>gb|AC090437.62| Mus musculus strain C57BL/6J clone rp23-11f20 map 6, complete sequence
          Length = 227127

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ctgagaggacctgctctctgc 205
              |||||||||||||||||||||
Sbjct: 109175 ctgagaggacctgctctctgc 109155

>emb|AL033522.1|HS451B21 Human DNA sequence from clone RP3-451B21 on chromosome 6q24 Contains
             the HSPC228 gene for hypothetical protein HSPC228 and  a
             novel gene, complete sequence
          Length = 135162

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 275   tttcattcatttacaactcat 295
             |||||||||||||||||||||
Sbjct: 68073 tttcattcatttacaactcat 68053

>emb|AL021919.4|HS1045J21 Human DNA sequence from clone RP5-1045J21 on chromosome 1q23.3-24.3
            Contains part of the TNR gene for tenascin R (restrictin,
            janusin), a novel gene and one CpG island, complete
            sequence
          Length = 138636

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 182  catctgagaggacctgctctctgca 206
            |||||||||| ||||||||||||||
Sbjct: 1746 catctgagagcacctgctctctgca 1722

>emb|BX255963.11| Zebrafish DNA sequence from clone CH211-195D17 in linkage group 20,
             complete sequence
          Length = 103956

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 6     tttgtttcaaacaccacatttggag 30
             |||||||||||||| ||||||||||
Sbjct: 32971 tttgtttcaaacacaacatttggag 32995

>emb|AL589876.11| Mouse DNA sequence from clone RP23-117O11 on chromosome 2, complete
              sequence
          Length = 221782

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ctgagaggacctgctctctgc 205
              |||||||||||||||||||||
Sbjct: 172218 ctgagaggacctgctctctgc 172238

>gb|AC122330.4| Mus musculus BAC clone RP23-342G7 from chromosome 18, complete sequence
          Length = 194291

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 275    tttcattcatttacaactca 294
              ||||||||||||||||||||
Sbjct: 134647 tttcattcatttacaactca 134628

>emb|BX649643.10| Zebrafish DNA sequence from clone CH211-125M10 in linkage group 22,
             complete sequence
          Length = 177325

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 91    atgatctgttacactttggtgata 114
             ||||||| ||||||||||||||||
Sbjct: 14955 atgatcttttacactttggtgata 14932


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,128,122
Number of Sequences: 3902068
Number of extensions: 3128122
Number of successful extensions: 54331
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54322
Number of HSP's gapped (non-prelim): 9
length of query: 380
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 358
effective length of database: 17,147,199,772
effective search space: 6138697518376
effective search space used: 6138697518376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)