccggcccatggccttggtctgctgcttgaggcaggcgcaggtggtctggcgg 250 Query: 559 tcggcgggggtggc 572 ||||||| |||||| Sbjct: 249 tcggcggtggtggc 236
>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA, complete cds Length = 650 Score = 79.8 bits (40), Expect = 1e-11 Identities = 43/44 (97%) Strand = Plus / Minus Query: 450 gtaggggatgttgacgccgcacttgctggggatgccggcgacga 493 |||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcgacga 306
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 65.9 bits (33), Expect = 2e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||||| | ||||||||||| |||||||||||||| Sbjct: 384 gctgatggcgtaggggatgctaacgccgcactttgtggggatgccggcg 336
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 455 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 404
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 687 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 636
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 317 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 266
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 94 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 145
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 640 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 589
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 423 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 372
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 405 ggggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 354
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Minus Query: 439 gggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 322 gggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 272
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 369 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 327 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 288
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 445 atggcgtaggggatgttgacgccgcacttgctggggatgcc 485 ||||||||||||||| |||||||||||||| ||||||||| Sbjct: 314 atggcgtaggggatgctgacgccgcacttggaggggatgcc 274
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| | ||||||||||| || ||||||||||||| Sbjct: 332 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 284
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 948 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 900
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| | ||||||||||| || ||||||||||||| Sbjct: 377 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 329
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| | | ||||||||||| |||||||||||||| Sbjct: 1575 gctgatggcgtaggggacgctaacgccgcactttgtggggatgccggcg 1527
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| | | ||||||||||| |||||||||||||| Sbjct: 1587 gctgatggcgtaggggacgctaacgccgcactttgtggggatgccggcg 1539
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 406 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 358
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| ||||||||||||| Sbjct: 403 gctgatggagtaggggacgctgacgccgcacttggaggggatgccggcg 355
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 316 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 268 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 226 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 187
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 260 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 218 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 179
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 308 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 260 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 218 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 179
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 417 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 369
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 399 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 351 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 309 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 270
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 324 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 276 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 234 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 195
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 423 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 375 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 333 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 294
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 388 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 346 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 307
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 438 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 390 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 348 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 309
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 385 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 343 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 304
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 436 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 388 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 346 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 307
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 385 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 343 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 304
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 433 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 385 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 343 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 304
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 386 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 344 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 305
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 327 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 279
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 253
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 253
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 397 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 349
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 350
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 247 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 199 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 157 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 118
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 58.0 bits (29), Expect = 4e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||||| |||||||||||||| |||||||| |||| Sbjct: 434 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcg 386 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 344 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 305
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 56.0 bits (28), Expect = 2e-04 Identities = 46/52 (88%) Strand = Plus / Minus Query: 438 ggggctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||| ||||||||| |||||||||||||| |||||||| |||| Sbjct: 400 ggggctgatggtgtaggggatcgtgacgccgcacttggaggggatgctggcg 349
>gb|AF439446.1|AF439446 Setaria italica lipid transfer protein mRNA, complete cds Length = 851 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 462 gacgccgcacttgctggggatgccggcgacg 492 |||||||||||||| |||||||||||||||| Sbjct: 381 gacgccgcacttgccggggatgccggcgacg 351
>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full insert sequence Length = 760 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 397 gttgacgccgcacttgccggggatgccggcg 367
>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full insert sequence Length = 2914 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 2484 gttgacgccgcacttgccggggatgccggcg 2454
>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full insert sequence Length = 646 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 391 gttgacgccgcacttgccggggatgccggcg 361
>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full insert sequence Length = 928 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 396 gttgacgccgcacttgccggggatgccggcg 366
>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full insert sequence Length = 853 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 391 gttgacgccgcacttgccggggatgccggcg 361
>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full insert sequence Length = 773 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| ||||||||||||| Sbjct: 396 gttgacgccgcacttgccggggatgccggcg 366
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 318 gctgatggagtaggggatgctgacgccgcacttg 285
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 318 gctgatggagtaggggatgctgacgccgcacttg 285
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 3174 gctgatggagtaggggatgctgacgccgcacttg 3141
>gb|AC123514.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0004B05, complete sequence Length = 121223 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 663 gttgacgccgcacttgccggggacgccggcgacg 630
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 378 gctgatggagtaggggatgctgacgccgcacttg 345
>dbj|AK064888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K13, full insert sequence Length = 737 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 439 gttgacgccgcacttgccggggacgccggcgacg 406
>dbj|AK061740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-E11, full insert sequence Length = 1437 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 1121 gttgacgccgcacttgccggggacgccggcgacg 1088
>dbj|AK060108.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C09, full insert sequence Length = 1196 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| |||||||||| Sbjct: 391 gttgacgccgcacttgccggggacgccggcgacg 358
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 301 gctgatggtgtaggggatgctgacgccgcacttg 268 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 211 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 172
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttg 474 |||||||| |||||||||| |||||||||||||| Sbjct: 398 gctgatggtgtaggggatgctgacgccgcacttg 365
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Plus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 94040 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 94088
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgcc 485 ||||||||||||||||| | | ||||||||||| |||||||||| Sbjct: 318 gctgatggcgtaggggacgctaacgccgcactttgtggggatgcc 274
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgcc 485 ||||||||||||||||| | | ||||||||||| |||||||||| Sbjct: 318 gctgatggcgtaggggacgctaacgccgcactttgtggggatgcc 274
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||||||| |||| | | ||||||||||| |||||||||||||| Sbjct: 283 gctgatggcgtaagggacgctaacgccgcactttgtggggatgccggcg 235
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 ||||||||||||||||| | ||||||||||| || |||||| |||||| Sbjct: 1347 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 1299
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 277 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 229
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 980 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 932
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 421 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 373
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 396 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 348
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 440 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 392
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 439 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 391
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 653 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 605
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| |||||||| | |||||||||||||| |||||||| |||| Sbjct: 421 gctgatggtgtaggggacgctgacgccgcacttggaggggatgctggcg 373
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||| ||||||||| |||||||||||||| |||||||| |||| Sbjct: 302 gctgatggtataggggatgctgacgccgcacttggaggggatgctggcg 254 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 212 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 173
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 48.1 bits (24), Expect = 0.037 Identities = 42/48 (87%) Strand = Plus / Minus Query: 442 ctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||||||||||| | ||||||||||| || |||||| |||||| Sbjct: 981 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 934
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 48.1 bits (24), Expect = 0.037 Identities = 42/48 (87%) Strand = Plus / Minus Query: 442 ctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 489 |||||||||||||||| | ||||||||||| || |||||| |||||| Sbjct: 2377 ctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 2330
>ref|XM_600291.2| PREDICTED: Bos taurus similar to PYRIN-containing APAF1-like protein 7 isoform 2 (LOC522018), mRNA Length = 2934 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 525 ctgctgcttgaggcaggtgcag 546 |||||||||||||||||||||| Sbjct: 1251 ctgctgcttgaggcaggtgcag 1230
>emb|AJ704771.1| Oryza sativa (japonica cultivar-group) mRNA for lipid transfer protein (ltp2 gene) Length = 417 Score = 44.1 bits (22), Expect = 0.58 Identities = 31/34 (91%) Strand = Plus / Minus Query: 459 gttgacgccgcacttgctggggatgccggcgacg 492 ||||||||||||||||| ||||| ||| |||||| Sbjct: 339 gttgacgccgcacttgccggggacgccagcgacg 306
>ref|XM_512395.1| PREDICTED: Pan troglodytes similar to zHuC (LOC455732), mRNA Length = 1158 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 609 gcccccgccaggtgcacgctccctg 633 ||||||||||||||||| ||||||| Sbjct: 546 gcccccgccaggtgcaccctccctg 522
>ref|XM_475420.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 417 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggc 563 ||||||||||||||||| ||| |||||||||| Sbjct: 267 cttgaggcaggtgcaggcggcgcggcggtcggc 235
>gb|AC144737.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0018K15, complete sequence Length = 168519 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggc 563 ||||||||||||||||| ||| |||||||||| Sbjct: 50083 cttgaggcaggtgcaggcggcgcggcggtcggc 50051
>gb|AC135637.5| Mus musculus BAC clone RP23-298I23 from chromosome 14, complete sequence Length = 130323 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 82 tagataaaaaacaaacaatat 102 ||||||||||||||||||||| Sbjct: 75388 tagataaaaaacaaacaatat 75368
>gb|AC121595.3| Mus musculus BAC clone RP23-299A12 from chromosome X, complete sequence Length = 214297 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 aaatagataaaaaacaaacaa 99 ||||||||||||||||||||| Sbjct: 107476 aaatagataaaaaacaaacaa 107496
>gb|AC156941.3| Mus musculus BAC clone RP23-25D8 from chromosome 14, complete sequence Length = 214940 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 82 tagataaaaaacaaacaatat 102 ||||||||||||||||||||| Sbjct: 24912 tagataaaaaacaaacaatat 24932
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 409 gctgatggtgtaggggacgctgacgccgcactt 377
>emb|AL627346.14| Mouse DNA sequence from clone RP23-313I9 on chromosome 11, complete sequence Length = 100292 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 87 aaaaaacaaacaatattagtg 107 ||||||||||||||||||||| Sbjct: 63302 aaaaaacaaacaatattagtg 63282
>gb|AC008481.9| Homo sapiens chromosome 19 clone CTC-398G3, complete sequence Length = 142645 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 609 gcccccgccaggtgcacgctccctg 633 ||||||||||||||||| ||||||| Sbjct: 42423 gcccccgccaggtgcaccctccctg 42447
>gb|AC093416.2| Homo sapiens chromosome 3 clone RP11-659P16, complete sequence Length = 189308 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 aaatagataaaaaacaaacaa 99 ||||||||||||||||||||| Sbjct: 156264 aaatagataaaaaacaaacaa 156284
>gb|AF200742.1|AF200742 Azoarcus sp. BH72 Mo-nitrogenase operon, complete sequence Length = 6480 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 488 cgacgaggtcgggcttgatgc 508 ||||||||||||||||||||| Sbjct: 2895 cgacgaggtcgggcttgatgc 2875
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggc 563 ||||||||||||||||| ||| |||||||||| Sbjct: 23364547 cttgaggcaggtgcaggcggcgcggcggtcggc 23364515
>emb|BX548056.3| Mouse DNA sequence from clone RP23-240D4 on chromosome X, complete sequence Length = 110099 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 79 aaatagataaaaaacaaacaa 99 ||||||||||||||||||||| Sbjct: 25889 aaatagataaaaaacaaacaa 25869
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 2428 gctgatggtgtaggggacgctgacgccgcactt 2396
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 305 gctgatggtgtaggggacgctgacgccgcactt 273
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 441 gctgatggcgtaggggatgttgacgccgcactt 473 |||||||| |||||||| | ||||||||||||| Sbjct: 356 gctgatggtgtaggggacgctgacgccgcactt 324
>emb|AL929191.9| Mouse DNA sequence from clone RP23-330G15 on chromosome 2, complete sequence Length = 192196 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 81 atagataaaaaacaaacaata 101 ||||||||||||||||||||| Sbjct: 44304 atagataaaaaacaaacaata 44284
>gb|AC134566.5| Mus musculus BAC clone RP24-196G8 from 3, complete sequence Length = 147839 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 77 acaaatagataaaaaacaaacaata 101 ||||||||| ||||||||||||||| Sbjct: 4395 acaaatagacaaaaaacaaacaata 4419
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 522 cgtctgctgcttgaggcagg 541 |||||||||||||||||||| Sbjct: 352102 cgtctgctgcttgaggcagg 352121
>gb|AC169701.1| Rhesus Macaque BAC CH250-11P19 (Children's Hospital Oakland Research Institute Rhesus macaque Adult Male BAC Library) complete sequence Length = 166264 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 aaaaaacaaacaatattagt 106 |||||||||||||||||||| Sbjct: 46910 aaaaaacaaacaatattagt 46891
>gb|BC101393.2| Homo sapiens zinc finger protein 614, mRNA (cDNA clone MGC:120638 IMAGE:40026901), complete cds Length = 2780 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 145 aatattagtgtccacttaaa 126
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome Length = 5237682 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 4194665 ataaaaaacaaacaatatta 4194684
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome Length = 5227419 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 4205506 ataaaaaacaaacaatatta 4205525
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome Length = 5228663 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 4205878 ataaaaaacaaacaatatta 4205897
>gb|AC147570.3| Homo sapiens BAC clone RP11-1176F21 from UL, complete sequence Length = 191237 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 159812 catctcctcctgagcctctg 159793
>gb|DQ069668.1| Ginkgo biloba photosystem I subunit VIII (psaI) gene, partial cds; chloroplast Length = 108 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 157 atttctatgttcaaaagaaa 176 |||||||||||||||||||| Sbjct: 80 atttctatgttcaaaagaaa 99
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 gatgccggcgacgaggtcgg 499 |||||||||||||||||||| Sbjct: 321682 gatgccggcgacgaggtcgg 321701
>gb|AC105457.1| Homo sapiens chromosome 21 clone RP11-271G11 map p11-q21.1, complete sequence Length = 164841 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 31396 catctcctcctgagcctctg 31415
>gb|AC105297.35| Mus musculus strain C57BL/6J clone rp23-14k19 map 17, complete sequence Length = 236275 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 182 tatacgttccatttggtgtatgtg 205 |||| ||||||||||||||||||| Sbjct: 127681 tatatgttccatttggtgtatgtg 127658
>gb|AY518541.1| Homo sapiens endothelin 2 (EDN2) gene, complete cds Length = 9704 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 392 ccaccctcgtgtcttggctt 411 |||||||||||||||||||| Sbjct: 8088 ccaccctcgtgtcttggctt 8069
>ref|XM_818195.1| Trypanosoma brucei TREU927 hypothetical protein (Tb10.406.0230) partial mRNA Length = 2982 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 512 ccatgccgctcgtctgctgc 531 |||||||||||||||||||| Sbjct: 2816 ccatgccgctcgtctgctgc 2797
>ref|XM_724080.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01407) partial mRNA Length = 2231 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 730 ataaaaaacaaacaatatta 749
>ref|XM_856358.1| PREDICTED: Canis familiaris hypothetical protein LOC608347 (LOC608347), mRNA Length = 948 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 557 ggtcggcgggggtggcagccgccg 580 ||||||||||||| |||||||||| Sbjct: 537 ggtcggcgggggtcgcagccgccg 560
>gb|AC128862.4| Rattus norvegicus 4 BAC CH230-419L6 (Children's Hospital Oakland Research Institute) complete sequence Length = 184149 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 281 tgacatgttcatctttccttataa 304 |||||||||||||||||| ||||| Sbjct: 94990 tgacatgttcatctttccatataa 94967
>gb|CP000001.1| Bacillus cereus E33L, complete genome Length = 5300915 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 4248977 ataaaaaacaaacaatatta 4248996
>gb|AC135798.31| Medicago truncatula clone mth2-31c16, complete sequence Length = 123159 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 gtgatacaaatagataaaaa 91 |||||||||||||||||||| Sbjct: 23683 gtgatacaaatagataaaaa 23664
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 480 gatgccggcgacgaggtcgg 499 |||||||||||||||||||| Sbjct: 402477 gatgccggcgacgaggtcgg 402496
>emb|AL445933.32| Human DNA sequence from clone RP11-486B10 on chromosome 1 Contains the EDN2 gene for endothelin 2, the 3' end of the HIVEP3 gene for human immunodeficiency virus type I enhancer binding protein 3 and a novel gene, complete sequence Length = 154153 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 392 ccaccctcgtgtcttggctt 411 |||||||||||||||||||| Sbjct: 43862 ccaccctcgtgtcttggctt 43881
>emb|AL391382.10| Human DNA sequence from clone RP11-38M15 on chromosome 13 Contains a chromosome 21 open reading frame 70 (C21orf70) pseudogene, two novel genes, a calponin 3 acidic (CNN3) pseudogene, a zinc finger protein 267 (ZNF267) pseudogene, two novel pseudogenes, a novel gene similar to chromosome 21 open reading frame 15 (C21orf15), a pseudogene similar to cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8) (CPF8, CYPIVF8), a pseudogene similar to sorting nexin 18 (SNX18), a melanoma antigen pseudogene and a CpG island, complete sequence Length = 186458 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 67738 catctcctcctgagcctctg 67757
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 gttcgccgggcgaacgggtg 74 |||||||||||||||||||| Sbjct: 1900587 gttcgccgggcgaacgggtg 1900606
>emb|X92648.1|HALTP H.annuus mRNA for non-specific lipid-transfer protein Length = 520 Score = 40.1 bits (20), Expect = 9.1 Identities = 47/56 (83%) Strand = Plus / Minus Query: 420 cttggagcaatcggttctggggctgatggcgtaggggatgttgacgccgcacttgc 475 ||||||||||||||| || |||||||| ||| |||||| |||| || ||||||| Sbjct: 381 cttggagcaatcggtgcttgggctgatcttgtaagggatgctgacaccacacttgc 326
>gb|BC101394.1| Homo sapiens zinc finger protein 614, mRNA (cDNA clone MGC:120639 IMAGE:40026907), complete cds Length = 2782 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 145 aatattagtgtccacttaaa 126
>gb|BC101392.1| Homo sapiens zinc finger protein 614, mRNA (cDNA clone MGC:120637 IMAGE:40026900), complete cds Length = 2781 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 145 aatattagtgtccacttaaa 126
>gb|BC101395.1| Homo sapiens zinc finger protein 614, mRNA (cDNA clone MGC:120640 IMAGE:40026909), complete cds Length = 2782 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 145 aatattagtgtccacttaaa 126
>gb|BC031859.2| Homo sapiens cDNA clone IMAGE:4822573 Length = 1678 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 aatagataaaaaacaaacaa 99 |||||||||||||||||||| Sbjct: 1098 aatagataaaaaacaaacaa 1079
>emb|CR858278.1| Pongo pygmaeus mRNA; cDNA DKFZp469C2010 (from clone DKFZp469C2010) Length = 4618 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 254 aatattagtgtccacttaaa 235
>gb|AC011468.8| Homo sapiens chromosome 19 clone CTC-471J1, complete sequence Length = 177444 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 41530 aatattagtgtccacttaaa 41549
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 479 ggatgccggcgacgaggtcg 498 |||||||||||||||||||| Sbjct: 2803167 ggatgccggcgacgaggtcg 2803148
>dbj|AK097156.1| Homo sapiens cDNA FLJ39837 fis, clone SPLEN2014080, weakly similar to ZINC FINGER PROTEIN 84 Length = 2492 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 291 aatattagtgtccacttaaa 272
>gb|AC087550.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone nbeb0016G17, complete sequence Length = 141041 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 tgatacaaatagataaaaaa 92 |||||||||||||||||||| Sbjct: 117147 tgatacaaatagataaaaaa 117128
>ref|NM_025040.2| Homo sapiens zinc finger protein 614 (ZNF614), mRNA Length = 4627 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 244 aatattagtgtccacttaaa 225
>gb|AC123664.15| Mus musculus chromosome 5, clone RP23-224P16, complete sequence Length = 226777 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 276 ctggatgacatgttcatctttcct 299 ||||||||||||||||||| |||| Sbjct: 158355 ctggatgacatgttcatctatcct 158332
>emb|BX548012.11| Zebrafish DNA sequence from clone DKEY-271O4 in linkage group 18, complete sequence Length = 154557 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatattagtgt 108 |||||||| ||||||||||||||| Sbjct: 14330 ataaaaaaaaaacaatattagtgt 14353
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 tgatacaaatagataaaaaa 92 |||||||||||||||||||| Sbjct: 15263448 tgatacaaatagataaaaaa 15263429
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 537 gcaggtgcaggtggcttggc 556 |||||||||||||||||||| Sbjct: 28261160 gcaggtgcaggtggcttggc 28261179
>gb|AC007606.8| Homo sapiens chromosome 16 clone RP11-35P16, complete sequence Length = 157477 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 aatagataaaaaacaaacaa 99 |||||||||||||||||||| Sbjct: 109151 aatagataaaaaacaaacaa 109170
>gb|AC093904.3| Homo sapiens BAC clone RP11-734K21 from 2, complete sequence Length = 191827 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ttctggggctgatggcgtagggga 457 ||||||||||||||||||| |||| Sbjct: 63783 ttctggggctgatggcgtacggga 63806
>dbj|AB066544.1| Macaca fascicularis brain cDNA clone:QtrA-10780, similar to human zinc finger protein 614 (ZNF614), mRNA, NM_025040 Length = 2407 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 234 aatattagtgtccacttaaa 215
>gb|AC023830.9| Homo sapiens chromosome 16 clone RP11-709D24, complete sequence Length = 182662 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 aatagataaaaaacaaacaa 99 |||||||||||||||||||| Sbjct: 30276 aatagataaaaaacaaacaa 30295
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 454 gggatgttgacgccgcactt 473 |||||||||||||||||||| Sbjct: 3074255 gggatgttgacgccgcactt 3074236
>dbj|AP005395.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0623A10 Length = 156517 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 537 gcaggtgcaggtggcttggc 556 |||||||||||||||||||| Sbjct: 59189 gcaggtgcaggtggcttggc 59208
>dbj|BS000003.1| Pan troglodytes chromosome 22 clone:PTB-084L06, map 22, complete sequences Length = 183187 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 175075 catctcctcctgagcctctg 175094 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 127437 catctcctcctgagcctctg 127456
>dbj|AP004799.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0585B01 Length = 133231 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 84 gataaaaaacaaacaatatt 103 |||||||||||||||||||| Sbjct: 74173 gataaaaaacaaacaatatt 74154
>emb|AL163204.2|HS21C004 Homo sapiens chromosome 21 segment HS21C004 Length = 340000 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 227660 catctcctcctgagcctctg 227679
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 479 ggatgccggcgacgaggtcgggct 502 |||||||||| ||||||||||||| Sbjct: 822386 ggatgccggccacgaggtcgggct 822409
>gb|BC004930.1| Homo sapiens zinc finger protein 614, mRNA (cDNA clone IMAGE:3605964), complete cds Length = 1314 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aatattagtgtccacttaaa 117 |||||||||||||||||||| Sbjct: 229 aatattagtgtccacttaaa 210
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome Length = 5227293 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 4205379 ataaaaaacaaacaatatta 4205398
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ataaaaaacaaacaatatta 104 |||||||||||||||||||| Sbjct: 4152415 ataaaaaacaaacaatatta 4152434
>emb|CR854989.8| Zebrafish DNA sequence from clone DKEY-220M7 in linkage group 16, complete sequence Length = 101111 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 311 agcgaagcccacatctcctc 330 |||||||||||||||||||| Sbjct: 54640 agcgaagcccacatctcctc 54659
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 tgatacaaatagataaaaaa 92 |||||||||||||||||||| Sbjct: 15271689 tgatacaaatagataaaaaa 15271670
>gb|DQ147214.1| Zea diploperennis isolate d8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 326 cttgaggcagctgcaggcggcgcggcggtcggcggtggtg 287
>gb|DQ147212.1| Zea diploperennis isolate d6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287
>gb|DQ147211.1| Zea diploperennis isolate d5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287
>gb|DQ147208.1| Zea diploperennis isolate d3 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 812 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287
>gb|DQ147206.1| Zea diploperennis isolate d1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 326 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 287
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 686 Score = 40.1 bits (20), Expect = 9.1 Identities = 35/40 (87%) Strand = Plus / Minus Query: 531 cttgaggcaggtgcaggtggcttggcggtcggcgggggtg 570 |||||||||| |||||| ||| |||||||||||| |||| Sbjct: 213 cttgaggcagttgcaggcggcgcggcggtcggcggtggtg 174
>dbj|AP001466.1| Homo sapiens genomic DNA, chromosome 21q11.1, clone:R111H17, D21S290-LL56 region, complete sequence Length = 115693 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 catctcctcctgagcctctg 341 |||||||||||||||||||| Sbjct: 18935 catctcctcctgagcctctg 18954 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,366,860 Number of Sequences: 3902068 Number of extensions: 5366860 Number of successful extensions: 120052 Number of sequences better than 10.0: 190 Number of HSP's better than 10.0 without gapping: 193 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 118732 Number of HSP's gapped (non-prelim): 1319 length of query: 664 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 641 effective length of database: 17,143,297,704 effective search space: 10988853828264 effective search space used: 10988853828264 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
