>dbj|AB164680.1| Hordeum vulgare HVD1 mRNA for ATP-dependent RNA helicase, complete
            cds
          Length = 2799

 Score =  236 bits (119), Expect = 2e-59
 Identities = 132/137 (96%)
 Strand = Plus / Minus

                                                                        
Query: 62   ttaaaacaagcaacgttcctgtaaaacccctggttattacacgaataattcagcggaagg 121
            ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||
Sbjct: 2657 ttaaaacaagcaacgttcctgtaaaacccctagatattacacgaataattcagcggaagg 2598

                                                                        
Query: 122  ccaggctctccttcggcgtgtnagcagcgtgccagaaaaatcatcttctntgtgaaacga 181
            ||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||
Sbjct: 2597 ccaggctctccttcggcgtgtcagcagcgtgccagaaaaatcatctcctctgtgaaacga 2538

                             
Query: 182  cgaccacacaaaactgt 198
            |||||||||||||||||
Sbjct: 2537 cgaccacacaaaactgt 2521

>ref|XM_521217.1| PREDICTED: Pan troglodytes similar to alpha 5 type IV collagen
            isoform 2, precursor; collagen IV, alpha-5 polypeptide;
            collagen of basement membrane, alpha-5 chain (LOC465805),
            mRNA
          Length = 4263

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 2147 ggaaggccaggctctcctt 2129

>ref|NM_001002979.1| Canis familiaris collagen, type IV, alpha 5 (Alport syndrome)
            (COL4A5), mRNA
          Length = 5681

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 3022 ggaaggccaggctctcctt 3004

>gb|BC035387.1| Homo sapiens collagen, type IV, alpha 5 (Alport syndrome), mRNA (cDNA
            clone IMAGE:4820995), complete cds
          Length = 3649

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 2303 ggaaggccaggctctcctt 2285

>ref|XM_588970.2| PREDICTED: Bos taurus similar to alpha 5 type IV collagen isoform 2,
            precursor (LOC511602), partial mRNA
          Length = 5771

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 2474 ggaaggccaggctctcctt 2456

>gb|AF470624.2| Canis familiaris type IV collagen alpha 5 (COL4A5) mRNA, complete cds
          Length = 5681

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 3022 ggaaggccaggctctcctt 3004

>ref|NM_000495.3| Homo sapiens collagen, type IV, alpha 5 (Alport syndrome) (COL4A5),
            transcript variant 1, mRNA
          Length = 6427

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 3048 ggaaggccaggctctcctt 3030

>ref|NM_033381.1| Homo sapiens collagen, type IV, alpha 5 (Alport syndrome) (COL4A5),
            transcript variant 3, mRNA
          Length = 6436

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 3048 ggaaggccaggctctcctt 3030

>ref|NM_033380.1| Homo sapiens collagen, type IV, alpha 5 (Alport syndrome) (COL4A5),
            transcript variant 2, mRNA
          Length = 6445

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 3048 ggaaggccaggctctcctt 3030

>emb|AL590613.6| Human DNA sequence from clone RP11-164G6 on chromosome 6 Contains
            part of the LAMA2 gene for laminin, alpha 2 (merosin,
            congenital muscular dystrophy) (LAMM), complete sequence
          Length = 91827

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 157  aaaaatcatcttctntgtgaaa 178
            |||||||||||||| |||||||
Sbjct: 2149 aaaaatcatcttctctgtgaaa 2128

>emb|AL035425.13|HS24A23 Human DNA sequence from clone RP6-24A23 on chromosome Xq22.2-23
            Contains the 3' end of the COL4A5 gene for type IV alpha
            5 collagen (Alport syndrome), the IRS4 gene for insulin
            receptor substrate 4, a novel gene and a CpG island,
            complete sequence
          Length = 137100

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 8037 ggaaggccaggctctcctt 8019

>gb|AY078501.1| Canis familiaris type IV collagen alpha 5 chain (COL4A5) mRNA,
            partial cds
          Length = 5073

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 2866 ggaaggccaggctctcctt 2848

>gb|U04502.1|HS4COL5A29 Homo sapiens type IV collagen alpha 5 chain (COL4A5) gene, exon 33
          Length = 293

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 116 ggaaggccaggctctcctt 134
           |||||||||||||||||||
Sbjct: 141 ggaaggccaggctctcctt 123

>gb|U07888.1|CFU07888 Canis familiaris Samoyed collagen type IV A5 chain mRNA, partial
           cds
          Length = 2263

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 116 ggaaggccaggctctcctt 134
           |||||||||||||||||||
Sbjct: 74  ggaaggccaggctctcctt 56

>gb|M58526.1|HUMCOLA5IV Human alpha-5 collagen type IV (COL4A5) mRNA, 3' end
          Length = 4816

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 116  ggaaggccaggctctcctt 134
            |||||||||||||||||||
Sbjct: 2604 ggaaggccaggctctcctt 2586

>gb|M31115.1|HUMCOL4A5 Human collagen type IV alpha 5 chain mRNA, 3' end
          Length = 3517

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 116 ggaaggccaggctctcctt 134
           |||||||||||||||||||
Sbjct: 107 ggaaggccaggctctcctt 89

>gb|M63455.1|HUMA5CL01 Human alpha-5 collagen type IV gene, exon 19
          Length = 210

 Score = 38.2 bits (19), Expect = 9.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 116 ggaaggccaggctctcctt 134
           |||||||||||||||||||
Sbjct: 109 ggaaggccaggctctcctt 91


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,058,396
Number of Sequences: 3902068
Number of extensions: 1058396
Number of successful extensions: 61576
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61553
Number of HSP's gapped (non-prelim): 23
length of query: 198
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 176
effective length of database: 17,147,199,772
effective search space: 3017907159872
effective search space used: 3017907159872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)