ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags5f03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome... 100 9e-18
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 100 9e-18
3gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 100 9e-18
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 94 5e-16
5gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genom... 94 5e-16
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 94 5e-16
7ref|NM_194080.1| Oryza sativa (japonica cultivar-group), mRNA 86 1e-13
8gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence 86 1e-13
9gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence 86 1e-13
10gb|AY310769.1| Nicotiana benthamiana clone 8-039 unknown mRNA 78 3e-11
11gb|AY846831.1| Triticum aestivum ribosomal protein S29 mRNA, com... 78 3e-11
12gb|AY110912.1| Zea mays CL3469_2 mRNA sequence 78 3e-11
13gb|AY109560.1| Zea mays CL3469_8 mRNA sequence 78 3e-11
14gb|AY109342.1| Zea mays CL3469_4 mRNA sequence 78 3e-11
15dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
16gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 76 1e-10
17emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa... 76 1e-10
18gb|AY389605.1| Hyacinthus orientalis ribosomal protein S29 (RPS2... 72 2e-09
19gb|DQ083212.1| Oryza sativa (indica cultivar-group) clone 7S11G3... 70 8e-09
20dbj|AK059123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 8e-09
21emb|Y16127.1|LES16127 Lycopersicon esculentum mRNA for hypotheti... 64 5e-07
22emb|AL163975.1|ATT15B3 Arabidopsis thaliana DNA chromosome 3, BA... 60 8e-06
23emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, ... 60 8e-06
24emb|AL031032.1|ATF17I5 Arabidopsis thaliana DNA chromosome 4, BA... 60 8e-06
25ref|NM_119544.3| Arabidopsis thaliana structural constituent of ... 54 5e-04
26ref|NM_114269.2| Arabidopsis thaliana structural constituent of ... 54 5e-04
27gb|AF325031.2|AF325031 Arabidopsis thaliana AT3g43980 (AT3g43980... 54 5e-04
28emb|BX826239.1|CNS0A7QD Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
29emb|BX825142.1|CNS0A7PE Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
30emb|BX824534.1|CNS0A7RP Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
31emb|BX841605.1|CNS09YHD Arabidopsis thaliana Full-length cDNA Co... 54 5e-04
32gb|BT004344.1| Arabidopsis thaliana clone U20117 putative riboso... 54 5e-04
33gb|AY086767.1| Arabidopsis thaliana clone 2749 mRNA, complete se... 54 5e-04
34gb|DQ108688.1| Arabidopsis thaliana clone 107113 mRNA sequence 54 5e-04
35gb|BT002766.1| Arabidopsis thaliana clone RAFL15-04-A21 (R20117)... 54 5e-04
36dbj|AK176861.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
37dbj|AK176439.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
38dbj|AK176332.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
39dbj|AK176322.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
40dbj|AK176295.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
41dbj|AK176294.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
42dbj|AK176060.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
43dbj|AK175918.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
44dbj|AK175739.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
45dbj|AK175283.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
46dbj|AK175173.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
47dbj|AK175172.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
48dbj|AK175152.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
49dbj|AK175132.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 54 5e-04
50dbj|AK118617.1| Arabidopsis thaliana At4g33865 mRNA for putative... 54 5e-04
51emb|CR931730.1| Medicago truncatula chromosome 5 clone mth2-17o... 52 0.002
52ref|XM_519212.1| PREDICTED: Pan troglodytes similar to paraoxona... 46 0.11
53gb|AY805220.1| Homo sapiens paraoxonase 3 (PON3) gene, complete cds 46 0.11
54gb|BC070374.1| Homo sapiens paraoxonase 3, mRNA (cDNA clone MGC:... 46 0.11
55gb|AC145888.3| Pan troglodytes BAC clone RP43-40H8 from 7, compl... 46 0.11
56ref|NM_000940.2| Homo sapiens paraoxonase 3 (PON3), mRNA 46 0.11
57gb|AC004022.1| Homo sapiens BAC clone GS1-155M11 from 7, complet... 46 0.11
58gb|AY499199.1| Synthetic construct paraoxonase PON3 variant G3H9... 46 0.11
59gb|AY499198.1| Synthetic construct paraoxonase PON3 variant G3G3... 46 0.11
60gb|AY499196.1| Synthetic construct paraoxonase PON3 variant G2C2... 46 0.11
61gb|BC020908.1| Homo sapiens paraoxonase 3, mRNA (cDNA clone IMAG... 46 0.11
62dbj|AK096114.1| Homo sapiens cDNA FLJ38795 fis, clone LIVER20043... 46 0.11
63emb|BX825609.1|CNS0A7QE Arabidopsis thaliana Full-length cDNA Co... 46 0.11
64emb|BX828871.1|CNS0A3J1 Arabidopsis thaliana Full-length cDNA Co... 46 0.11
65gb|AF320003.1|AF320003 Homo sapiens paraoxanase-3 mRNA, partial cds 46 0.11
66gb|AF220944.1|AF220944 Oryctolagus cuniculus paraoxonase 3 (PON3... 46 0.11
67gb|AY086371.1| Arabidopsis thaliana clone 24629 mRNA, complete s... 46 0.11
68gb|AF329433.1| Homo sapiens paraoxonase 3 (PON3) mRNA, complete cds 46 0.11
69dbj|AK176815.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 46 0.11
70dbj|AK176070.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 46 0.11
71dbj|AK175819.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 46 0.11
72dbj|AK175731.1| Arabidopsis thaliana mRNA for ribosomal S29 subu... 46 0.11
73dbj|AP002517.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 46 0.11
74gb|L48516.1|HUMPON3R Homo sapiens paraoxonase 3 (PON3) mRNA, 3' ... 46 0.11
75dbj|AB065501.1| Homo sapiens gene for seven transmembrane helix ... 46 0.11
76gb|AY550074.1| Sus scrofa 40S ribosomal protein S29 mRNA, comple... 44 0.45
77ref|NM_001001633.1| Sus scrofa 40S ribosomal protein S29 (RPS29)... 44 0.45
78gb|DQ108844.1| Arabidopsis thaliana clone 32764 mRNA sequence 44 0.45
79gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 44 0.45
80emb|BX062216.1|CNS09K64 Single read from an extremity of a full-... 42 1.8
81emb|BX060052.1|CNS09II0 Single read from an extremity of a full-... 42 1.8
82emb|BX045283.1|CNS0973R Single read from an extremity of a full-... 42 1.8
83emb|BX039902.1|CNS092YA Single read from an extremity of a full-... 42 1.8
84emb|BX035521.1|CNS08ZKL Single read from an extremity of a full-... 42 1.8
85emb|BX034864.1|CNS08Z2C Single read from an extremity of a full-... 42 1.8
86emb|BX032950.1|CNS08XL6 Single read from an extremity of a full-... 42 1.8
87emb|BX032949.1|CNS08XL5 Single read from an extremity of a full-... 42 1.8
88emb|BX032900.1|CNS08XJS Single read from an extremity of a full-... 42 1.8
89emb|BX029858.1|CNS08V7A Single read from an extremity of a full-... 42 1.8
90emb|BX024653.1|CNS08R6P Single read from an extremity of a full-... 42 1.8
91emb|BX021452.1|CNS08OPS Single read from an extremity of a full-... 42 1.8
92emb|BX021129.1|CNS08OGT Single read from an extremity of a full-... 42 1.8
93emb|BX018990.1|CNS08MTE Single read from an extremity of a full-... 42 1.8
94emb|BX018131.1|CNS08M5J Single read from an extremity of a full-... 42 1.8
95emb|BX016647.1|CNS08L0B Single read from an extremity of a full-... 42 1.8
96emb|BX014329.1|CNS08J7X Single read from an extremity of a full-... 42 1.8
97emb|BX013944.1|CNS08IX8 Single read from an extremity of a full-... 42 1.8
98emb|BX013193.1|CNS08ICD Single read from an extremity of a full-... 42 1.8
99emb|BX012751.1|CNS08I03 Single read from an extremity of a full-... 42 1.8
100emb|BX011385.1|CNS08GY5 Single read from an extremity of a full-... 42 1.8
101emb|BX011384.1|CNS08GY4 Single read from an extremity of a full-... 42 1.8
102emb|BX011210.1|CNS08GTA Single read from an extremity of a full-... 42 1.8
103emb|BX011209.1|CNS08GT9 Single read from an extremity of a full-... 42 1.8
104emb|BX009526.1|CNS08FII Single read from an extremity of a full-... 42 1.8
105emb|BX008674.1|CNS08EUU Single read from an extremity of a full-... 42 1.8
106emb|BX008492.1|CNS08EPS Single read from an extremity of a full-... 42 1.8
107emb|BX007367.1|CNS08DUJ Single read from an extremity of a full-... 42 1.8
108emb|BX007366.1|CNS08DUI Single read from an extremity of a full-... 42 1.8
109emb|BX007064.1|CNS08DM4 Single read from an extremity of a full-... 42 1.8
110emb|BX006545.1|CNS08D7P Single read from an extremity of a full-... 42 1.8
111emb|BX006544.1|CNS08D7O Single read from an extremity of a full-... 42 1.8
112emb|BX005506.1|CNS08CEU Single read from an extremity of a full-... 42 1.8
113emb|BX005505.1|CNS08CET Single read from an extremity of a full-... 42 1.8
114emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosom... 42 1.8
115emb|CR381644.8| Zebrafish DNA sequence from clone CH211-80A15 in... 42 1.8
116gb|AC087485.6| Homo sapiens chromosome 15, clone RP11-570N16, co... 42 1.8
117gb|AC136896.6| Homo sapiens chromosome 15, clone RP11-860O1, com... 42 1.8
118gb|AC135350.6| Homo sapiens chromosome 15, clone RP13-946E15, co... 42 1.8
119gb|AC097461.3| Homo sapiens BAC clone RP11-16P6 from 2, complete... 42 1.8
120ref|XM_321509.2| Anopheles gambiae str. PEST ENSANGP00000018161 ... 42 1.8
121gb|AC006602.1|AC006602 Homo sapiens Chromosome 15q11-q13 PAC clo... 42 1.8
122gb|AY433152.1| Aedes aegypti ASAP ID: 34225 cytosolic small ribo... 40 7.0
123gb|DQ440193.1| Aedes aegypti clone AET-1667 40S ribosomal protei... 40 7.0
124gb|AC123899.15| Medicago truncatula clone mth2-33n6, complete se... 40 7.0
125gb|AY305497.1| Eurytemora affinis voucher Eaf elongation factor-... 40 7.0
126emb|AL392003.11| Human DNA sequence from clone RP11-331H2 on chr... 40 7.0
127emb|AL391707.9| Human DNA sequence from clone RP11-166B18 on chr... 40 7.0
128gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 40 7.0
129emb|BX841514.1|CNS09YHL Arabidopsis thaliana Full-length cDNA Co... 40 7.0
130gb|AC007244.2|AC007244 Homo sapiens BAC clone RP11-207L19 from Y... 40 7.0
131gb|AF266749.1|AF266749 Culex pipiens quinquefasciatus ribsomal p... 40 7.0
132gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, ... 40 7.0
133emb|AL953872.7| Zebrafish DNA sequence from clone CH211-235H23, ... 40 7.0
134emb|BX001041.6| Zebrafish DNA sequence from clone CH211-62M7, co... 40 7.0
135emb|AL844564.14| Mouse DNA sequence from clone RP23-400D4 on chr... 40 7.0 
>gb|AC118346.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBa0039F06, complete sequence
          Length = 133022

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 53/54 (98%)
 Strand = Plus / Plus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 86372 taccttgatgaagccaatatccttggcgttgctgcggaagcactgcctgcagca 86425
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 53/54 (98%)
 Strand = Plus / Minus

                                                                      
Query: 462      taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 24119054 taccttgatgaagccaatatccttggcgttgctgcggaagcactgcctgcagca 24119001
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 53/54 (98%)
 Strand = Plus / Minus

                                                                      
Query: 462      taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 24430723 taccttgatgaagccaatatccttggcgttgctgcggaagcactgcctgcagca 24430670
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 56/59 (94%)
 Strand = Plus / Plus

                                                                           
Query: 457      gagtgtaccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
                |||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 31738997 gagtataccttgatgaagccaatgtccttggcgttgctgcggaagcactgcctgcagca 31739055
to top
>gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete
             sequence
          Length = 134496

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 56/59 (94%)
 Strand = Plus / Plus

                                                                        
Query: 457   gagtgtaccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 64223 gagtataccttgatgaagccaatgtccttggcgttgctgcggaagcactgcctgcagca 64281
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 56/59 (94%)
 Strand = Plus / Plus

                                                                           
Query: 457      gagtgtaccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
                |||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 31829513 gagtataccttgatgaagccaatgtccttggcgttgctgcggaagcactgcctgcagca 31829571
to top
>ref|NM_194080.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 509

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 194 cttgatgaagccaatgtccttggcgttgctgcggaagcactgcctgcagca 144
to top
>gb|BT017321.1| Zea mays clone EL01N0319C08.c mRNA sequence
          Length = 424

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 204 cttgatgaagccaatgtccttggcgttgctgcggaagcactgcctgcagca 154
to top
>gb|AF457936.1| Zea mays clone cho1c.pk002.j14, mRNA sequence
          Length = 402

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 190 cttgatgaagccaatgtccttggcgttgctgcggaagcactgcctgcagca 140
to top
>gb|AY310769.1| Nicotiana benthamiana clone 8-039 unknown mRNA
          Length = 392

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||| | |||||||||||||| ||||||||||||||||||||
Sbjct: 219 cttgatgaagccagtttccttggcgttgctgcggaagcactgcctgcagca 169
to top
>gb|AY846831.1| Triticum aestivum ribosomal protein S29 mRNA, complete cds
          Length = 398

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||||| |||||||||| ||| ||||||||||||||||||||
Sbjct: 200 cttgatgaagccaatgtccttggcgtcgctgcggaagcactgcctgcagca 150
to top
>gb|AY110912.1| Zea mays CL3469_2 mRNA sequence
          Length = 489

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||||| |||||||||||||| ||||||||||| ||||||||
Sbjct: 252 cttgatgaagccaatgtccttggcgttgctgcggaagcactgtctgcagca 202
to top
>gb|AY109560.1| Zea mays CL3469_8 mRNA sequence
          Length = 586

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||| ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 194 cttgatgaaaccaatgtccttggcgttgctgcggaagcactgcctgcagca 144
to top
>gb|AY109342.1| Zea mays CL3469_4 mRNA sequence
          Length = 814

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||||||||||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 220 cttgatgaagccaatgtccttggcattgctgcggaagcactgcctgcagca 170
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                      
Query: 462      taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
                ||||||||||||||| || |||||||||||||| ||||||||||| ||||||||
Sbjct: 19578221 taccttgatgaagccgatgtccttggcgttgctgcggaagcactgtctgcagca 19578168
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                      
Query: 462      taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
                ||||||||||||||| || |||||||||||||| ||||||||||| ||||||||
Sbjct: 19504434 taccttgatgaagccgatgtccttggcgttgctgcggaagcactgtctgcagca 19504381
to top
>emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa0009K11 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 144596

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                    
Query: 462    taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
              ||||||||||||||| || |||||||||||||| ||||||||||| ||||||||
Sbjct: 110402 taccttgatgaagccgatgtccttggcgttgctgcggaagcactgtctgcagca 110349
to top
>gb|AY389605.1| Hyacinthus orientalis ribosomal protein S29 (RPS29) mRNA, partial
           cds
          Length = 481

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 472 aagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           |||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 208 aagccaatttccttggcattgctacggaagcactgcctgcagca 165
to top
>gb|DQ083212.1| Oryza sativa (indica cultivar-group) clone 7S11G34 mRNA sequence
          Length = 346

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||| || |||||||||||||| ||||||||||| ||||||||
Sbjct: 64  cttgatgaagccgatgtccttggcgttgctgcggaagcactgtctgcagca 14
to top
>dbj|AK059123.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-F08, full
           insert sequence
          Length = 457

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||| || |||||||||||||| ||||||||||| ||||||||
Sbjct: 249 cttgatgaagccgatgtccttggcgttgctgcggaagcactgtctgcagca 199
to top
>emb|Y16127.1|LES16127 Lycopersicon esculentum mRNA for hypothetical protein
          Length = 474

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 465 cttgatgaagccaatatccttggcgttgctacggaagcactgcctgca 512
           ||||||||||||||| |||||||| ||||| ||||||||||| |||||
Sbjct: 215 cttgatgaagccaatttccttggcattgctgcggaagcactgtctgca 168
to top
>emb|AL163975.1|ATT15B3 Arabidopsis thaliana DNA chromosome 3, BAC clone T15B3
          Length = 114656

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||||| ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 89935 taccttaatgaatccaatctccttagcgttgctacggaaacactgtctgcagca 89988



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||||| ||||| || || ||||||||||| || ||||| ||||| ||||||||
Sbjct: 68316 taccttaatgaatccgatctccttggcgttactgcggaaacactgtctgcagca 68369
to top
>emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 80
          Length = 192861

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||||| ||||| || || |||||||||||||||||||||||||| || |||||
Sbjct: 82523 taccttaatgaatccgatttccttggcgttgctacggaagcactgtctacagca 82470



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||||| ||||| || || |||||||||||||||||||| ||||| ||||||||
Sbjct: 67057 taccttaatgaatccgatttccttggcgttgctacggaaacactgtctgcagca 67110
to top
>emb|AL031032.1|ATF17I5 Arabidopsis thaliana DNA chromosome 4, BAC clone  F17I5 (ESSA project)
          Length = 86748

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||||| ||||| || || |||||||||||||||||||||||||| || |||||
Sbjct: 33499 taccttaatgaatccgatttccttggcgttgctacggaagcactgtctacagca 33446



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 462   taccttgatgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
             |||||| ||||| || || |||||||||||||||||||| ||||| ||||||||
Sbjct: 18033 taccttaatgaatccgatttccttggcgttgctacggaaacactgtctgcagca 18086
to top
>ref|NM_119544.3| Arabidopsis thaliana structural constituent of ribosome AT4G33865
           mRNA, complete cds
          Length = 439

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 228 tccttggcgttgctacggaaacactgtctgcagca 194
to top
>ref|NM_114269.2| Arabidopsis thaliana structural constituent of ribosome AT3G44010
           mRNA, complete cds
          Length = 483

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 226 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 180
to top
>gb|AF325031.2|AF325031 Arabidopsis thaliana AT3g43980 (AT3g43980/T15B3_120) mRNA, complete
           cds
          Length = 420

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 225 tccttggcgttgctacggaaacactgtctgcagca 191
to top
>emb|BX826239.1|CNS0A7QD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL93ZC06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 360

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 178 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 132
to top
>emb|BX825142.1|CNS0A7PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL15ZD07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 459

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 202 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 156
to top
>emb|BX824534.1|CNS0A7RP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH54ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 394

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 211 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 165
to top
>emb|BX841605.1|CNS09YHD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL66ZF11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 358

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 161 tccttggcgttgctacggaaacactgtctgcagca 127
to top
>gb|BT004344.1| Arabidopsis thaliana clone U20117 putative ribosomal protein S29
           (At3g44010) mRNA, complete cds
          Length = 202

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 158 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 112
to top
>gb|AY086767.1| Arabidopsis thaliana clone 2749 mRNA, complete sequence
          Length = 482

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 226 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 180
to top
>gb|DQ108688.1| Arabidopsis thaliana clone 107113 mRNA sequence
          Length = 393

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 174 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 128
to top
>gb|BT002766.1| Arabidopsis thaliana clone RAFL15-04-A21 (R20117) putative
           ribosomal protein S29 (At3g44010) mRNA, complete cds
          Length = 421

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| ||||| ||||||||
Sbjct: 226 atgaatccaatctccttagcgttgctacggaaacactgtctgcagca 180
to top
>dbj|AK176861.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL25-41-O05
          Length = 359

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 189 tccttggcgttgctacggaaacactgtctgcagca 155
to top
>dbj|AK176439.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL24-19-N14
          Length = 367

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK176332.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-32-J11
          Length = 385

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 230 tccttggcgttgctacggaaacactgtctgcagca 196
to top
>dbj|AK176322.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-29-F01
          Length = 370

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK176295.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-24-M01
          Length = 368

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 195 tccttggcgttgctacggaaacactgtctgcagca 161
to top
>dbj|AK176294.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL23-24-E02
          Length = 370

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK176060.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-80-C13
          Length = 407

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK175918.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-58-A09
          Length = 407

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 202 tccttggcgttgctacggaaacactgtctgcagca 168
to top
>dbj|AK175739.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-28-I01
          Length = 407

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK175283.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-72-B11
          Length = 388

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK175173.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-59-B22
          Length = 359

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 189 tccttggcgttgctacggaaacactgtctgcagca 155
to top
>dbj|AK175172.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-59-A02
          Length = 370

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 197 tccttggcgttgctacggaaacactgtctgcagca 163
to top
>dbj|AK175152.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-57-E24
          Length = 423

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 213 tccttggcgttgctacggaaacactgtctgcagca 179
to top
>dbj|AK175132.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL21-54-P17
          Length = 394

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 189 tccttggcgttgctacggaaacactgtctgcagca 155
to top
>dbj|AK118617.1| Arabidopsis thaliana At4g33865 mRNA for putative ribosomal S29
           subunit, complete cds, clone: RAFL19-88-C17
          Length = 427

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||||||||
Sbjct: 246 tccttggcgttgctacggaaacactgtctgcagca 212
to top
>emb|CR931730.1| Medicago truncatula chromosome 5 clone  mth2-17o15, COMPLETE
           SEQUENCE
          Length = 89342

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 463 accttgatgaagccaatatccttggcgttgctacggaagcactgcctgca 512
           ||||| ||||||||||| |||||||| |||||  |||||||||| |||||
Sbjct: 926 accttaatgaagccaatttccttggcattgctgtggaagcactgtctgca 877
to top
>ref|XM_519212.1| PREDICTED: Pan troglodytes similar to paraoxonase 3 (LOC463548), mRNA
          Length = 1452

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 191  cttctcagacaaaacattctgga 213
            |||||||||||||||||||||||
Sbjct: 1326 cttctcagacaaaacattctgga 1304
to top
>gb|AY805220.1| Homo sapiens paraoxonase 3 (PON3) gene, complete cds
          Length = 76547

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 191   cttctcagacaaaacattctgga 213
             |||||||||||||||||||||||
Sbjct: 42735 cttctcagacaaaacattctgga 42713
to top
>gb|BC070374.1| Homo sapiens paraoxonase 3, mRNA (cDNA clone MGC:88384
           IMAGE:4710338), complete cds
          Length = 1118

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 950 cttctcagacaaaacattctgga 928
to top
>gb|AC145888.3| Pan troglodytes BAC clone RP43-40H8 from 7, complete sequence
          Length = 163342

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 191   cttctcagacaaaacattctgga 213
             |||||||||||||||||||||||
Sbjct: 72373 cttctcagacaaaacattctgga 72351
to top
>ref|NM_000940.2| Homo sapiens paraoxonase 3 (PON3), mRNA
          Length = 1201

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 964 cttctcagacaaaacattctgga 942
to top
>gb|AC004022.1| Homo sapiens BAC clone GS1-155M11 from 7, complete sequence
          Length = 116552

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 191    cttctcagacaaaacattctgga 213
              |||||||||||||||||||||||
Sbjct: 104866 cttctcagacaaaacattctgga 104888
to top
>gb|AY499199.1| Synthetic construct paraoxonase PON3 variant G3H9 gene, partial cds
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 939 cttctcagacaaaacattctgga 917
to top
>gb|AY499198.1| Synthetic construct paraoxonase PON3 variant G3G3 gene, partial cds
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 939 cttctcagacaaaacattctgga 917
to top
>gb|AY499196.1| Synthetic construct paraoxonase PON3 variant G2C2 gene, partial cds
          Length = 1062

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 939 cttctcagacaaaacattctgga 917
to top
>gb|BC020908.1| Homo sapiens paraoxonase 3, mRNA (cDNA clone IMAGE:4723275),
           containing frame-shift errors
          Length = 963

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 795 cttctcagacaaaacattctgga 773
to top
>dbj|AK096114.1| Homo sapiens cDNA FLJ38795 fis, clone LIVER2004392, highly similar to
            SERUM PARAOXONASE/ARYLESTERASE 3 (EC 3.1.1.2)
          Length = 2433

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 191  cttctcagacaaaacattctgga 213
            |||||||||||||||||||||||
Sbjct: 2295 cttctcagacaaaacattctgga 2273
to top
>emb|BX825609.1|CNS0A7QE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL48ZG03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 460

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 469 atgaagccaatatccttggcgttgctacggaagcactgcctgcagca 515
           ||||| ||||| ||||| |||||||||||||| |||||  |||||||
Sbjct: 202 atgaatccaatctccttagcgttgctacggaaacactgtttgcagca 156
to top
>emb|BX828871.1|CNS0A3J1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL45ZE11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 382

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| |||||  |||||||
Sbjct: 183 tccttggcgttgctacggaaacactgtttgcagca 149
to top
>gb|AF320003.1|AF320003 Homo sapiens paraoxanase-3 mRNA, partial cds
          Length = 1064

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 939 cttctcagacaaaacattctgga 917
to top
>gb|AF220944.1|AF220944 Oryctolagus cuniculus paraoxonase 3 (PON3) mRNA, complete cds
          Length = 1085

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 946 cttctcagacaaaacattctgga 924
to top
>gb|AY086371.1| Arabidopsis thaliana clone 24629 mRNA, complete sequence
          Length = 423

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| | ||||||
Sbjct: 228 tccttggcgttgctacggaaacactgtcggcagca 194
to top
>gb|AF329433.1| Homo sapiens paraoxonase 3 (PON3) mRNA, complete cds
          Length = 1075

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 939 cttctcagacaaaacattctgga 917
to top
>dbj|AK176815.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL25-36-M09
          Length = 496

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||||||||||||||| ||||| ||| ||||
Sbjct: 202 tccttggcgttgctacggaaacactgtctgtagca 168
to top
>dbj|AK176070.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-81-B04
          Length = 407

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||| ||||||||||| ||||| ||||||||
Sbjct: 197 tccttggctttgctacggaaacactgtctgcagca 163
to top
>dbj|AK175819.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-41-I17
          Length = 407

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||| ||||||||||| ||||| ||||||||
Sbjct: 197 tccttggctttgctacggaaacactgtctgcagca 163
to top
>dbj|AK175731.1| Arabidopsis thaliana mRNA for ribosomal S29 subunit, complete cds,
           clone: RAFL22-27-J17
          Length = 407

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 481 tccttggcgttgctacggaagcactgcctgcagca 515
           |||||||| ||||||||||| ||||| ||||||||
Sbjct: 197 tccttggctttgctacggaaacactgtctgcagca 163
to top
>dbj|AP002517.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-116P9, complete
              sequences
          Length = 173251

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 91     acatagattaaatattttatgaa 113
              |||||||||||||||||||||||
Sbjct: 101884 acatagattaaatattttatgaa 101862
to top
>gb|L48516.1|HUMPON3R Homo sapiens paraoxonase 3 (PON3) mRNA, 3' end of cds
          Length = 1038

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 191 cttctcagacaaaacattctgga 213
           |||||||||||||||||||||||
Sbjct: 900 cttctcagacaaaacattctgga 878
to top
>dbj|AB065501.1| Homo sapiens gene for seven transmembrane helix receptor, complete cds,
             isolate:CBRC7TM_64
          Length = 56423

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 91    acatagattaaatattttatgaa 113
             |||||||||||||||||||||||
Sbjct: 25324 acatagattaaatattttatgaa 25346
to top
>gb|AY550074.1| Sus scrofa 40S ribosomal protein S29 mRNA, complete cds
          Length = 287

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 465 cttgatgaagccaatatccttggcgt 490
           ||||||||||||||||||||| ||||
Sbjct: 162 cttgatgaagccaatatccttcgcgt 137
to top
>ref|NM_001001633.1| Sus scrofa 40S ribosomal protein S29 (RPS29), mRNA
          Length = 287

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 465 cttgatgaagccaatatccttggcgt 490
           ||||||||||||||||||||| ||||
Sbjct: 162 cttgatgaagccaatatccttcgcgt 137
to top
>gb|DQ108844.1| Arabidopsis thaliana clone 32764 mRNA sequence
          Length = 347

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 469 atgaagccaatatccttggcgttgctacggaagcactg 506
           ||||| ||||| ||||| |||||||||||||| |||||
Sbjct: 169 atgaatccaatctccttagcgttgctacggaaacactg 132
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 74      aaacaaactactaaaacacata 95
               ||||||||||||||||||||||
Sbjct: 4104504 aaacaaactactaaaacacata 4104525
to top
>emb|BX062216.1|CNS09K64 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 215 tgaagccaatatccttggcgt 195
to top
>emb|BX060052.1|CNS09II0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 383

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 214 tgaagccaatatccttggcgt 194
to top
>emb|BX045283.1|CNS0973R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 396

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 227 tgaagccaatatccttggcgt 207
to top
>emb|BX039902.1|CNS092YA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 427

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 237 tgaagccaatatccttggcgt 217
to top
>emb|BX035521.1|CNS08ZKL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 209

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 139 tgaagccaatatccttggcgt 119
to top
>emb|BX034864.1|CNS08Z2C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 209 tgaagccaatatccttggcgt 189
to top
>emb|BX032950.1|CNS08XL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 173

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 125 tgaagccaatatccttggcgt 145
to top
>emb|BX032949.1|CNS08XL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 211 tgaagccaatatccttggcgt 191
to top
>emb|BX032900.1|CNS08XJS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 144 tgaagccaatatccttggcgt 164
to top
>emb|BX029858.1|CNS08V7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 231 tgaagccaatatccttggcgt 211
to top
>emb|BX024653.1|CNS08R6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 353

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 215 tgaagccaatatccttggcgt 195
to top
>emb|BX021452.1|CNS08OPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 410

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 231 tgaagccaatatccttggcgt 211
to top
>emb|BX021129.1|CNS08OGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 355

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 164 tgaagccaatatccttggcgt 144
to top
>emb|BX018990.1|CNS08MTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 219 tgaagccaatatccttggcgt 199
to top
>emb|BX018131.1|CNS08M5J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 403

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 214 tgaagccaatatccttggcgt 194
to top
>emb|BX016647.1|CNS08L0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 409

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 137 tgaagccaatatccttggcgt 157
to top
>emb|BX014329.1|CNS08J7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 227 tgaagccaatatccttggcgt 207
to top
>emb|BX013944.1|CNS08IX8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 413

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 215 tgaagccaatatccttggcgt 195
to top
>emb|BX013193.1|CNS08ICD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 423

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 141 tgaagccaatatccttggcgt 161
to top
>emb|BX012751.1|CNS08I03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 438

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 149 tgaagccaatatccttggcgt 169
to top
>emb|BX011385.1|CNS08GY5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 239

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 133 tgaagccaatatccttggcgt 153
to top
>emb|BX011384.1|CNS08GY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 370

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 210 tgaagccaatatccttggcgt 190
to top
>emb|BX011210.1|CNS08GTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 287

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 114 tgaagccaatatccttggcgt 134
to top
>emb|BX011209.1|CNS08GT9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 389

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 224 tgaagccaatatccttggcgt 204
to top
>emb|BX009526.1|CNS08FII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 420

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 135 tgaagccaatatccttggcgt 155
to top
>emb|BX008674.1|CNS08EUU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 382

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 210 tgaagccaatatccttggcgt 190
to top
>emb|BX008492.1|CNS08EPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 422

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 234 tgaagccaatatccttggcgt 214
to top
>emb|BX007367.1|CNS08DUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 386

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 121 tgaagccaatatccttggcgt 141
to top
>emb|BX007366.1|CNS08DUI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 212

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 22  tgaagccaatatccttggcgt 2
to top
>emb|BX007064.1|CNS08DM4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 227 tgaagccaatatccttggcgt 207
to top
>emb|BX006545.1|CNS08D7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 376

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 124 tgaagccaatatccttggcgt 144
to top
>emb|BX006544.1|CNS08D7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 218 tgaagccaatatccttggcgt 198
to top
>emb|BX005506.1|CNS08CEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 344

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 86  tgaagccaatatccttggcgt 106
to top
>emb|BX005505.1|CNS08CET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 386

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 198 tgaagccaatatccttggcgt 178
to top
>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17
          Length = 147295

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 470    tgaagccaatatccttggcgt 490
              |||||||||||||||||||||
Sbjct: 114295 tgaagccaatatccttggcgt 114315
to top
>emb|CR381644.8| Zebrafish DNA sequence from clone CH211-80A15 in linkage group 8,
              complete sequence
          Length = 171750

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 78     aaactactaaaacacatagat 98
              |||||||||||||||||||||
Sbjct: 162129 aaactactaaaacacatagat 162109
to top
>gb|AC087485.6| Homo sapiens chromosome 15, clone RP11-570N16, complete sequence
          Length = 169771

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 85    taaaacacatagattaaatat 105
             |||||||||||||||||||||
Sbjct: 51422 taaaacacatagattaaatat 51402
to top
>gb|AC136896.6| Homo sapiens chromosome 15, clone RP11-860O1, complete sequence
          Length = 214946

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 85    taaaacacatagattaaatat 105
             |||||||||||||||||||||
Sbjct: 70816 taaaacacatagattaaatat 70796
to top
>gb|AC135350.6| Homo sapiens chromosome 15, clone RP13-946E15, complete sequence
          Length = 158316

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    taaaacacatagattaaatat 105
             |||||||||||||||||||||
Sbjct: 60101 taaaacacatagattaaatat 60121
to top
>gb|AC097461.3| Homo sapiens BAC clone RP11-16P6 from 2, complete sequence
          Length = 169828

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 199    acaaaacattctggactataa 219
              |||||||||||||||||||||
Sbjct: 147032 acaaaacattctggactataa 147012
to top
>ref|XM_321509.2| Anopheles gambiae str. PEST ENSANGP00000018161
           (ENSANGG00000015672), partial mRNA
          Length = 371

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 470 tgaagccaatatccttggcgt 490
           |||||||||||||||||||||
Sbjct: 232 tgaagccaatatccttggcgt 212
to top
>gb|AC006602.1|AC006602 Homo sapiens Chromosome 15q11-q13 PAC clone pDJ476i9 from the
             Prader-Willi/Angelman Syndrome region, complete sequence
          Length = 93610

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 85    taaaacacatagattaaatat 105
             |||||||||||||||||||||
Sbjct: 24151 taaaacacatagattaaatat 24171
to top
>gb|AY433152.1| Aedes aegypti ASAP ID: 34225 cytosolic small ribosomal subunit S29
           mRNA sequence
          Length = 368

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 471 gaagccaatatccttggcgt 490
           ||||||||||||||||||||
Sbjct: 186 gaagccaatatccttggcgt 167
to top
>gb|DQ440193.1| Aedes aegypti clone AET-1667 40S ribosomal protein S29 mRNA,
           complete cds
          Length = 171

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 471 gaagccaatatccttggcgt 490
           ||||||||||||||||||||
Sbjct: 156 gaagccaatatccttggcgt 137
to top
>gb|AC123899.15| Medicago truncatula clone mth2-33n6, complete sequence
          Length = 127126

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 481    tccttggcgttgctacggaagcactgcctgca 512
              |||||||  |||||| ||||||||||||||||
Sbjct: 126387 tccttggaattgctatggaagcactgcctgca 126418
to top
>gb|AY305497.1| Eurytemora affinis voucher Eaf elongation factor-2 mRNA, partial
           cds
          Length = 2119

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 465 cttgatgaagccaatatccttggc 488
           |||||||||| |||||||||||||
Sbjct: 175 cttgatgaaggcaatatccttggc 152
to top
>emb|AL392003.11| Human DNA sequence from clone RP11-331H2 on chromosome 1 Containt the 3'
              end of the HSD17B7 gene for hydroxysteroid (17-beta)
              dehydrogenase 7, a novel protein (MGC48998) and a
              cytochrome c oxidase subunit VIIb (COX7B) pseudogene,
              complete sequence
          Length = 191872

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 252    aaacagcatgttgtgggcat 271
              ||||||||||||||||||||
Sbjct: 110852 aaacagcatgttgtgggcat 110871
to top
>emb|AL391707.9| Human DNA sequence from clone RP11-166B18 on chromosome 10, complete
             sequence
          Length = 166826

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   gctcttcaaaacagcatgtt 263
             ||||||||||||||||||||
Sbjct: 73503 gctcttcaaaacagcatgtt 73522
to top
>gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-22c10, complete
             sequence
          Length = 123020

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 481   tccttggcgttgctacggaagcactgcctgca 512
             |||||||  |||||| ||||||||||||||||
Sbjct: 18584 tccttggaattgctatggaagcactgcctgca 18615
to top
>emb|BX841514.1|CNS09YHL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 413

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 481 tccttggcgttgctacggaa 500
           ||||||||||||||||||||
Sbjct: 202 tccttggcgttgctacggaa 183
to top
>gb|AC007244.2|AC007244 Homo sapiens BAC clone RP11-207L19 from Y, complete sequence
          Length = 184977

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     acagttctcaccaaaacctc 48
              ||||||||||||||||||||
Sbjct: 140506 acagttctcaccaaaacctc 140525
to top
>gb|AF266749.1|AF266749 Culex pipiens quinquefasciatus ribsomal protein S29 mRNA, complete
           cds
          Length = 322

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 471 gaagccaatatccttggcgt 490
           ||||||||||||||||||||
Sbjct: 198 gaagccaatatccttggcgt 179
to top
>gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, complete genome
          Length = 791654

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     ctaaaacacatagattaaatattt 107
              |||||||||||| |||||||||||
Sbjct: 597737 ctaaaacacatacattaaatattt 597760
to top
>emb|AL953872.7| Zebrafish DNA sequence from clone CH211-235H23, complete sequence
          Length = 164584

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 430    caattgcacaagggtacatg 449
              ||||||||||||||||||||
Sbjct: 100739 caattgcacaagggtacatg 100720
to top
>emb|BX001041.6| Zebrafish DNA sequence from clone CH211-62M7, complete sequence
          Length = 167472

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    taaaacacatagattaaata 104
             ||||||||||||||||||||
Sbjct: 98998 taaaacacatagattaaata 99017
to top
>emb|AL844564.14| Mouse DNA sequence from clone RP23-400D4 on chromosome 11, complete
             sequence
          Length = 196136

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    acatagattaaatattttat 110
             ||||||||||||||||||||
Sbjct: 89495 acatagattaaatattttat 89476


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,616,442
Number of Sequences: 3902068
Number of extensions: 5616442
Number of successful extensions: 121252
Number of sequences better than 10.0: 135
Number of HSP's better than 10.0 without gapping: 135
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120860
Number of HSP's gapped (non-prelim): 392
length of query: 515
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 492
effective length of database: 17,143,297,704
effective search space: 8434502470368
effective search space used: 8434502470368
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top