| Clone Name | rbags5d02 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_185010.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1709 Score = 262 bits (132), Expect = 1e-66 Identities = 291/344 (84%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 356 |||||||||||||||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 1233 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 1174 Query: 357 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagccacgccgagtg 416 ||||||||| || ||||| || |||||||||| || || ||||||||||| ||||||| Sbjct: 1173 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagta 1114 Query: 417 ccgcgccaggtcctccggcatgtactccggcgccttcacaagagtagggcggatcgctga 476 || || |||| ||| ||||| || || || | ||| ||||||| |||| ||| ||||| Sbjct: 1113 cctagctaggttctcgggcatatattctggaggctttacaagagatgggcagattgctga 1054 Query: 477 agcagacagatttgcttctctctgaaacctgtcctcgaaaccagtcatagatgcagtgcc 536 |||||||||||||||||||||||| |||||||| || ||||||||||| ||||||||||| Sbjct: 1053 agcagacagatttgcttctctctggaacctgtcttcaaaaccagtcattgatgcagtgcc 994 Query: 537 accacataacatagtgttctcaagcagttgcttttggtactccgatgcgacgtttgaaac 596 |||||||||||||||||| |||||||| || |||||||| | || ||| || || || Sbjct: 993 accacataacatagtgttttcaagcagctgacgatggtactctggtgtgacattcgagac 934 Query: 597 actagtaattagctggtggacaataccataatcttctaagccca 640 || |||| ||||| || ||||| ||||||||||||||||||| Sbjct: 933 gcttgtaaccagctgatgaacaattccataatcttctaagccca 890
>dbj|AK069426.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020D04, full insert sequence Length = 1801 Score = 254 bits (128), Expect = 3e-64 Identities = 290/344 (84%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 356 |||||||||||||||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 1316 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 1257 Query: 357 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagccacgccgagtg 416 ||||||||| || ||||| || |||||||||| || || ||||||||||| ||||||| Sbjct: 1256 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagta 1197 Query: 417 ccgcgccaggtcctccggcatgtactccggcgccttcacaagagtagggcggatcgctga 476 || || |||| ||| ||||| || || || | ||| ||||||| ||| ||| ||||| Sbjct: 1196 cctagctaggttctcgggcatatattctggaggctttacaagagatgggtagattgctga 1137 Query: 477 agcagacagatttgcttctctctgaaacctgtcctcgaaaccagtcatagatgcagtgcc 536 |||||||||||||||||||||||| |||||||| || ||||||||||| ||||||||||| Sbjct: 1136 agcagacagatttgcttctctctggaacctgtcttcaaaaccagtcattgatgcagtgcc 1077 Query: 537 accacataacatagtgttctcaagcagttgcttttggtactccgatgcgacgtttgaaac 596 |||||||||||||||||| |||||||| || |||||||| | || ||| || || || Sbjct: 1076 accacataacatagtgttttcaagcagctgacgatggtactctggtgtgacattcgagac 1017 Query: 597 actagtaattagctggtggacaataccataatcttctaagccca 640 || |||| ||||| || ||||| ||||||||||||||||||| Sbjct: 1016 gcttgtaaccagctgatgaacaattccataatcttctaagccca 973
>gb|AY110996.1| Zea mays CL51592_-1 mRNA sequence Length = 615 Score = 151 bits (76), Expect = 3e-33 Identities = 253/312 (81%) Strand = Plus / Plus Query: 301 aagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgacgtgc 360 |||||||||||||| || |||||||| || ||||| || || ||||||||||| || ||| Sbjct: 284 aagcacttcttgtgcacaatggacggccccgtctcatcatactcgcccttggtcacatgc 343 Query: 361 tggttctgggggaagaccaccttggccaggatcgcgccgcccagccacgccgagtgccgc 420 ||||| || ||||| || ||||| |||| ||||| || |||| ||| ||||||| || Sbjct: 344 tggttttgagggaaaacgaccttagccaatatcgcaccacccaaccaggccgagtacctt 403 Query: 421 gccaggtcctccggcatgtactccggcgccttcacaagagtagggcggatcgctgaagca 480 || |||| ||| |||||||| || || | ||||||||| | || | ||| ||||||||| Sbjct: 404 gctaggttctcgggcatgtattcaggaggcttcacaagtgatggacagattgctgaagca 463 Query: 481 gacagatttgcttctctctgaaacctgtcctcgaaaccagtcatagatgcagtgccacca 540 ||||||||||||||||||| ||||| ||||| || |||||||| |||| ||||||||| Sbjct: 464 cacagatttgcttctctctggaacctatcctcaaagccagtcattgatgaggtgccacca 523 Query: 541 cataacatagtgttctcaagcagttgcttttggtactccgatgcgacgtttgaaacacta 600 |||||||| || || |||||||| || |||||||| |||| || ||||| |||||| Sbjct: 524 cataacatggtattttcaagcagctgacgatggtactctgatgaaacatttgagacacta 583 Query: 601 gtaattagctgg 612 || | ||||||| Sbjct: 584 gtgactagctgg 595
>gb|BT016713.1| Zea mays clone Contig546 mRNA sequence Length = 1257 Score = 137 bits (69), Expect = 5e-29 Identities = 144/169 (85%) Strand = Plus / Minus Query: 472 gctgaagcagacagatttgcttctctctgaaacctgtcctcgaaaccagtcatagatgca 531 ||||||||||||||||||||||||||||| ||||||||||| || |||||||| |||| Sbjct: 769 gctgaagcagacagatttgcttctctctggaacctgtcctcaaagccagtcattgatgtg 710 Query: 532 gtgccaccacataacatagtgttctcaagcagttgcttttggtactccgatgcgacgttt 591 ||||||||||||||||| || || |||||||| || |||||||| |||| || ||| Sbjct: 709 gtgccaccacataacatggtattttcaagcagctgacgatggtactctgatgaaacattt 650 Query: 592 gaaacactagtaattagctggtggacaataccataatcttctaagccca 640 || | ||||||| ||||||||| || |||||||||||||| ||||||| Sbjct: 649 gaggcgctagtaactagctggtgaacgataccataatcttccaagccca 601
>gb|AY107222.1| Zea mays PCO096729 mRNA sequence Length = 943 Score = 137 bits (69), Expect = 5e-29 Identities = 144/169 (85%) Strand = Plus / Minus Query: 472 gctgaagcagacagatttgcttctctctgaaacctgtcctcgaaaccagtcatagatgca 531 ||||||||||||||||||||||||||||| ||||||||||| || |||||||| |||| Sbjct: 497 gctgaagcagacagatttgcttctctctggaacctgtcctcaaagccagtcattgatgtg 438 Query: 532 gtgccaccacataacatagtgttctcaagcagttgcttttggtactccgatgcgacgttt 591 ||||||||||||||||| || || |||||||| || |||||||| |||| || ||| Sbjct: 437 gtgccaccacataacatggtattttcaagcagctgacgatggtactctgatgaaacattt 378 Query: 592 gaaacactagtaattagctggtggacaataccataatcttctaagccca 640 || | ||||||| ||||||||| || |||||||||||||| ||||||| Sbjct: 377 gaggcgctagtaactagctggtgaacgataccataatcttccaagccca 329
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 125 bits (63), Expect = 2e-25 Identities = 105/119 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 356 |||||||||||||||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 32144983 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 32144924 Query: 357 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagccacgccgagt 415 ||||||||| || ||||| || |||||||||| || || ||||||||||| ||||||| Sbjct: 32144923 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 32144865 Score = 91.7 bits (46), Expect = 3e-15 Identities = 106/126 (84%) Strand = Plus / Minus Query: 515 aaccagtcatagatgcagtgccaccacataacatagtgttctcaagcagttgcttttggt 574 |||||||||| ||||||||||||||||||||||||||||| |||||||| || |||| Sbjct: 32143934 aaccagtcattgatgcagtgccaccacataacatagtgttttcaagcagctgacgatggt 32143875 Query: 575 actccgatgcgacgtttgaaacactagtaattagctggtggacaataccataatcttcta 634 |||| | || ||| || || || || |||| ||||| || ||||| ||||||||||||| Sbjct: 32143874 actctggtgtgacattcgagacgcttgtaaccagctgatgaacaattccataatcttcta 32143815 Query: 635 agccca 640 |||||| Sbjct: 32143814 agccca 32143809 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 449 ccttcacaagagtagggcggatcgctgaagcagacagatttgcttctctctgaaacctgt 508 |||| ||||||| |||| ||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 32144748 cctttacaagagatgggcagattgctgaagcagacagatttgcttctctctggaacctgt 32144689 Query: 509 cctcgaaacc 518 | || ||||| Sbjct: 32144688 cttcaaaacc 32144679
>gb|AC084320.10| Oryza sativa chromosome 3 BAC OSJNBa0091J19 genomic sequence, complete sequence Length = 178158 Score = 125 bits (63), Expect = 2e-25 Identities = 105/119 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 356 |||||||||||||||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 146108 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 146049 Query: 357 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagccacgccgagt 415 ||||||||| || ||||| || |||||||||| || || ||||||||||| ||||||| Sbjct: 146048 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 145990 Score = 91.7 bits (46), Expect = 3e-15 Identities = 106/126 (84%) Strand = Plus / Minus Query: 515 aaccagtcatagatgcagtgccaccacataacatagtgttctcaagcagttgcttttggt 574 |||||||||| ||||||||||||||||||||||||||||| |||||||| || |||| Sbjct: 145059 aaccagtcattgatgcagtgccaccacataacatagtgttttcaagcagctgacgatggt 145000 Query: 575 actccgatgcgacgtttgaaacactagtaattagctggtggacaataccataatcttcta 634 |||| | || ||| || || || || |||| ||||| || ||||| ||||||||||||| Sbjct: 144999 actctggtgtgacattcgagacgcttgtaaccagctgatgaacaattccataatcttcta 144940 Query: 635 agccca 640 |||||| Sbjct: 144939 agccca 144934 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 449 ccttcacaagagtagggcggatcgctgaagcagacagatttgcttctctctgaaacctgt 508 |||| ||||||| |||| ||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 145873 cctttacaagagatgggcagattgctgaagcagacagatttgcttctctctggaacctgt 145814 Query: 509 cctcgaaacc 518 | || ||||| Sbjct: 145813 cttcaaaacc 145804
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 125 bits (63), Expect = 2e-25 Identities = 105/119 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 356 |||||||||||||||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 32235495 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 32235436 Query: 357 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagccacgccgagt 415 ||||||||| || ||||| || |||||||||| || || ||||||||||| ||||||| Sbjct: 32235435 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 32235377 Score = 91.7 bits (46), Expect = 3e-15 Identities = 106/126 (84%) Strand = Plus / Minus Query: 515 aaccagtcatagatgcagtgccaccacataacatagtgttctcaagcagttgcttttggt 574 |||||||||| ||||||||||||||||||||||||||||| |||||||| || |||| Sbjct: 32234446 aaccagtcattgatgcagtgccaccacataacatagtgttttcaagcagctgacgatggt 32234387 Query: 575 actccgatgcgacgtttgaaacactagtaattagctggtggacaataccataatcttcta 634 |||| | || ||| || || || || |||| ||||| || ||||| ||||||||||||| Sbjct: 32234386 actctggtgtgacattcgagacgcttgtaaccagctgatgaacaattccataatcttcta 32234327 Query: 635 agccca 640 |||||| Sbjct: 32234326 agccca 32234321 Score = 75.8 bits (38), Expect = 2e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 449 ccttcacaagagtagggcggatcgctgaagcagacagatttgcttctctctgaaacctgt 508 |||| ||||||| |||| ||| ||||||||||||||||||||||||||||| ||||||| Sbjct: 32235260 cctttacaagagatgggcagattgctgaagcagacagatttgcttctctctggaacctgt 32235201 Query: 509 cctcgaaacc 518 | || ||||| Sbjct: 32235200 cttcaaaacc 32235191
>emb|Y09623.1|LRACTINPA Lumbricus rubellus mRNA for actin, partial Length = 1119 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1117 agaagcacttcctgtggacgatggatgggccggactcgtcgta 1075
>emb|X96514.1|LTACT1567 L.terrestris mRNA for actin (1567 bp) Length = 1567 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1195 agaagcacttcctgtggacgatggatgggccggactcgtcgta 1153
>gb|AF303985.1|AF303985 Salmo trutta cardiac muscle actin mRNA, complete cds Length = 1134 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1132 agaagcacttcctgtggacgatggaagggccggcctcgtcgta 1090
>dbj|AB086242.1| Coryphaenoides yaquinae mRNA for skeletal alpha-actin type-2a, complete cds Length = 1582 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1132 agaagcacttcctgtggacgatggaggggccggcctcgtcgta 1090
>dbj|AB086240.1| Coryphaenoides armatus mRNA for skeletal alpha-actin type-2a, complete cds Length = 1587 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1132 agaagcacttcctgtggacgatggaggggccggcctcgtcgta 1090
>dbj|AB021652.1| Coryphaenoides cinereus mRNA for skeletal alpha-actin type-2, complete cds Length = 1568 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1139 agaagcacttcctgtggacgatggaggggccggcctcgtcgta 1097
>dbj|AB021650.1| Coryphaenoides acrolepis mRNA for skeletal alpha-actin type-2, complete cds Length = 1611 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1179 agaagcacttcctgtggacgatggaggggccggcctcgtcgta 1137
>gb|AY524976.1| Cydia pomonella actin gene, partial cds Length = 1205 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1203 agaagcacttgctgtggacgatggaggggccggactcgtcgta 1161
>gb|J01168.1|SUSACT2S Strongylocentrotus purpuratus actin 2 protein gene, complete cds Length = 1891 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1880 agaagcacttcctgtggacgatggatgggccggactcatcgta 1838
>gb|AF500273.3| Gadus morhua fast skeletal muscle alpha-actin mRNA, complete cds Length = 1592 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1174 agaagcacttcctgtggacgatggaggggcctgcctcgtcgta 1132
>emb|X96515.1|LTACT1820 L.terrestris act gene (1820 bp) Length = 1820 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| | ||||||||||| ||||||| ||||||||| Sbjct: 1790 agaagcacttcctatggacgatggatgggccggactcgtcgta 1748
>emb|X96512.1|LTACT1596 L.terrestris mRNA for actin (1596 bp) Length = 1596 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| | ||||||||||| ||||||| ||||||||| Sbjct: 1182 agaagcacttcctatggacgatggatgggccggactcgtcgta 1140
>emb|X05195.1|TPACT Tetrahymena pyriformis actin gene Length = 1234 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 |||||||||||| ||||||||||||| || |||| |||||||| ||| ||||||||| Sbjct: 1198 tcagaagcactttctgtggacgatggaaggaccggattcgtcgtattcggccttggtga 1140
>emb|X03076.1|SFACT15B Strongylocentrotus franciscanus actin gene Sfa 15B Length = 1876 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1724 agaagcacttcctgtggacgatggatgggccagactcgtcgta 1682
>emb|X03075.1|SFACT15A Strongylocentrotus franciscanus actin gene Sfa 15A Length = 1956 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1804 agaagcacttcctgtggacgatggatgggccagactcgtcgta 1762
>ref|NM_214469.1| Strongylocentrotus purpuratus actin (LOC373192), mRNA Length = 1131 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1129 agaagcacttcctgtggacgatggatgggccggactcatcgta 1087
>ref|NM_214528.1| Strongylocentrotus purpuratus cytoskeletal actin CyIIb (CyIIb), mRNA Length = 1131 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1129 agaagcacttcctgtggacgatggatgggccggactcatcgta 1087
>dbj|AB073380.1| Theragra chalcogramma mRNA for alpha skeletal actin-2, complete cds Length = 1601 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1200 agaagcacttcctgtggacgatggaggggcctgcctcgtcgta 1158
>dbj|AB073379.1| Theragra chalcogramma mRNA for alpha skeletal actin-1, complete cds Length = 1485 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1204 agaagcacttcctgtggacgatggaggggcctgcctcgtcgta 1162
>gb|U38960.1|FRU38960 Fugu rubripes alpha actin (alpha-cardiac actin2) gene, complete cds Length = 3990 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 3758 agaagcacttcctgtggacgatggaggggccggcctcatcgta 3716
>gb|J01170.1|SUSACBS Sea urchin (S.purpuratus) actin gene, clone SpG2-8, AA 313 to COOH terminus Length = 277 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 186 agaagcacttcctgtggacgatggatgggccggactcatcgta 144
>gb|J01169.1|SUSACAS Sea urchin (S.purpuratus) actin mRNA, clone SpG2, AA 313 to term Length = 628 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 186 agaagcacttcctgtggacgatggatgggccggactcatcgta 144
>gb|U82659.1|HTCYTACT2 Heliocidaris tuberculata cytoplasmic actin CyII (HtCyII) gene, exon 4 and partial cds Length = 744 Score = 54.0 bits (27), Expect = 6e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||||||||| Sbjct: 685 agaagcacttcctgtggacgatggacgggcc 655
>gb|M35323.1|SUSCYIIBA S.purpuratus cytoskeletal actin CyIIb gene, complete cds Length = 1972 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1827 agaagcacttcctgtggacgatggatgggccggactcatcgta 1785
>gb|J01202.1|SUSACTIN Sea urchin (S.purpuratus) actin gene, clone pSpG17 Length = 2748 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 2060 agaagcacttcctgtggacgatggatgggccggactcatcgta 2018
>dbj|D50029.1|CRASAA2 Goldfish mRNA for skeletal alpha-actin, complete cds Length = 1268 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || |||| ||||||||| Sbjct: 1175 agaagcacttcctgtggacgatggaaggaccggcctcgtcgta 1133
>ref|NM_001037157.1| Strongylocentrotus purpuratus actin 2 (LOC373190), mRNA Length = 1131 Score = 54.0 bits (27), Expect = 6e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1129 agaagcacttcctgtggacgatggatgggccggactcatcgta 1087
>gb|AY360221.1| Ricinus communis actin (ACT) mRNA, complete cds Length = 1615 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||| ||||||| ||||| ||||| | |||||| || |||||||||| Sbjct: 1312 agaagcacttcctgtggacaatggatgggccagactcgtcatactcgcccttgg 1259
>gb|M26111.1|GOOACTB Goose beta-actin mRNA, complete cds Length = 1994 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||||||||||| ||||||||| Sbjct: 1188 gtggacgatggacgggccggactcgtcgta 1159
>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence Length = 153766 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||||| |||||||||| | |||||| | ||||||||| Sbjct: 9226 tcagaagcacttcctgtggacgatagccgggccagactcgtcgta 9270
>gb|AF270649.1| Misgurnus mizolepis beta-actin gene, complete cds Length = 7339 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 301 aagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 6165 aagcacttcctgtggacgatggatgggccggactcatcgta 6125
>gb|AY663391.1| Triticum turgidum cultivar Langdon clone BAC 1156G16, complete sequence Length = 187012 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||||| |||||||||| | |||||| | ||||||||| Sbjct: 17842 tcagaagcacttcctgtggacgatagccgggccagactcgtcgta 17886
>gb|AF539593.1| Globodera rostochiensis actin mRNA, complete cds Length = 1131 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||||| |||||||||||||||||| | ||||||||| Sbjct: 1131 tcagaagcacttgcggtggacgatggacgggcccgactcgtcgta 1087
>gb|AY380801.1| Panagrellus redivivus actin gene, complete cds Length = 1248 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||||| |||||||||||||||||||| |||||||| Sbjct: 1248 tcagaagcacttgcggtggacgatggacgggccggattcgtcgta 1204
>gb|AY112716.1| Panagrellus redivivus actin mRNA, complete cds Length = 1131 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||||| |||||||||||||||||||| |||||||| Sbjct: 1131 tcagaagcacttgcggtggacgatggacgggccggattcgtcgta 1087
>gb|AY161281.1| Globodera rostochiensis actin 2 mRNA, complete cds Length = 1131 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||||| |||||||||||||||||| | ||||||||| Sbjct: 1131 tcagaagcacttgcggtggacgatggacgggcccgactcgtcgta 1087
>dbj|AB034210.1| Oikopleura longicauda OilMA2 gene for muscle actin, complete cds Length = 3580 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 |||||||||| ||||||||||||| || |||| |||||||| ||| ||||||||| Sbjct: 2755 agaagcactttctgtggacgatggatggaccggcttcgtcgtattcggccttggtga 2699
>gb|DQ084066.1| Callinectes sapidus beta-actin mRNA, complete cds Length = 1338 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtc 338 ||||||||||| ||||||||||||| ||||| | |||||| Sbjct: 1183 agaagcacttcctgtggacgatggaggggccagactcgtc 1144
>gb|AF285176.1|AF285176 Musa x paradisiaca actin (ACT1) gene, complete cds Length = 3816 Score = 48.1 bits (24), Expect = 0.036 Identities = 48/56 (85%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||||| ||||||| ||||| || |||| || ||||| |||||||||| Sbjct: 3619 tcagaagcacttcctgtggacaatggaaggaccggattcctcgtattcgcccttgg 3564
>gb|AY857865.1| Linum usitatissimum actin (Act1) mRNA, complete cds Length = 1470 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| |||||||||| || ||||||| |||||||| Sbjct: 1144 agaagcacttcctgtggacgattgaagggccggattcgtcgta 1102
>gb|BT018655.1| Zea mays clone EL01N0507B03.d mRNA sequence Length = 1378 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||| ||| |||| |||||||||||||| | ||||||||| Sbjct: 1101 agaagcatttcctgtgcacgatggacgggccagactcgtcgta 1059
>gb|AY646105.1| Trichoplusia ni putative cytoplasmic actin (A3b) mRNA, partial cds Length = 1024 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| |||| |||||||| ||||| | ||||||||| Sbjct: 686 agaagcacttcctgtgcacgatggaggggccagactcgtcgta 644
>gb|AY646104.1| Trichoplusia ni cytoplasmic actin (A3a) mRNA, partial cds Length = 957 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| |||| |||||||| ||||||| ||| ||||| Sbjct: 686 agaagcacttcctgtgcacgatggaggggccggactcatcgta 644
>gb|AY690421.1| Carassius auratus skeletal alpha-actin mRNA, complete cds Length = 1134 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||| || |||| ||||||||| Sbjct: 1132 agaagcacttcctgtggacaatggaaggaccggcctcgtcgta 1090
>gb|BC045406.1| Danio rerio actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:55618 IMAGE:2644533), complete cds Length = 1302 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || || | ||||||||| Sbjct: 1188 agaagcacttcctgtggacgatggatggacctgcctcgtcgta 1146
>gb|AY099151.1| Littorina littorea beta actin mRNA, partial cds Length = 983 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 964 agaagcactttcggtggacgatggaagggccggactcgtcgta 922
>gb|BC063950.1| Danio rerio bactin1, mRNA (cDNA clone MGC:77623 IMAGE:6996683), complete cds Length = 1679 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 1152 agaagcacttcctgtggacgatggatgggcc 1122
>emb|AJ012665.1|PAC012665 Plectus acuminatus mRNA for actin Length = 1861 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||||||||| | ||||||||| Sbjct: 1189 agaagcacttgcggtggacgatggacgggcccgactcgtcgta 1147
>gb|AY395871.1| Cyprinus carpio skeletal muscle actin mutant mRNA, complete cds Length = 1188 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||| || |||| ||||||||| Sbjct: 1136 agaagcacttcctgtggacaatggaaggaccggcctcgtcgta 1094
>gb|AY395870.1| Cyprinus carpio skeletal muscle alpha-actin mRNA, complete cds Length = 1184 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||| || |||| ||||||||| Sbjct: 1132 agaagcacttcctgtggacaatggaaggaccggcctcgtcgta 1090
>emb|CR682787.2|CNS0FPSF Tetraodon nigroviridis full-length cDNA Length = 1844 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||| || | |||||||||||| ||||||| ||||||||| Sbjct: 1216 agaagcatttgtggtggacgatggaggggccggactcgtcgta 1174
>emb|CR679698.2|CNS0FNEM Tetraodon nigroviridis full-length cDNA Length = 758 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| ||||||||||||| ||||||| |||||||| Sbjct: 628 agaagcactttctgtggacgatggaggggccggcttcgtcgta 586
>gb|BC045846.1| Danio rerio bactin1, mRNA (cDNA clone MGC:55989 IMAGE:3819668), complete cds Length = 1726 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 1198 agaagcacttcctgtggacgatggatgggcc 1168
>emb|Y13665.1|SKY13665 Saccoglossus kowalevskii mRNA for actin, 2049 bp Length = 2049 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 1159 agaagcacttgcggtggacgatggatgggccggactcgtcgta 1117
>ref|XM_781492.1| PREDICTED: Strongylocentrotus purpuratus similar to actin (41.8 kD) (act-2) (LOC581500), mRNA Length = 1333 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 1204 agaagcacttgcggtggacgatggatgggccggactcgtcgta 1162
>gb|BC065435.1| Danio rerio actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:77653 IMAGE:6997034), complete cds Length = 1316 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || || | ||||||||| Sbjct: 1168 agaagcacttcctgtggacgatggatggacctgcctcgtcgta 1126
>ref|NM_131591.1| Danio rerio actin, alpha 1, skeletal muscle (acta1), mRNA Length = 1284 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || || | ||||||||| Sbjct: 1160 agaagcacttcctgtggacgatggatggacctgcctcgtcgta 1118
>gb|AF056976.1|AF056976 Acremonium chrysogenum gamma-actin (act) gene, complete cds Length = 3240 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| |||||| |||||||||| Sbjct: 2478 agaagcacttgcggtggacgatggaggggccgctctcgtcgta 2436
>gb|S74059.1| Tg616=CyI actin [Tripneustes gratilla=sea urchins, embryos, Genomic, 5275 nt] Length = 5277 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 4277 agaagcacttcctgtggacgatggatgggcc 4247
>gb|AF180887.1|AF180887 Danio rerio skeletal alpha1 actin (acta1) mRNA, complete cds Length = 1284 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || || | ||||||||| Sbjct: 1160 agaagcacttcctgtggacgatggatggacctgcctcgtcgta 1118
>gb|DQ074455.1| Aedes aegypti actin 5 (act-5) mRNA, complete cds Length = 1409 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||| ||||||| |||||||| Sbjct: 1129 agaagcacttcctgtggacaatggatgggccggattcgtcgta 1087
>gb|DQ322244.2| Culex pipiens pipiens strain Buckeye actin mRNA, complete cds Length = 1564 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| ||| |||||||||||||||| ||||||||| Sbjct: 1167 agaagcacttgcggtgaacgatggacgggccggactcgtcgta 1125
>gb|U63566.1|U63566 Oxytricha sp. Aspen macronuclear actin I gene, partial cds Length = 1242 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 ||||| |||||| ||||||||||||| | ||| ||||||||||||| ||||||||| Sbjct: 1098 tcagatgcactttctgtggacgatggaggctccgttctcgtcgtagtcttccttggtga 1040
>gb|U63579.1|U63579 Oxytricha sp. Aspen. micronuclear actin I gene, partial sequence Length = 631 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 ||||| |||||| ||||||||||||| | ||| ||||||||||||| ||||||||| Sbjct: 264 tcagatgcactttctgtggacgatggaggctccgttctcgtcgtagtcttccttggtga 206
>gb|AC084593.1|CBRG42E09 Caenorhabditis briggsae cosmid G42E09, complete sequence Length = 41984 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Plus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 36270 agaagcacttgcggtggacgatggatgggccggactcgtcgta 36312
>gb|AC084484.1|CBRG03N05 Caenorhabditis briggsae cosmid G03N05, complete sequence Length = 29563 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 5734 agaagcacttgcggtggacgatggatgggccggactcgtcgta 5692
>gb|AF276076.1|AF276076 Ambystoma mexicanum cardiac actin mRNA, complete cds Length = 1565 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || || | ||||||||| Sbjct: 1185 agaagcacttcctgtggacgatggagggacctgcctcgtcgta 1143
>ref|NM_214529.1| Strongylocentrotus purpuratus cytoskeletal actin IIIa (CyIIIa), mRNA Length = 1131 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || |||| ||| ||||| Sbjct: 1129 agaagcacttcctgtggacgatggatggaccggactcatcgta 1087
>gb|AF369906.1| Sorghum bicolor clone BAC10J22 Sbb3766 sequence Length = 152439 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||| ||| ||||||||||||| ||||||| ||| ||||| Sbjct: 13032 agaagcatttcctgtggacgatggatgggccggactcatcgta 12990
>gb|AY107106.1| Zea mays PCO106910 mRNA sequence Length = 1839 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||| ||| |||| |||||||||||||| | ||||||||| Sbjct: 1500 agaagcatttcctgtgcacgatggacgggccagactcgtcgta 1458
>dbj|AB086889.1| Halocynthia roretzi mRNA for muscle actin, complete cds Length = 1341 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||| ||| ||||||||||||| || |||| ||||||||| Sbjct: 1173 agaagcatttcctgtggacgatggaaggtccggcctcgtcgta 1131
>emb|BX649405.13| Zebrafish DNA sequence from clone DKEY-190M16 in linkage group 1, complete sequence Length = 231915 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 53489 agaagcacttcctgtggacgatggatgggcc 53519
>emb|AL928650.5| Zebrafish DNA sequence from clone CH211-160D14 in linkage group 17, complete sequence Length = 178563 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Plus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 116089 agaagcacttcctgtggacgatggatgggcc 116119
>gb|U82663.1|HEACTCYII2 Heliocidaris erythrogramma cytoplasmic actin CyII (HeCyII) gene, exon 4 and partial cds Length = 939 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 585 agaagcacttcctgtggacgatggatgggcc 555
>gb|U22506.1|HEU22506 Heliocidaris erythrogramma cytoplasmic actin type II (hecyII) mRNA, partial cds Length = 1501 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 919 agaagcacttcctgtggacgatggatgggcc 889
>gb|U12272.1|HTCYI3 Heliocidaris tuberculata CyI cytoplasmic actin (HtCyI) gene, exon 4 and complete cds Length = 1012 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggcc 329 ||||||||||| ||||||||||||| ||||| Sbjct: 516 agaagcacttcctgtggacgatggatgggcc 486
>gb|M30511.1|SUSACT05 Sea urchin (S.purpuratus) cytoskeletal actin (CyIIIa), exons 3 and 4 Length = 1874 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||||||||| || |||| ||| ||||| Sbjct: 1475 agaagcacttcctgtggacgatggatggaccggactcatcgta 1433
>dbj|AB036756.1| Chrysophrys major mRNA for B-actin, complete cds Length = 1521 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 1155 agaagcacttgcggtggacgatggaggggccggactcgtcgta 1113
>dbj|D50028.1|CYISAA1 Carp mRNA for skeletal alpha-actin, complete cds Length = 1260 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||| || |||| ||||||||| Sbjct: 1168 agaagcacttcctgtggacaatggaaggaccggcctcgtcgta 1126
>gb|U01352.1|U01352 Aplysia californica actin mRNA, complete cds Length = 1596 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||| ||||||| ||| ||||| Sbjct: 1197 agaagcacttcctgtggacaatggatgggccggactcatcgta 1155
>dbj|D87406.1| Branchiostoma floridae mRNA for cytoplasmic actin, complete cds Length = 1809 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||| |||||||||||| ||||||| ||||||||| Sbjct: 1150 agaagcacttgcggtggacgatggatgggccggactcgtcgta 1108
>ref|NM_114519.2| Arabidopsis thaliana ACT12 (ACTIN-12); structural constituent of cytoskeleton AT3G46520 (ACT12) mRNA, complete cds Length = 1453 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgg 326 ||||||||||||| |||||||||| ||||| Sbjct: 1224 tcagaagcacttcctgtggacgatcgacgg 1195
>gb|AF182035.1| Homo sapiens skeletal muscle alpha-actin gene (ACTA1), complete cds Length = 3783 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 3280 gtggacgatggaagggccggcctcgtcgta 3251
>gb|BC012597.1| Homo sapiens actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:13546 IMAGE:4291656), complete cds Length = 1694 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1226 gtggacgatggaagggccggcctcgtcgta 1197
>gb|DQ468385.1| Rhinolophus ferrumequinum beta-actin mRNA, partial cds Length = 521 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 507 gtggacgatggaggggccggactcgtcgta 478
>gb|AY550069.1| Sus scrofa cytoskeletal beta actin mRNA, partial cds Length = 1862 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1200 gtggacgatggaggggccggactcgtcgta 1171
>gb|DQ279785.1| Carollia perspicillata beta-actin-like mRNA, partial sequence Length = 598 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 593 gtggacgatggaggggccggactcgtcgta 564
>ref|XM_534781.2| PREDICTED: Canis familiaris similar to Actin, aortic smooth muscle (Alpha-actin 2) (LOC477587), mRNA Length = 1293 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Minus Query: 316 acgatggacgggccggtctcgtcgta 341 |||||||||||||||| ||||||||| Sbjct: 1135 acgatggacgggccggcctcgtcgta 1110
>emb|CR735070.2|CNS0GTYL Tetraodon nigroviridis full-length cDNA Length = 1850 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1208 gtggacgatggaggggccggactcgtcgta 1179
>emb|CR733489.2|CNS0GSQO Tetraodon nigroviridis full-length cDNA Length = 1810 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1172 gtggacgatggaggggccggactcgtcgta 1143
>emb|CR732341.1|CNS0GS0Q Tetraodon nigroviridis full-length cDNA Length = 1464 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 836 gtggacgatggaggggccggactcgtcgta 807
>emb|CR729549.2|CNS0GPV7 Tetraodon nigroviridis full-length cDNA Length = 1497 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 854 gtggacgatggaggggccggactcgtcgta 825
>emb|CR728636.2|CNS0GP5U Tetraodon nigroviridis full-length cDNA Length = 1842 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1207 gtggacgatggaggggccggactcgtcgta 1178
>emb|CR727369.2|CNS0GO6N Tetraodon nigroviridis full-length cDNA Length = 1856 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1210 gtggacgatggaggggccggactcgtcgta 1181
>emb|CR723781.2|CNS0GLEZ Tetraodon nigroviridis full-length cDNA Length = 1859 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1217 gtggacgatggaggggccggactcgtcgta 1188
>ref|XM_856706.1| PREDICTED: Canis familiaris beta-actin, transcript variant 7 (ACTB), mRNA Length = 1102 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 188 gtggacgatggaggggccggactcgtcgta 159
>ref|XM_536888.2| PREDICTED: Canis familiaris beta-actin, transcript variant 1 (ACTB), mRNA Length = 2131 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1217 gtggacgatggaggggccggactcgtcgta 1188
>ref|XM_856647.1| PREDICTED: Canis familiaris beta-actin, transcript variant 6 (ACTB), mRNA Length = 1681 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 767 gtggacgatggaggggccggactcgtcgta 738
>emb|CR718527.2|CNS0GHD1 Tetraodon nigroviridis full-length cDNA Length = 1658 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1019 gtggacgatggaggggccggactcgtcgta 990
>ref|XM_845524.1| PREDICTED: Canis familiaris beta-actin, transcript variant 2 (ACTB), mRNA Length = 2173 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1259 gtggacgatggaggggccggactcgtcgta 1230
>ref|XM_856763.1| PREDICTED: Canis familiaris beta-actin, transcript variant 9 (ACTB), mRNA Length = 2176 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1262 gtggacgatggaggggccggactcgtcgta 1233
>ref|XM_856620.1| PREDICTED: Canis familiaris beta-actin, transcript variant 5 (ACTB), mRNA Length = 2172 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1258 gtggacgatggaggggccggactcgtcgta 1229
>emb|CR704121.2|CNS0G691 Tetraodon nigroviridis full-length cDNA Length = 1778 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1199 gtggacgatggaggggccggactcgtcgta 1170
>emb|CR703997.1|CNS0G65L Tetraodon nigroviridis full-length cDNA Length = 1823 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1200 gtggacgatggaggggccggactcgtcgta 1171
>emb|CR703834.2|CNS0G612 Tetraodon nigroviridis full-length cDNA Length = 1819 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1195 gtggacgatggaggggccggactcgtcgta 1166
>emb|CR703547.2|CNS0G5T3 Tetraodon nigroviridis full-length cDNA Length = 1849 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1209 gtggacgatggaggggccggactcgtcgta 1180
>emb|CR702701.2|CNS0G55L Tetraodon nigroviridis full-length cDNA Length = 905 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 267 gtggacgatggaggggccggactcgtcgta 238
>emb|CR702033.2|CNS0G4N1 Tetraodon nigroviridis full-length cDNA Length = 1804 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1185 gtggacgatggaggggccggactcgtcgta 1156
>emb|CR699919.2|CNS0G30B Tetraodon nigroviridis full-length cDNA Length = 1832 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1183 gtggacgatggaggggccggactcgtcgta 1154
>emb|CR700349.1|CNS0G3C9 Tetraodon nigroviridis full-length cDNA Length = 1360 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 744 gtggacgatggaggggccggactcgtcgta 715
>emb|CR691261.2|CNS0FWBT Tetraodon nigroviridis full-length cDNA Length = 972 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 341 gtggacgatggaggggccggactcgtcgta 312
>emb|CR691235.2|CNS0FWB3 Tetraodon nigroviridis full-length cDNA Length = 1819 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1197 gtggacgatggaggggccggactcgtcgta 1168
>emb|CR699132.2|CNS0G2EG Tetraodon nigroviridis full-length cDNA Length = 1311 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 682 gtggacgatggaggggccggactcgtcgta 653
>emb|CR698491.1|CNS0G1WN Tetraodon nigroviridis full-length cDNA Length = 1803 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1187 gtggacgatggaggggccggactcgtcgta 1158
>emb|CR698235.2|CNS0G1PJ Tetraodon nigroviridis full-length cDNA Length = 1042 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 398 gtggacgatggaggggccggactcgtcgta 369
>emb|CR698281.1|CNS0G1QT Tetraodon nigroviridis full-length cDNA Length = 1783 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1173 gtggacgatggaggggccggactcgtcgta 1144
>emb|CR697503.2|CNS0G157 Tetraodon nigroviridis full-length cDNA Length = 1386 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 743 gtggacgatggaggggccggactcgtcgta 714
>emb|CR696054.2|CNS0G00Y Tetraodon nigroviridis full-length cDNA Length = 1380 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 743 gtggacgatggaggggccggactcgtcgta 714
>emb|CR695870.2|CNS0FZVU Tetraodon nigroviridis full-length cDNA Length = 1831 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1204 gtggacgatggaggggccggactcgtcgta 1175
>emb|CR692132.2|CNS0FX00 Tetraodon nigroviridis full-length cDNA Length = 908 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 272 gtggacgatggaggggccggactcgtcgta 243
>emb|CR692262.1|CNS0FX3M Tetraodon nigroviridis full-length cDNA Length = 1799 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1188 gtggacgatggaggggccggactcgtcgta 1159
>emb|CR695267.2|CNS0FZF3 Tetraodon nigroviridis full-length cDNA Length = 1774 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1152 gtggacgatggaggggccggactcgtcgta 1123
>emb|CR694694.2|CNS0FYZ6 Tetraodon nigroviridis full-length cDNA Length = 1642 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1037 gtggacgatggaggggccggactcgtcgta 1008
>ref|XM_843847.1| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 2 (LOC488984), mRNA Length = 1385 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1111 gtggacgatggaggggccggcctcgtcgta 1082
>ref|XM_852388.1| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 5 (LOC488984), mRNA Length = 799 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 525 gtggacgatggaggggccggcctcgtcgta 496
>ref|XM_546102.2| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 1 (LOC488984), mRNA Length = 603 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 329 gtggacgatggaggggccggcctcgtcgta 300
>ref|XM_852310.1| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 4 (LOC488984), mRNA Length = 1137 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 863 gtggacgatggaggggccggcctcgtcgta 834
>emb|CR689700.1|CNS0FV4G Tetraodon nigroviridis full-length cDNA Length = 1044 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 421 gtggacgatggaggggccggactcgtcgta 392
>emb|CR687019.2|CNS0FT1Z Tetraodon nigroviridis full-length cDNA Length = 770 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 132 gtggacgatggaggggccggactcgtcgta 103
>emb|CR686737.2|CNS0FSU5 Tetraodon nigroviridis full-length cDNA Length = 1848 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1210 gtggacgatggaggggccggactcgtcgta 1181
>emb|CR686734.2|CNS0FSU2 Tetraodon nigroviridis full-length cDNA Length = 921 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 277 gtggacgatggaggggccggactcgtcgta 248
>ref|XM_536230.2| PREDICTED: Canis familiaris similar to cytoplasmic beta-actin (LOC610787), mRNA Length = 1854 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1155 gtggacgatggaggggccggactcgtcgta 1126
>emb|CR684749.2|CNS0FRAX Tetraodon nigroviridis full-length cDNA Length = 1853 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1209 gtggacgatggaggggccggactcgtcgta 1180
>emb|CR684567.2|CNS0FR5V Tetraodon nigroviridis full-length cDNA Length = 1817 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1197 gtggacgatggaggggccggactcgtcgta 1168
>emb|CR684380.2|CNS0FR0O Tetraodon nigroviridis full-length cDNA Length = 1849 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1204 gtggacgatggaggggccggactcgtcgta 1175
>emb|CR684251.2|CNS0FQX3 Tetraodon nigroviridis full-length cDNA Length = 1827 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1201 gtggacgatggaggggccggactcgtcgta 1172
>emb|CR683413.2|CNS0FQ9T Tetraodon nigroviridis full-length cDNA Length = 1825 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1189 gtggacgatggaggggccggactcgtcgta 1160
>emb|CR684365.1|CNS0FR09 Tetraodon nigroviridis full-length cDNA Length = 1771 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1170 gtggacgatggaggggccggactcgtcgta 1141
>emb|CR683315.2|CNS0FQ73 Tetraodon nigroviridis full-length cDNA Length = 1829 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1208 gtggacgatggaggggccggactcgtcgta 1179
>emb|CR682991.1|CNS0FPY3 Tetraodon nigroviridis full-length cDNA Length = 1164 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 546 gtggacgatggaggggccggactcgtcgta 517
>emb|CR682803.2|CNS0FPSV Tetraodon nigroviridis full-length cDNA Length = 980 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 342 gtggacgatggaggggccggactcgtcgta 313
>emb|CR682722.2|CNS0FPQM Tetraodon nigroviridis full-length cDNA Length = 1763 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1167 gtggacgatggaggggccggactcgtcgta 1138
>emb|CR681460.2|CNS0FORK Tetraodon nigroviridis full-length cDNA Length = 1839 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1206 gtggacgatggaggggccggactcgtcgta 1177
>emb|CR679285.2|CNS0FN35 Tetraodon nigroviridis full-length cDNA Length = 1677 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1042 gtggacgatggaggggccggactcgtcgta 1013
>emb|CR664478.2|CNS0FBOK Tetraodon nigroviridis full-length cDNA Length = 1347 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 724 gtggacgatggaggggccggactcgtcgta 695
>emb|CR661066.2|CNS0F91S Tetraodon nigroviridis full-length cDNA Length = 1822 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1192 gtggacgatggaggggccggactcgtcgta 1163
>emb|CR655557.1|CNS0F4SR Tetraodon nigroviridis full-length cDNA Length = 1789 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1159 gtggacgatggaggggccggactcgtcgta 1130
>emb|CR654962.2|CNS0F4C8 Tetraodon nigroviridis full-length cDNA Length = 1575 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 939 gtggacgatggaggggccggactcgtcgta 910
>ref|NM_174225.1| Bos taurus actin, alpha 1, skeletal muscle (ACTA1), mRNA Length = 1485 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1224 gtggacgatggaggggccggcctcgtcgta 1195
>emb|CR648880.2|CNS0EZNA Tetraodon nigroviridis full-length cDNA Length = 1762 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1132 gtggacgatggaggggccggactcgtcgta 1103
>emb|CR642170.2|CNS0EUGW Tetraodon nigroviridis full-length cDNA Length = 1776 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1145 gtggacgatggaggggccggactcgtcgta 1116
>emb|CR640811.2|CNS0ETF5 Tetraodon nigroviridis full-length cDNA Length = 1813 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1194 gtggacgatggaggggccggactcgtcgta 1165
>emb|CR635905.1|CNS0EPMV Tetraodon nigroviridis full-length cDNA Length = 1814 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1189 gtggacgatggaggggccggactcgtcgta 1160
>emb|CR634803.2|CNS0EOS9 Tetraodon nigroviridis full-length cDNA Length = 1831 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1195 gtggacgatggaggggccggactcgtcgta 1166
>ref|NM_001100.3| Homo sapiens actin, alpha 1, skeletal muscle (ACTA1), mRNA Length = 1509 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1224 gtggacgatggaagggccggcctcgtcgta 1195
>emb|AL160004.18| Human DNA sequence from clone RP5-1068B5 on chromosome 1q42.11-43 Contains a pseudogene similar to part of ribosomal protein L21 (RPL21), the ACTA1 gene for actin, alpha 1, skeletal muscle, the 3' end of the NUP133 gene for nucleoporin 133kDa and two CpG islands, complete sequence Length = 86173 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Plus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 52771 gtggacgatggaagggccggcctcgtcgta 52800
>gb|AY280960.1| Homo sapiens actin alpha 1 skeletal muscle protein (ACTA1) mRNA, complete cds; alternatively spliced Length = 765 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 750 gtggacgatggaagggccggcctcgtcgta 721
>emb|CR859327.1| Pongo pygmaeus mRNA; cDNA DKFZp468G072 (from clone DKFZp468G072) Length = 1543 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1223 gtggacgatggaagggccggcctcgtcgta 1194
>dbj|AK096902.1| Homo sapiens cDNA FLJ39583 fis, clone SKMUS2004897, highly similar to ACTIN, ALPHA SKELETAL MUSCLE Length = 1381 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1117 gtggacgatggaagggccggcctcgtcgta 1088
>emb|CR541796.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0631D for gene ACTA1, actin, alpha 1, skeletal muscle; complete cds, without stopcodon Length = 1131 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1119 gtggacgatggaagggccggcctcgtcgta 1090
>emb|CR536516.1| Homo sapiens full open reading frame cDNA clone RZPDo834D1020D for gene ACTA1, actin, alpha 1, skeletal muscle; complete cds, incl. stopcodon Length = 1134 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1119 gtggacgatggaagggccggcctcgtcgta 1090
>gb|S64188.1| type 1 actin {type 1} [Emiliania huxleyi=Prymnesiophyte algae, CCMP379, mRNA Partial, 1095 nt] Length = 1095 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||||||||| | ||||||||| Sbjct: 1083 gtggacgatggacgggcccgactcgtcgta 1054
>gb|S57815.1| alpha-actin {STS, sequence tagged site} [human, Genomic, 188 nt] Length = 188 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 45 gtggacgatggaagggccggcctcgtcgta 16
>gb|BC102376.1| Bos taurus actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:127298 IMAGE:7951610), complete cds Length = 1528 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1253 gtggacgatggaggggccggcctcgtcgta 1224
>gb|AF112538.1|AF112538 Malva pusilla actin (Act1) mRNA, complete cds Length = 1647 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||| ||||||| ||||| || || | |||||| || |||||||||| Sbjct: 1228 agaagcacttcctgtggacaatggatggaccagactcgtcatactcgcccttgg 1175
>gb|BT005073.1| Arabidopsis thaliana clone U20828 putative actin 12 (At3g46520) mRNA, complete cds Length = 1165 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgg 326 ||||||||||||| |||||||||| ||||| Sbjct: 1134 tcagaagcacttcctgtggacgatcgacgg 1105
>ref|NM_001009784.1| Ovis aries beta actin (LOC443352), mRNA Length = 2191 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1199 gtggacgatggaggggccggactcgtcgta 1170
>gb|BT003847.1| Arabidopsis thaliana clone RAFL15-27-C22 (R20828) putative actin 12 (At3g46520) mRNA, complete cds Length = 1476 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgg 326 ||||||||||||| |||||||||| ||||| Sbjct: 1224 tcagaagcacttcctgtggacgatcgacgg 1195
>gb|AF035774.1|AF035774 Equus caballus beta actin mRNA, complete cds Length = 1128 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1113 gtggacgatggaggggccggactcgtcgta 1084
>emb|BX648545.1|HSM808693 Homo sapiens mRNA; cDNA DKFZp779F0855 (from clone DKFZp779F0855) Length = 1240 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 953 gtggacgatggaagggccggcctcgtcgta 924
>gb|AY893990.1| Synthetic construct Homo sapiens clone FLH130947.01L actin alpha 1 (ACTA1) mRNA, partial cds Length = 1134 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1119 gtggacgatggaagggccggcctcgtcgta 1090
>gb|AY305737.1| Gossypium hirsutum actin (ACT9) mRNA, complete cds Length = 1629 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||| ||||||| ||||| || |||| ||| || || |||||||||| Sbjct: 1160 agaagcacttcctgtggacaatggatggaccggactcatcatactcgcccttgg 1107
>gb|AY305736.1| Gossypium hirsutum actin (ACT15) mRNA, complete cds Length = 1605 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||| ||||||| ||||| || |||| ||| || || |||||||||| Sbjct: 1147 agaagcacttcctgtggacaatggatggaccggactcatcatactcgcccttgg 1094
>gb|AY305730.1| Gossypium hirsutum actin (ACT8) mRNA, complete cds Length = 1589 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||| ||||||| ||||| || |||| ||| || || |||||||||| Sbjct: 1164 agaagcacttcctgtggacaatggatggaccggactcatcatactcgcccttgg 1111
>gb|AY305729.1| Gossypium hirsutum actin (ACT7) mRNA, complete cds Length = 1583 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 ||||||||||| ||||||| ||||| || |||| ||| || || |||||||||| Sbjct: 1159 agaagcacttcctgtggacaatggatggaccggactcatcatactcgcccttgg 1106
>gb|U37499.1|TRU37499 Takifugu rubripes beta actin1 gene, complete cds Length = 4780 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 4073 gtggacgatggaggggccggactcgtcgta 4044
>emb|AL133314.1|ATF12A12 Arabidopsis thaliana DNA chromosome 3, BAC clone F12A12 Length = 100815 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgg 326 ||||||||||||| |||||||||| ||||| Sbjct: 29083 tcagaagcacttcctgtggacgatcgacgg 29054
>gb|U82661.1|HECYTACT2 Heliocidaris erythrogramma cytoplasmic actin CyII (HeCyII) gene, exon 4 and partial cds Length = 693 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggc 328 ||||||||||| ||||||||||||| |||| Sbjct: 632 agaagcacttcctgtggacgatggatgggc 603
>gb|U39357.1|OAU39357 Ovis aries beta actin mRNA, complete cds Length = 2191 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1199 gtggacgatggaggggccggactcgtcgta 1170
>gb|J00068.1|HUMACTASK Human adult skeletal muscle alpha-actin mRNA Length = 1374 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 1222 gtggacgatggaagggccggcctcgtcgta 1193
>gb|U27982.1|ATU27982 Arabidopsis thaliana actin-12 (ACT12) gene, complete cds Length = 3284 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgg 326 ||||||||||||| |||||||||| ||||| Sbjct: 2728 tcagaagcacttcctgtggacgatcgacgg 2699
>gb|U02285.1|BTU02285 Bos taurus alpha skeletal actin precursor gene, complete cds Length = 6396 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 5270 gtggacgatggaggggccggcctcgtcgta 5241
>gb|M20543.1|HUMSAACT Human skeletal alpha-actin gene, complete cds Length = 3778 Score = 44.1 bits (22), Expect = 0.56 Identities = 28/30 (93%) Strand = Plus / Minus Query: 312 gtggacgatggacgggccggtctcgtcgta 341 |||||||||||| ||||||| ||||||||| Sbjct: 3274 gtggacgatggaagggccggcctcgtcgta 3245
>gb|AY432900.1| Aedes aegypti ASAP ID: 38631 actin mRNA sequence Length = 2065 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccgg 331 ||||||||||| ||||||| ||||| ||||||| Sbjct: 1288 agaagcacttcctgtggacaatggatgggccgg 1256
>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete sequence Length = 2105742 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 357 gtgctggttctgggggaagaccaccttgg 385 |||||||| ||||||||||||||| |||| Sbjct: 335461 gtgctggtgctgggggaagaccactttgg 335489
>gb|BC019212.1| Mus musculus serum amyloid A 4, mRNA (cDNA clone MGC:29122 IMAGE:5053373), complete cds Length = 2103 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 202 acaccacaccacaccagtgcc 222 ||||||||||||||||||||| Sbjct: 1544 acaccacaccacaccagtgcc 1564
>ref|NM_011316.2| Mus musculus serum amyloid A 4 (Saa4), mRNA Length = 2103 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 202 acaccacaccacaccagtgcc 222 ||||||||||||||||||||| Sbjct: 1544 acaccacaccacaccagtgcc 1564
>emb|CR639774.2|CNS0ESMC Tetraodon nigroviridis full-length cDNA Length = 1812 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 313 tggacgatggacgggccggtctcgtcgta 341 ||||||||||| ||||||| ||||||||| Sbjct: 1184 tggacgatggaggggccggactcgtcgta 1156
>gb|AC090122.26| Mus musculus strain C57BL/6J clone rp23-28a7 map 7, complete sequence Length = 212485 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 202 acaccacaccacaccagtgcc 222 ||||||||||||||||||||| Sbjct: 70282 acaccacaccacaccagtgcc 70302
>gb|AF368030.1|AF368030 Heliothis virescens actin mRNA, complete cds Length = 1399 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggcc 329 ||||||||||||| |||||||||| || ||||| Sbjct: 1128 tcagaagcacttcctgtggacgatagaggggcc 1096
>ref|NM_214527.1| Strongylocentrotus purpuratus cytoskeletal actin CyIIIb (CyIIIb), mRNA Length = 1131 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatgga 323 ||||||||||| ||||||||||||| Sbjct: 1129 agaagcacttcctgtggacgatgga 1105
>gb|U63126.1|TVU63126 Trichomonas vaginalis clone Type3 actin mRNA, partial cds Length = 1103 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 |||||||||| |||||||||||| ||||| | ||||||||| || ||||||||| Sbjct: 1101 agaagcacttgcggtggacgatggatgggccagcctcgtcgtattcctccttggtga 1045
>gb|U63125.1|TVU63125 Trichomonas vaginalis clone Type4 actin mRNA, partial cds Length = 1102 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 |||||||||| |||||||||||| ||||| | ||||||||| || ||||||||| Sbjct: 1100 agaagcacttgcggtggacgatggatgggccagcctcgtcgtattcctccttggtga 1044
>gb|U63123.1|TVU63123 Trichomonas vaginalis clone Type5 actin mRNA, partial cds Length = 1102 Score = 42.1 bits (21), Expect = 2.2 Identities = 48/57 (84%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 355 |||||||||| |||||||||||| ||||| | ||||||||| || ||||||||| Sbjct: 1100 agaagcacttgcggtggacgatggatgggccagcctcgtcgtattcctccttggtga 1044
>gb|AF318603.2| Heterodera glycines actin 1 mRNA, complete cds Length = 1367 Score = 42.1 bits (21), Expect = 2.2 Identities = 39/45 (86%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||||| |||||| ||||||||||| | ||||||||| Sbjct: 1213 tcagaagcacttgcggtggacaatggacgggcccgactcgtcgta 1169
>gb|AY161282.1| Heterodera glycines actin 1 gene, complete cds Length = 2286 Score = 42.1 bits (21), Expect = 2.2 Identities = 39/45 (86%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 |||||||||||| |||||| ||||||||||| | ||||||||| Sbjct: 2126 tcagaagcacttgcggtggacaatggacgggcccgactcgtcgta 2082
>gb|U38958.1|FRU38958 Fugu rubripes alpha actin (alpha-skeletal actin2) gene, complete cds Length = 3580 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatgga 323 ||||||||||| ||||||||||||| Sbjct: 3146 agaagcacttcctgtggacgatgga 3122
>gb|U40397.1|MMU40397 Mus musculus serum amyloid A-4 protein (Saa4) gene, complete cds Length = 5705 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 202 acaccacaccacaccagtgcc 222 ||||||||||||||||||||| Sbjct: 4782 acaccacaccacaccagtgcc 4802
>gb|U12271.1|HECYI3 Heliocidaris erythrogramma CyI cytoplasmic actin (HeCyI) gene, exon 4 and complete cds Length = 1255 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatgga 323 ||||||||||| ||||||||||||| Sbjct: 516 agaagcacttcctgtggacgatgga 492
>gb|AY145451.1| Hordeum vulgare actin mRNA, complete cds Length = 1421 Score = 42.1 bits (21), Expect = 2.2 Identities = 39/45 (86%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgta 341 ||||||||||||| |||||||||| | ||||| | ||||||||| Sbjct: 1153 tcagaagcacttcctgtggacgatcgctgggccagactcgtcgta 1109
>gb|M35324.1|SUSCYIIIBA S.purpuratus cytoskeletal actin CyIIIb gene, complete cds Length = 2918 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatgga 323 ||||||||||| ||||||||||||| Sbjct: 2762 agaagcacttcctgtggacgatgga 2738
>gb|AC166747.4| Mus musculus chromosome 5, clone RP23-316L10, complete sequence Length = 189572 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 599 tagtaattagctggtggaca 618 |||||||||||||||||||| Sbjct: 46663 tagtaattagctggtggaca 46682
>gb|AC120543.7| Mus musculus chromosome 8, clone RP23-330A24, complete sequence Length = 210696 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 481 gacagatttgcttctctctg 500 |||||||||||||||||||| Sbjct: 195361 gacagatttgcttctctctg 195342
>gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 section 10 of 16 of the complete genome Length = 290294 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 agtaaaaaatagacgccaat 68 |||||||||||||||||||| Sbjct: 65348 agtaaaaaatagacgccaat 65367
>ref|XM_585878.2| PREDICTED: Bos taurus similar to T-cell surface glycoprotein CD1b precursor (CD1b antigen) (LOC509004), mRNA Length = 1279 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 491 cttctctctgaaacctgtcctcga 514 |||||||| ||||||||||||||| Sbjct: 535 cttctctcagaaacctgtcctcga 558
>gb|AE009952.1| Yersinia pestis KIM, complete genome Length = 4600755 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 agtaaaaaatagacgccaat 68 |||||||||||||||||||| Sbjct: 1754562 agtaaaaaatagacgccaat 1754543
>gb|DQ465450.1| Arabidopsis thaliana ecotype Zu_0 truncated disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 4077 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 4050 tcagaagcacttcctgtggacgat 4073
>gb|DQ465449.1| Arabidopsis thaliana ecotype Ws_0 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3838 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3811 tcagaagcacttcctgtggacgat 3834
>gb|DQ465448.1| Arabidopsis thaliana ecotype Tamm_46 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3887 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3860 tcagaagcacttcctgtggacgat 3883
>gb|DQ465447.1| Arabidopsis thaliana ecotype Sq_1 truncated disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3853 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3826 tcagaagcacttcctgtggacgat 3849
>gb|DQ465445.1| Arabidopsis thaliana ecotype Pog_0 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3837 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3810 tcagaagcacttcctgtggacgat 3833
>gb|DQ465444.1| Arabidopsis thaliana ecotype Nfe_17 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3950 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3923 tcagaagcacttcctgtggacgat 3946
>gb|DQ465443.1| Arabidopsis thaliana ecotype Mt_0 truncated disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3879 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3852 tcagaagcacttcctgtggacgat 3875
>gb|DQ465442.1| Arabidopsis thaliana ecotype Lov_2 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 4097 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 4070 tcagaagcacttcctgtggacgat 4093
>gb|DQ465441.1| Arabidopsis thaliana ecotype Ler_0 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3891 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3864 tcagaagcacttcctgtggacgat 3887
>gb|DQ465440.1| Arabidopsis thaliana ecotype Kas_1 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3839 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3812 tcagaagcacttcctgtggacgat 3835
>gb|DQ465439.1| Arabidopsis thaliana ecotype Ef_1 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3985 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3958 tcagaagcacttcctgtggacgat 3981
>gb|DQ465438.1| Arabidopsis thaliana ecotype Ang_0 disease resistance protein RPP13 variant (RPP13) gene, complete cds Length = 3884 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 297 tcagaagcacttcttgtggacgat 320 ||||||||||||| |||||||||| Sbjct: 3857 tcagaagcacttcctgtggacgat 3880
>emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, complete sequence Length = 195301 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 483 cagatttgcttctctctgaa 502 |||||||||||||||||||| Sbjct: 110941 cagatttgcttctctctgaa 110922
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 524 tagatgcagtgccaccacat 543 |||||||||||||||||||| Sbjct: 591981 tagatgcagtgccaccacat 592000
>emb|Z68317.1|CET01H3 Caenorhabditis elegans Cosmid T01H3, complete sequence Length = 21870 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 tagctaggtaagctaggtag 116 |||||||||||||||||||| Sbjct: 13460 tagctaggtaagctaggtag 13479 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 tagctaggtaagctaggtag 116 |||||||||||||||||||| Sbjct: 13043 tagctaggtaagctaggtag 13062
>gb|AC101788.5| Mus musculus chromosome 15, clone RP24-148C8, complete sequence Length = 190073 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 tagtaaaaaatagacgccaa 67 |||||||||||||||||||| Sbjct: 103754 tagtaaaaaatagacgccaa 103735
>gb|DQ192542.1| Bos taurus CD1b3 (CD1B3) mRNA, complete cds Length = 1002 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 491 cttctctctgaaacctgtcctcga 514 |||||||| ||||||||||||||| Sbjct: 535 cttctctcagaaacctgtcctcga 558
>gb|DQ066926.1| Fundulus heteroclitus ribosomal protein L8 mRNA, partial cds Length = 409 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 371 ggaagaccaccttggccagg 390 |||||||||||||||||||| Sbjct: 44 ggaagaccaccttggccagg 25
>emb|AL139042.15| Human DNA sequence from clone RP11-459O1 on chromosome 6 Contains an actin beta (ACTB) pseudogene and part of a novel gene, complete sequence Length = 107745 Score = 40.1 bits (20), Expect = 8.7 Identities = 35/40 (87%) Strand = Plus / Plus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtc 338 ||||||| || | |||||||||||| ||||||| |||||| Sbjct: 2606 agaagcatttgtggtggacgatggaggggccggactcgtc 2645
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 agtaaaaaatagacgccaat 68 |||||||||||||||||||| Sbjct: 3108233 agtaaaaaatagacgccaat 3108252
>emb|AJ581663.1|HGA581663 Homarus gammarus mRNA for beta actin (act gene) Length = 1264 Score = 40.1 bits (20), Expect = 8.7 Identities = 35/40 (87%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtc 338 ||||||||||| ||||||| ||||| ||||| | |||||| Sbjct: 1129 agaagcacttcctgtggacaatggatgggcccgactcgtc 1090
>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20 Length = 258050 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 agtaaaaaatagacgccaat 68 |||||||||||||||||||| Sbjct: 173022 agtaaaaaatagacgccaat 173003
>gb|AC097359.2| Homo sapiens chromosome 3 clone RP11-259K5, complete sequence Length = 187127 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tgggctagctcctagctagc 37 |||||||||||||||||||| Sbjct: 32549 tgggctagctcctagctagc 32568
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 373 aagaccaccttggccaggat 392 |||||||||||||||||||| Sbjct: 3221275 aagaccaccttggccaggat 3221256
>gb|AE005979.1| Caulobacter crescentus CB15 section 305 of 359 of the complete genome Length = 11597 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 ccttggccaggatcgcgccg 399 |||||||||||||||||||| Sbjct: 7893 ccttggccaggatcgcgccg 7874
>gb|AE012268.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 176 of 460 of the complete genome Length = 11409 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 380 ccttggccaggatcgcgccg 399 |||||||||||||||||||| Sbjct: 10015 ccttggccaggatcgcgccg 9996
>gb|AF421536.1| Crypthecodinium cohnii actin mRNA, complete cds Length = 1465 Score = 40.1 bits (20), Expect = 8.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 297 tcagaagcacttcttgtggacgatggacgggccggtctcgtcgtagtcgcccttgg 352 |||||||||||| ||| ||||||| ||||| | ||||||||| |||||||||| Sbjct: 1185 tcagaagcacttgcggtgcacgatggtggggccagactcgtcgtactcgcccttgg 1130
>gb|AC096506.5| Homo sapiens Xp BAC RP11-64I1 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 120135 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 483 cagatttgcttctctctgaa 502 |||||||||||||||||||| Sbjct: 6396 cagatttgcttctctctgaa 6415
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 380 ccttggccaggatcgcgccg 399 |||||||||||||||||||| Sbjct: 3091837 ccttggccaggatcgcgccg 3091856
>ref|NG_000840.1| Homo sapiens actin, beta pseudogene 8 (ACTBP8) on chromosome 6 Length = 1861 Score = 40.1 bits (20), Expect = 8.7 Identities = 35/40 (87%) Strand = Plus / Minus Query: 299 agaagcacttcttgtggacgatggacgggccggtctcgtc 338 ||||||| || | |||||||||||| ||||||| |||||| Sbjct: 1637 agaagcatttgtggtggacgatggaggggccggactcgtc 1598
>gb|AC020732.4|AC020732 Homo sapiens BAC clone RP11-556H16 from X, complete sequence Length = 181559 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 483 cagatttgcttctctctgaa 502 |||||||||||||||||||| Sbjct: 4396 cagatttgcttctctctgaa 4415
>gb|AC123679.16| Mus musculus chromosome 5, clone RP23-280N22, complete sequence Length = 152336 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 599 tagtaattagctggtggaca 618 |||||||||||||||||||| Sbjct: 118567 tagtaattagctggtggaca 118548 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 599 tagtaattagctggtggaca 618 |||||||||||||||||||| Sbjct: 45363 tagtaattagctggtggaca 45344
>gb|AF043695.2| Caenorhabditis elegans cosmid C42C1, complete sequence Length = 44686 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 481 gacagatttgcttctctctgaaac 504 ||||||||| |||||||||||||| Sbjct: 12326 gacagattttcttctctctgaaac 12349
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 214 accagtgccagtgccgccgg 233 |||||||||||||||||||| Sbjct: 2642230 accagtgccagtgccgccgg 2642249 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 342 gtcgcccttggtgacgtgctggtt 365 |||||||||| ||||||||||||| Sbjct: 2239410 gtcgcccttgctgacgtgctggtt 2239433
>dbj|AP006190.1| Homo sapiens genomic DNA, chromosome 3, clone:RP11-145L6, complete sequence Length = 176082 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 tgggctagctcctagctagc 37 |||||||||||||||||||| Sbjct: 1981 tgggctagctcctagctagc 2000
>emb|AL670544.7| Mouse DNA sequence from clone RP23-16G8 on chromosome X, complete sequence Length = 236946 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 487 tttgcttctctctgaaacct 506 |||||||||||||||||||| Sbjct: 168241 tttgcttctctctgaaacct 168222 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,991,263 Number of Sequences: 3902068 Number of extensions: 3991263 Number of successful extensions: 81449 Number of sequences better than 10.0: 251 Number of HSP's better than 10.0 without gapping: 251 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80871 Number of HSP's gapped (non-prelim): 575 length of query: 640 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 617 effective length of database: 17,143,297,704 effective search space: 10577414683368 effective search space used: 10577414683368 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)