ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4o15
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_478772.1| Oryza sativa (japonica cultivar-group), mRNA 414 e-112
2dbj|AK065242.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
3gb|AY108240.1| Zea mays PCO100302 mRNA sequence 349 7e-93
4dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
5dbj|AP005908.3| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
6emb|AJ133751.1|SOL133751 Spinacia oleracea mRNA for chloroplast ... 64 6e-07
7emb|X72384.1|DCD2NLP D.carota D2 mRNA for glycine rich protein 58 4e-05
8emb|AL136967.5| Human DNA sequence from clone RP1-149M18 on chro... 44 0.57
9emb|CR450763.5| Zebrafish DNA sequence from clone CH211-180M24, ... 44 0.57
10gb|AC160655.2| Pan troglodytes BAC clone CH251-26F13 from chromo... 44 0.57
11gb|AC160057.2| Pan troglodytes BAC clone CH251-416M4 from chromo... 44 0.57
12gb|AY112589.1| Zea mays CL61174_1 mRNA sequence 44 0.57
13ref|NM_116184.2| Arabidopsis thaliana unknown protein AT3G63190 ... 42 2.2
14gb|AC122253.5| Mus musculus BAC clone RP23-171K3 from chromosome... 42 2.2
15gb|AC103604.4| Mus musculus chromosome 3, clone RP23-95A20, comp... 42 2.2
16gb|AY092982.1| Arabidopsis thaliana putative protein (At3g63190)... 42 2.2
17gb|AY056778.1| Arabidopsis thaliana AT3g63190/F16M2_40 mRNA, com... 42 2.2
18gb|AC105155.9| Mus musculus chromosome 3, clone RP24-346C8, comp... 42 2.2
19gb|AC159229.2| Mus musculus BAC clone RP24-351I2 from chromosome... 42 2.2
20gb|AF372883.1|AF372883 Arabidopsis thaliana AT3g63190/F16M2_40 m... 42 2.2
21emb|BX822699.1|CNS0A72X Arabidopsis thaliana Full-length cDNA Co... 42 2.2
22emb|BX825146.1|CNS0A6FZ Arabidopsis thaliana Full-length cDNA Co... 42 2.2
23gb|BT002678.1| Arabidopsis thaliana At3g63190/F16M2_40 gene, com... 42 2.2
24gb|AC140361.2| Mus musculus BAC clone RP24-247B3 from chromosome... 42 2.2
25gb|AC131036.4| Mus musculus chromosome 5, clone RP23-358D12, com... 40 8.9
26ref|XM_956989.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.9
27ref|XM_328654.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.9
28gb|AC111010.5| Mus musculus BAC clone RP23-419L21 from chromosom... 40 8.9
29gb|AC166290.7| Mus musculus BAC RP23-14P17 (Roswell Park Cancer... 40 8.9
30gb|AC163275.4| Mus musculus chromosome 5, clone RP23-458G12, com... 40 8.9
31ref|XM_742778.1| Aspergillus fumigatus Af293 tRNA-splicing endon... 40 8.9
32ref|XM_539204.2| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
33ref|XM_852242.1| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
34ref|XM_852201.1| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
35ref|XM_852160.1| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
36ref|XM_852120.1| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
37ref|XM_852074.1| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
38ref|XM_843706.1| PREDICTED: Canis familiaris similar to plectin ... 40 8.9
39gb|AC121590.2| Mus musculus BAC clone RP23-281L22 from 2, comple... 40 8.9
40gb|AC110540.7| Mus musculus chromosome 3, clone RP23-105B8, comp... 40 8.9
41gb|AC160063.12| Mus musculus 10 BAC RP24-502H14 (Roswell Park Ca... 40 8.9
42gb|AC154993.9| Mus musculus chromosome 3, clone RP23-246L14, com... 40 8.9
43emb|AL844892.5| Human DNA sequence from clone RP11-396M20 on chr... 40 8.9
44emb|AL607062.10| Human DNA sequence from clone RP11-439F7 on chr... 40 8.9
45gb|AF306784.1| Cherax quadricarinatus vitellogenin (vg) mRNA, co... 40 8.9
46gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 8.9
47gb|AC118290.7| Rattus norvegicus 2 BAC CH230-366D18 (Children's ... 40 8.9
48emb|BX571658.1| Wolinella succinogenes, complete genome; segment... 40 8.9
49emb|AL596086.9| Mouse DNA sequence from clone RP23-168C20 on chr... 40 8.9
50emb|BX323864.8| Zebrafish DNA sequence from clone CH211-218K4 in... 40 8.9
51emb|BX511254.6| Zebrafish DNA sequence from clone DKEYP-90G2 in ... 40 8.9
52gb|AC010863.10| Homo sapiens chromosome 10 clone RP11-346E7, com... 40 8.9
53gb|AC007518.32| Mus musculus chromosome , clone CT7-345D4, compl... 40 8.9
54gb|AC106799.3| Homo sapiens chromosome 5 clone RP11-445O3, compl... 40 8.9
55dbj|AK138983.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 8.9
56gb|AC026711.6| Homo sapiens chromosome 5 clone CTD-2093E18, comp... 40 8.9
57ref|XM_626980.1| Cryptosporidium parvum Iowa II hypothetical pro... 40 8.9
58gb|AC153884.1| Mus musculus 6 BAC RP23-476E22 (Roswell Park Can... 40 8.9
59dbj|BS000019.1| Pan troglodytes chromosome 22 clone:PTB-023I17, ... 40 8.9
60gb|AC145738.4| Mus musculus BAC clone RP24-293H7 from 3, complet... 40 8.9
61gb|AC147968.2| Gallus gallus BAC clone CH261-119F24 from chromos... 40 8.9
62emb|AL928700.7| Mouse DNA sequence from clone RP23-388J20 on chr... 40 8.9
63emb|AL928543.5| Mouse DNA sequence from clone RP23-345P1 on chro... 40 8.9
64emb|AL845165.4| Mouse DNA sequence from clone RP23-281N9 on chro... 40 8.9 
>ref|XM_478772.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1227

 Score =  414 bits (209), Expect = e-112
 Identities = 332/373 (89%)
 Strand = Plus / Minus

                                                                       
Query: 262 tcctgttccttctgcttttggatggcttcaacctttttcatgtactcgtctgtgattttt 321
           ||||||||||||||||||||||| ||||| | |||||||||||||||||| || | ||||
Sbjct: 882 tcctgttccttctgcttttggatagcttcgatctttttcatgtactcgtcagtaactttt 823

                                                                       
Query: 322 tgtagatcggctgataaatccttcacattatcttcagaaagtttcttttccttctctagc 381
           |||||||| || || ||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 822 tgtagatcagcggacaaatccttcacgttatcttcagaaagtttcttttccttctcaagc 763

                                                                       
Query: 382 ttatcataggctttgattgcgtctcgtcttatgtttctgatagcaaccttgccttcttca 441
           ||||| || |||||||| || |||| ||||||||| || |||||||||||||||||||||
Sbjct: 762 ttatcgtaagctttgatggcatctcttcttatgttccttatagcaaccttgccttcttca 703

                                                                       
Query: 442 gataacttagctacggtttttgtcatctcctttctgcgatcagatgtcaatggtgggaca 501
           | ||| ||||| || ||||||| ||  ||||||||||| ||||| ||||||||||| |||
Sbjct: 702 gctaatttagcaacagtttttgccaattcctttctgcggtcagaagtcaatggtggaaca 643

                                                                       
Query: 502 gtgactcgtatcacttctccatcattgcttggtgttaccccaatatttgcagcaactata 561
           |||||||| |||||||||||||||||||||||||| ||||| | ||||||||||||||| 
Sbjct: 642 gtgactcgaatcacttctccatcattgcttggtgtaacccccagatttgcagcaactatt 583

                                                                       
Query: 562 gctttctcaatgagcttgaggcaagacttgtcatatggctggataagaagagaagtcgca 621
           | ||||||||||||||||||| | || |||||||||||||| ||||| |||||||| |||
Sbjct: 582 gttttctcaatgagcttgagggaggatttgtcatatggctgaataaggagagaagttgca 523

                        
Query: 622 tctggagtattta 634
           |||||||| ||||
Sbjct: 522 tctggagtgttta 510
to top
>dbj|AK065242.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002I12, full
           insert sequence
          Length = 1226

 Score =  391 bits (197), Expect = e-105
 Identities = 330/373 (88%), Gaps = 1/373 (0%)
 Strand = Plus / Minus

                                                                       
Query: 262 tcctgttccttctgcttttggatggcttcaacctttttcatgtactcgtctgtgattttt 321
           ||||||||||||||||||||||| ||||| | |||||||||||||||||| || | ||||
Sbjct: 881 tcctgttccttctgcttttggatagcttcgatctttttcatgtactcgtcagtaactttt 822

                                                                       
Query: 322 tgtagatcggctgataaatccttcacattatcttcagaaagtttcttttccttctctagc 381
            ||||||| || || ||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 821 -gtagatcagcggacaaatccttcacgttatcttcagaaagtttcttttccttctcaagc 763

                                                                       
Query: 382 ttatcataggctttgattgcgtctcgtcttatgtttctgatagcaaccttgccttcttca 441
           ||||| || ||| |||| || |||| ||||||||| || |||||||||||||||||||||
Sbjct: 762 ttatcgtaagctatgatggcatctcttcttatgttccttatagcaaccttgccttcttca 703

                                                                       
Query: 442 gataacttagctacggtttttgtcatctcctttctgcgatcagatgtcaatggtgggaca 501
           | ||| ||||| || ||||||| ||  ||||||||||| ||||| ||||||||||| |||
Sbjct: 702 gctaatttagcaacagtttttgccaattcctttctgcggtcagaagtcaatggtggaaca 643

                                                                       
Query: 502 gtgactcgtatcacttctccatcattgcttggtgttaccccaatatttgcagcaactata 561
           |||||||| |||||||||||||||||||||||||| ||||| | ||||||||||||||| 
Sbjct: 642 gtgactcgaatcacttctccatcattgcttggtgtaacccccagatttgcagcaactatt 583

                                                                       
Query: 562 gctttctcaatgagcttgaggcaagacttgtcatatggctggataagaagagaagtcgca 621
           | ||||||||||||||||||| | || |||||||||||||| ||||| |||||||| |||
Sbjct: 582 gttttctcaatgagcttgagggaggatttgtcatatggctgaataaggagagaagttgca 523

                        
Query: 622 tctggagtattta 634
           |||||||| ||||
Sbjct: 522 tctggagtgttta 510
to top
>gb|AY108240.1| Zea mays PCO100302 mRNA sequence
          Length = 776

 Score =  349 bits (176), Expect = 7e-93
 Identities = 296/336 (88%)
 Strand = Plus / Minus

                                                                       
Query: 294 ctttttcatgtactcgtctgtgattttttgtagatcggctgataaatccttcacattatc 353
           |||||||||||||||||| |||| ||||||||| || ||||| ||||| |||||||| ||
Sbjct: 775 ctttttcatgtactcgtccgtgactttttgtaggtcagctgacaaatctttcacattgtc 716

                                                                       
Query: 354 ttcagaaagtttcttttccttctctagcttatcataggctttgattgcgtctcgtcttat 413
           ||||||||| ||||||||||||| ||| ||||| || ||||||||||| |||| ||||||
Sbjct: 715 ttcagaaagcttcttttccttctgtagtttatcgtaagctttgattgcatctcttcttat 656

                                                                       
Query: 414 gtttctgatagcaaccttgccttcttcagataacttagctacggtttttgtcatctcctt 473
           ||| || |||||||||||||| |||||||  || |||||||| || ||||  |  |||||
Sbjct: 655 gttccttatagcaaccttgccatcttcagccaatttagctactgtctttgctaattcctt 596

                                                                       
Query: 474 tctgcgatcagatgtcaatggtgggacagtgactcgtatcacttctccatcattgcttgg 533
           |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||
Sbjct: 595 tctgcgatcagatgtcaatggtgggacagtcactcgtatcacttctccgtcattgcttgg 536

                                                                       
Query: 534 tgttaccccaatatttgcagcaactatagctttctcaatgagcttgaggcaagacttgtc 593
           ||| || |||| |||||| |||||||||| |||||| || ||||||||||  ||||||||
Sbjct: 535 tgtcacaccaagatttgcggcaactatagttttctcgataagcttgaggcttgacttgtc 476

                                               
Query: 594 atatggctggataagaagagaagtcgcatctggagt 629
           |||||| || |||||||||||||| |||||||||||
Sbjct: 475 atatggttgaataagaagagaagttgcatctggagt 440
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  155 bits (78), Expect = 2e-34
 Identities = 105/114 (92%)
 Strand = Plus / Minus

                                                                            
Query: 470      cctttctgcgatcagatgtcaatggtgggacagtgactcgtatcacttctccatcattgc 529
                |||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 22952090 cctttctgcggtcagaagtcaatggtggaacagtgactcgaatcacttctccatcattgc 22952031

                                                                      
Query: 530      ttggtgttaccccaatatttgcagcaactatagctttctcaatgagcttgaggc 583
                ||||||| ||||| | ||||||||||||||| | ||||||||||||||||||||
Sbjct: 22952030 ttggtgtaacccccagatttgcagcaactattgttttctcaatgagcttgaggc 22951977



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                                 
Query: 263      cctgttccttctgcttttggatggcttcaacctttttcatgtactcgtc 311
                |||||||||||||||||||||| ||||| | ||||||||||||||||||
Sbjct: 22954341 cctgttccttctgcttttggatagcttcgatctttttcatgtactcgtc 22954293



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                     
Query: 321      ttgtagatcggctgataaatccttcacattatcttcagaaagtttcttttcct 373
                ||||||||| || || ||||||||||| |||||||||||||||||||||||||
Sbjct: 22954166 ttgtagatcagcggacaaatccttcacgttatcttcagaaagtttcttttcct 22954114



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                              
Query: 589      ttgtcatatggctggataagaagagaagtcgcatctggagtattta 634
                |||||||||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 22951887 ttgtcatatggctgaataaggagagaagttgcatctggagtgttta 22951842



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                     
Query: 427      accttgccttcttcagataacttagctacggtttttg 463
                |||||||||||||||| ||| ||||| || |||||||
Sbjct: 22952942 accttgccttcttcagctaatttagcaacagtttttg 22952906
to top
>dbj|AP005908.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1121_A05
          Length = 172668

 Score =  155 bits (78), Expect = 2e-34
 Identities = 105/114 (92%)
 Strand = Plus / Minus

                                                                         
Query: 470   cctttctgcgatcagatgtcaatggtgggacagtgactcgtatcacttctccatcattgc 529
             |||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 27304 cctttctgcggtcagaagtcaatggtggaacagtgactcgaatcacttctccatcattgc 27245

                                                                   
Query: 530   ttggtgttaccccaatatttgcagcaactatagctttctcaatgagcttgaggc 583
             ||||||| ||||| | ||||||||||||||| | ||||||||||||||||||||
Sbjct: 27244 ttggtgtaacccccagatttgcagcaactattgttttctcaatgagcttgaggc 27191



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                              
Query: 263   cctgttccttctgcttttggatggcttcaacctttttcatgtactcgtc 311
             |||||||||||||||||||||| ||||| | ||||||||||||||||||
Sbjct: 29555 cctgttccttctgcttttggatagcttcgatctttttcatgtactcgtc 29507



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                  
Query: 321   ttgtagatcggctgataaatccttcacattatcttcagaaagtttcttttcct 373
             ||||||||| || || ||||||||||| |||||||||||||||||||||||||
Sbjct: 29380 ttgtagatcagcggacaaatccttcacgttatcttcagaaagtttcttttcct 29328



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                           
Query: 589   ttgtcatatggctggataagaagagaagtcgcatctggagtattta 634
             |||||||||||||| ||||| |||||||| ||||||||||| ||||
Sbjct: 27101 ttgtcatatggctgaataaggagagaagttgcatctggagtgttta 27056



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 427   accttgccttcttcagataacttagctacggtttttg 463
             |||||||||||||||| ||| ||||| || |||||||
Sbjct: 28156 accttgccttcttcagctaatttagcaacagtttttg 28120
to top
>emb|AJ133751.1|SOL133751 Spinacia oleracea mRNA for chloroplast ribosome recycling factor
          Length = 1109

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 143/180 (79%)
 Strand = Plus / Minus

                                                                       
Query: 261 ctcctgttccttctgcttttggatggcttcaacctttttcatgtactcgtctgtgatttt 320
           ||||||||| |||||||| | ||| |  |||||||| ||||||||||| || || |  ||
Sbjct: 827 ctcctgttctttctgcttgtagatagactcaaccttcttcatgtactcatcggtcaactt 768

                                                                       
Query: 321 ttgtagatcggctgataaatccttcacattatcttcagaaagtttcttttccttctctag 380
            || ||||| || ||||  || |||||||||||||| ||||| || ||||||||||| ||
Sbjct: 767 ctgcagatcagccgataggtctttcacattatcttccgaaagctttttttccttctcaag 708

                                                                       
Query: 381 cttatcataggctttgattgcgtctcgtcttatgtttctgatagcaaccttgccttcttc 440
            || ||||| | ||| |  || |||| ||||||||| || |  |||||||| ||||||||
Sbjct: 707 tttttcataagatttcagagcatctcttcttatgttcctcactgcaacctttccttcttc 648
to top
>emb|X72384.1|DCD2NLP D.carota D2 mRNA for glycine rich protein
          Length = 946

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 333 tgataaatccttcacattatcttcagaaagtttcttttccttctctagcttatcataggc 392
           |||||| ||||||||||||||||| || || || |||||||| || || |||||||||| 
Sbjct: 600 tgataagtccttcacattatcttctgagagctttttttccttttcaagtttatcatagga 541

                                
Query: 393 tttgattgcgtctcgtcttat 413
           ||| || || |||| ||||||
Sbjct: 540 tttaatggcatctcttcttat 520
to top
>emb|AL136967.5| Human DNA sequence from clone RP1-149M18 on chromosome 6 Contains the
             NCR2 gene for natural cytotoxicity triggering receptor 2
             and four CpG islands, complete sequence
          Length = 115295

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     aaggaaactgagacttttagag 22
             ||||||||||||||||||||||
Sbjct: 14693 aaggaaactgagacttttagag 14714
to top
>emb|CR450763.5| Zebrafish DNA sequence from clone CH211-180M24, complete sequence
          Length = 97685

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 276   cttttggatggcttcaaccttt 297
             ||||||||||||||||||||||
Sbjct: 13586 cttttggatggcttcaaccttt 13607
to top
>gb|AC160655.2| Pan troglodytes BAC clone CH251-26F13 from chromosome unknown, complete
              sequence
          Length = 197508

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 1      aaggaaactgagacttttagag 22
              ||||||||||||||||||||||
Sbjct: 175070 aaggaaactgagacttttagag 175049
to top
>gb|AC160057.2| Pan troglodytes BAC clone CH251-416M4 from chromosome unknown, complete
              sequence
          Length = 168684

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1      aaggaaactgagacttttagag 22
              ||||||||||||||||||||||
Sbjct: 121788 aaggaaactgagacttttagag 121809
to top
>gb|AY112589.1| Zea mays CL61174_1 mRNA sequence
          Length = 414

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 257 tcagctcctgttccttctgcttttggatgg 286
           |||| ||||||||||||||||| |||||||
Sbjct: 374 tcagttcctgttccttctgcttctggatgg 403
to top
>ref|NM_116184.2| Arabidopsis thaliana unknown protein AT3G63190 mRNA, complete cds
          Length = 1235

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 866 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 814
to top
>gb|AC122253.5| Mus musculus BAC clone RP23-171K3 from chromosome 17, complete sequence
          Length = 197161

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 256    ctcagctcctgttccttctgc 276
              |||||||||||||||||||||
Sbjct: 191378 ctcagctcctgttccttctgc 191358
to top
>gb|AC103604.4| Mus musculus chromosome 3, clone RP23-95A20, complete sequence
          Length = 170670

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 555    aactatagctttctcaatgag 575
              |||||||||||||||||||||
Sbjct: 162970 aactatagctttctcaatgag 162950
to top
>gb|AY092982.1| Arabidopsis thaliana putative protein (At3g63190) mRNA, complete
           cds
          Length = 1173

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 804 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 752
to top
>gb|AY056778.1| Arabidopsis thaliana AT3g63190/F16M2_40 mRNA, complete cds
          Length = 1212

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 866 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 814
to top
>gb|AC105155.9| Mus musculus chromosome 3, clone RP24-346C8, complete sequence
          Length = 162298

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 555    aactatagctttctcaatgag 575
              |||||||||||||||||||||
Sbjct: 134142 aactatagctttctcaatgag 134162
to top
>gb|AC159229.2| Mus musculus BAC clone RP24-351I2 from chromosome 12, complete sequence
          Length = 134517

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 203   tcagaaatcttgtggccagtt 223
             |||||||||||||||||||||
Sbjct: 58113 tcagaaatcttgtggccagtt 58133
to top
>gb|AF372883.1|AF372883 Arabidopsis thaliana AT3g63190/F16M2_40 mRNA, complete cds
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 786 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 734
to top
>emb|BX822699.1|CNS0A72X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB59ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1225

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 916 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 864
to top
>emb|BX825146.1|CNS0A6FZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL15ZF09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1062

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 802 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 750
to top
>gb|BT002678.1| Arabidopsis thaliana At3g63190/F16M2_40 gene, complete cds
          Length = 828

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 337 aaatccttcacattatcttcagaaagtttcttttccttctctagcttatcata 389
           ||||||||||| || ||||| || || ||||| |||||||| || ||||||||
Sbjct: 737 aaatccttcacgttgtcttctgacagcttcttctccttctcgagtttatcata 685
to top
>gb|AC140361.2| Mus musculus BAC clone RP24-247B3 from chromosome 17, complete sequence
          Length = 157937

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 256    ctcagctcctgttccttctgc 276
              |||||||||||||||||||||
Sbjct: 115698 ctcagctcctgttccttctgc 115718
to top
>gb|AC131036.4| Mus musculus chromosome 5, clone RP23-358D12, complete sequence
          Length = 197112

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 266   gttccttctgcttttggatggctt 289
             ||||| ||||||||||||||||||
Sbjct: 59770 gttccctctgcttttggatggctt 59793
to top
>ref|XM_956989.1| Neurospora crassa OR74A hypothetical protein (NCU07949.1) partial
            mRNA
          Length = 8481

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 364  ttcttttccttctctagctt 383
            ||||||||||||||||||||
Sbjct: 3755 ttcttttccttctctagctt 3736
to top
>ref|XM_328654.1| Neurospora crassa OR74A hypothetical protein (NCU07949.1) partial
            mRNA
          Length = 8481

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 364  ttcttttccttctctagctt 383
            ||||||||||||||||||||
Sbjct: 3755 ttcttttccttctctagctt 3736
to top
>gb|AC111010.5| Mus musculus BAC clone RP23-419L21 from chromosome 14, complete
             sequence
          Length = 205141

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 364   ttcttttccttctctagctt 383
             ||||||||||||||||||||
Sbjct: 23505 ttcttttccttctctagctt 23524
to top
>gb|AC166290.7| Mus musculus  BAC RP23-14P17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 242055

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 464   tcatctcctttctgcgatca 483
             ||||||||||||||||||||
Sbjct: 96145 tcatctcctttctgcgatca 96126
to top
>gb|AC163275.4| Mus musculus chromosome 5, clone RP23-458G12, complete sequence
          Length = 176643

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 266    gttccttctgcttttggatggctt 289
              ||||| ||||||||||||||||||
Sbjct: 104744 gttccctctgcttttggatggctt 104767
to top
>ref|XM_742778.1| Aspergillus fumigatus Af293 tRNA-splicing endonuclease (Afu6g02060)
            partial mRNA
          Length = 6231

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 385  tcataggctttgattgcgtc 404
            ||||||||||||||||||||
Sbjct: 3143 tcataggctttgattgcgtc 3124
to top
>ref|XM_539204.2| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 1 (LOC482083), mRNA
          Length = 15160

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6612 cagctcctgttccttctgct 6593
to top
>ref|XM_852242.1| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 8 (LOC482083), mRNA
          Length = 14734

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6186 cagctcctgttccttctgct 6167
to top
>ref|XM_852201.1| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 7 (LOC482083), mRNA
          Length = 14734

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6186 cagctcctgttccttctgct 6167
to top
>ref|XM_852160.1| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 6 (LOC482083), mRNA
          Length = 15175

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6627 cagctcctgttccttctgct 6608
to top
>ref|XM_852120.1| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 5 (LOC482083), mRNA
          Length = 14749

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6201 cagctcctgttccttctgct 6182
to top
>ref|XM_852074.1| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 4 (LOC482083), mRNA
          Length = 14863

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6315 cagctcctgttccttctgct 6296
to top
>ref|XM_843706.1| PREDICTED: Canis familiaris similar to plectin 1 isoform 1,
            transcript variant 2 (LOC482083), mRNA
          Length = 14812

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  cagctcctgttccttctgct 277
            ||||||||||||||||||||
Sbjct: 6264 cagctcctgttccttctgct 6245
to top
>gb|AC121590.2| Mus musculus BAC clone RP23-281L22 from 2, complete sequence
          Length = 167364

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ataggctttgattgcgtctc 406
             ||||||||||||||||||||
Sbjct: 78585 ataggctttgattgcgtctc 78566
to top
>gb|AC110540.7| Mus musculus chromosome 3, clone RP23-105B8, complete sequence
          Length = 232416

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   agaaagtttcttttccttct 376
             ||||||||||||||||||||
Sbjct: 57587 agaaagtttcttttccttct 57606
to top
>gb|AC160063.12| Mus musculus 10 BAC RP24-502H14 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 158603

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 560   tagctttctcaatgagcttg 579
             ||||||||||||||||||||
Sbjct: 80130 tagctttctcaatgagcttg 80149
to top
>gb|AC154993.9| Mus musculus chromosome 3, clone RP23-246L14, complete sequence
          Length = 208416

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 357    agaaagtttcttttccttct 376
              ||||||||||||||||||||
Sbjct: 203871 agaaagtttcttttccttct 203890
to top
>emb|AL844892.5| Human DNA sequence from clone RP11-396M20 on chromosome 10 Contains the
             5' end of the GRID1 gene for glutamate receptor
             (ionotropic) delta 1, the 3' end of the gene for  friend
             of EBNA2 (FOE) (KIAA0261) and five CpG islands, complete
             sequence
          Length = 167780

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 252   cttgctcagctcctgttcct 271
             ||||||||||||||||||||
Sbjct: 64036 cttgctcagctcctgttcct 64055
to top
>emb|AL607062.10| Human DNA sequence from clone RP11-439F7 on chromosome 10 Contains a
             novel gene (LOC221035), complete sequence
          Length = 88210

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 458   tttttgtcatctcctttctg 477
             ||||||||||||||||||||
Sbjct: 68033 tttttgtcatctcctttctg 68014
to top
>gb|AF306784.1| Cherax quadricarinatus vitellogenin (vg) mRNA, complete cds
          Length = 7944

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 341  ccttcacattatcttcagaa 360
            ||||||||||||||||||||
Sbjct: 3880 ccttcacattatcttcagaa 3861
to top
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 266     gttccttctgcttttggatg 285
               ||||||||||||||||||||
Sbjct: 2037164 gttccttctgcttttggatg 2037145
to top
>gb|AC118290.7| Rattus norvegicus 2 BAC CH230-366D18 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 210896

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 132    agtcttagcaagagtccaac 151
              ||||||||||||||||||||
Sbjct: 193966 agtcttagcaagagtccaac 193985
to top
>emb|BX571658.1| Wolinella succinogenes, complete genome; segment 2/7
          Length = 346792

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   gtatcacttctccatcattg 528
             ||||||||||||||||||||
Sbjct: 85185 gtatcacttctccatcattg 85166
to top
>emb|AL596086.9| Mouse DNA sequence from clone RP23-168C20 on chromosome 11 Contains the
              3' end of the Tex14 gene for testis expressed gene 14,
              complete sequence
          Length = 200501

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 258    cagctcctgttccttctgcttttg 281
              ||||||||||| ||||||||||||
Sbjct: 186131 cagctcctgtttcttctgcttttg 186154
to top
>emb|BX323864.8| Zebrafish DNA sequence from clone CH211-218K4 in linkage group 17,
              complete sequence
          Length = 154824

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 462    tgtcatctcctttctgcgat 481
              ||||||||||||||||||||
Sbjct: 148312 tgtcatctcctttctgcgat 148331
to top
>emb|BX511254.6| Zebrafish DNA sequence from clone DKEYP-90G2 in linkage group 17,
              complete sequence
          Length = 185139

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 462    tgtcatctcctttctgcgat 481
              ||||||||||||||||||||
Sbjct: 138824 tgtcatctcctttctgcgat 138843
to top
>gb|AC010863.10| Homo sapiens chromosome 10 clone RP11-346E7, complete sequence
          Length = 186902

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 458   tttttgtcatctcctttctg 477
             ||||||||||||||||||||
Sbjct: 64839 tttttgtcatctcctttctg 64820
to top
>gb|AC007518.32| Mus musculus chromosome , clone CT7-345D4, complete sequence
          Length = 193714

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 464    tcatctcctttctgcgatca 483
              ||||||||||||||||||||
Sbjct: 175471 tcatctcctttctgcgatca 175452
to top
>gb|AC106799.3| Homo sapiens chromosome 5 clone RP11-445O3, complete sequence
          Length = 176095

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 265    tgttccttctgcttttggat 284
              ||||||||||||||||||||
Sbjct: 145310 tgttccttctgcttttggat 145291
to top
>dbj|AK138983.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length
            enriched library, clone:A530045A01 product:hypothetical
            protein, full insert sequence
          Length = 2593

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 266  gttccttctgcttttggatggctt 289
            ||||| ||||||||||||||||||
Sbjct: 1241 gttccctctgcttttggatggctt 1264
to top
>gb|AC026711.6| Homo sapiens chromosome 5 clone CTD-2093E18, complete sequence
          Length = 191309

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 265   tgttccttctgcttttggat 284
             ||||||||||||||||||||
Sbjct: 14094 tgttccttctgcttttggat 14075
to top
>ref|XM_626980.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_700),
            partial mRNA
          Length = 5739

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 262  tcctgttccttctgcttttg 281
            ||||||||||||||||||||
Sbjct: 4173 tcctgttccttctgcttttg 4154
to top
>gb|AC153884.1| Mus musculus  6 BAC RP23-476E22 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 195597

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 402    gtctcgtcttatgtttctga 421
              ||||||||||||||||||||
Sbjct: 133775 gtctcgtcttatgtttctga 133756
to top
>dbj|BS000019.1| Pan troglodytes chromosome 22 clone:PTB-023I17, map 22, complete
             sequences
          Length = 141751

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 358   gaaagtttcttttccttctc 377
             ||||||||||||||||||||
Sbjct: 77045 gaaagtttcttttccttctc 77064
to top
>gb|AC145738.4| Mus musculus BAC clone RP24-293H7 from 3, complete sequence
          Length = 135567

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 525   attgcttggtgttaccccaa 544
             ||||||||||||||||||||
Sbjct: 22759 attgcttggtgttaccccaa 22740
to top
>gb|AC147968.2| Gallus gallus BAC clone CH261-119F24 from chromosome unknown, complete
              sequence
          Length = 209917

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 427    accttgccttcttcagataa 446
              ||||||||||||||||||||
Sbjct: 165413 accttgccttcttcagataa 165432
to top
>emb|AL928700.7| Mouse DNA sequence from clone RP23-388J20 on chromosome 2, complete
              sequence
          Length = 158364

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 366    cttttccttctctagcttat 385
              ||||||||||||||||||||
Sbjct: 111121 cttttccttctctagcttat 111140
to top
>emb|AL928543.5| Mouse DNA sequence from clone RP23-345P1 on chromosome 2, complete
             sequence
          Length = 90551

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 387   ataggctttgattgcgtctc 406
             ||||||||||||||||||||
Sbjct: 24017 ataggctttgattgcgtctc 23998
to top
>emb|AL845165.4| Mouse DNA sequence from clone RP23-281N9 on chromosome 2, complete
             sequence
          Length = 112789

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   gtatcacttctccatcattg 528
             ||||||||||||||||||||
Sbjct: 40066 gtatcacttctccatcattg 40047


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,379,374
Number of Sequences: 3902068
Number of extensions: 6379374
Number of successful extensions: 137984
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 137789
Number of HSP's gapped (non-prelim): 193
length of query: 651
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 628
effective length of database: 17,143,297,704
effective search space: 10765990958112
effective search space used: 10765990958112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top