ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4l20
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_467700.1| Oryza sativa (japonica cultivar-group), mRNA 163 9e-37
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 163 9e-37
3dbj|AP004815.3| Oryza sativa (japonica cultivar-group) genomic D... 163 9e-37
4dbj|AP005112.3| Oryza sativa (japonica cultivar-group) genomic D... 163 9e-37
5dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
6dbj|AP004725.3| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
7gb|AY106868.1| Zea mays PCO072630 mRNA sequence 98 4e-17
8gb|AY111143.1| Zea mays CL50626_1 mRNA sequence 56 1e-04
9gb|AC100149.12| Mus musculus chromosome 10, clone RP23-43F3, com... 50 0.009
10gb|AC159380.8| Mus musculus 10 BAC RP24-460M18 (Roswell Park Can... 50 0.009
11emb|AL353685.23| Human DNA sequence from clone RP11-31J20 on chr... 44 0.57
12gb|AF287262.1|AF287262 Homo sapiens ATP-binding cassette 1 sub-f... 44 0.57
13gb|AF275948.1|AF275948 Homo sapiens ABCA1 (ABCA1) gene, complete... 44 0.57
14gb|AC146896.15| Mus musculus chromosome X clone xcat-28-97f16, c... 42 2.3
15gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 42 2.3
16ref|XM_391147.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 42 2.3
17gb|AC093447.17| Mus musculus strain 129/Sv clone ct7-25g12 map X... 42 2.3
18gb|AC087376.5| Homo sapiens chromosome 11, clone RP11-230O19, co... 42 2.3
19gb|AC104978.2| Homo sapiens chromosome 11, clone RP11-244O16, co... 42 2.3
20emb|AL732391.7| Mouse DNA sequence from clone RP23-364H13 on chr... 42 2.3
21gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, co... 40 8.9
22ref|XM_522913.1| PREDICTED: Pan troglodytes similar to KIAA1737 ... 40 8.9
23gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com... 40 8.9
24gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 8.9
25gb|AC148869.1| Pan troglodytes fosmid clone CH1251-3642E8 from Y... 40 8.9
26ref|NM_033426.2| Homo sapiens KIAA1737 (KIAA1737), mRNA 40 8.9
27gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com... 40 8.9
28emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in ... 40 8.9
29gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's ... 40 8.9
30gb|AC112644.3| Homo sapiens 3 BAC RP11-10O22 (Roswell Park Cance... 40 8.9
31gb|BC037300.2| Homo sapiens KIAA1737, mRNA (cDNA clone MGC:33650... 40 8.9
32emb|AL604066.9| Mouse DNA sequence from clone RP23-174M12 on chr... 40 8.9
33emb|CR859828.1| Pongo pygmaeus mRNA; cDNA DKFZp459E237 (from clo... 40 8.9
34emb|AL834514.1|HSM805629 Homo sapiens mRNA; cDNA DKFZp762K087 (f... 40 8.9
35dbj|AK125777.1| Homo sapiens cDNA FLJ43789 fis, clone TESTI2053242 40 8.9
36dbj|AK096603.1| Homo sapiens cDNA FLJ39284 fis, clone OCBBF2011759 40 8.9
37gb|AC010677.4| Homo sapiens chromosome 7 clone CTD-2304L4, compl... 40 8.9
38ref|XM_941431.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 8.9
39ref|XM_930126.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 8.9
40gb|AC115991.4| Homo sapiens chromosome 11, clone CTC-342M10, com... 40 8.9
41gb|AC007880.2| Homo sapiens BAC clone RP11-323F11 from 2, comple... 40 8.9
42gb|AC008462.6|AC008462 Homo sapiens chromosome 5 clone CTC-352J1... 40 8.9
43gb|AC079602.15| Homo sapiens 12 BAC RP11-216P16 (Roswell Park Ca... 40 8.9
44gb|AC060812.15| Homo sapiens chromosome 11, clone RP11-120E20, c... 40 8.9
45gb|AY154351.1| Ficedula hypoleuca isolate c2 growth hormone rece... 40 8.9
46gb|AY154350.1| Ficedula hypoleuca isolate c1 growth hormone rece... 40 8.9
47gb|AY154349.1| Ficedula hypoleuca isolate p3 growth hormone rece... 40 8.9
48gb|AY154348.1| Ficedula albicollis isolate p2 growth hormone rec... 40 8.9
49gb|AY154347.1| Ficedula albicollis isolate p1 growth hormone rec... 40 8.9
50gb|AC007686.5|AC007686 Homo sapiens chromosome 14 clones CTD-228... 40 8.9
51emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in ... 40 8.9
52dbj|AP006294.1| Homo sapiens genomic DNA, chromosome 11 clone:CT... 40 8.9
53emb|AJ870019.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
54emb|AJ870018.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
55emb|AJ870017.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
56emb|AJ870016.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
57emb|AJ870015.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
58emb|AJ870014.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
59emb|AJ870013.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
60emb|AJ870012.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
61emb|AJ870011.1| Ficedula hypoleuca partial intron 5 of the ghr g... 40 8.9
62emb|AJ870010.1| Ficedula parva partial intron 5 of the ghr gene,... 40 8.9
63emb|AJ870009.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
64emb|AJ870008.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
65emb|AJ870007.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
66emb|AJ870006.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
67emb|AJ870005.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
68emb|AJ870004.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
69emb|AJ870003.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
70emb|AJ870002.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
71emb|AJ870001.1| Ficedula albicollis partial intron 5 of the ghr ... 40 8.9
72dbj|AP004486.1| Lotus japonicus genomic DNA, chromosome 5, clone... 40 8.9
73emb|AJ223837.1|MMU223837 Mus musculus Eef1a2 gene (mutated gene ... 40 8.9
74dbj|AB051524.1| Homo sapiens mRNA for KIAA1737 protein, partial cds 40 8.9 
>ref|XM_467700.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1959

 Score =  163 bits (82), Expect = 9e-37
 Identities = 149/170 (87%), Gaps = 1/170 (0%)
 Strand = Plus / Minus

                                                                        
Query: 459  ccttgacttctgtaaagccaaatccttccttctgccttcttgagtaacccgcagttctcc 518
            |||||||||  |||||| ||||||||| ||||||||||| |||| |  | || |||||| 
Sbjct: 1950 ccttgactttggtaaagtcaaatcctttcttctgccttcctgagcagtc-gctgttctcg 1892

                                                                        
Query: 519  caacagaagaaatatttggctcggctaacgggttggtgacaaatccaccctgaactccaa 578
            || |||| ||||| || ||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 1891 cagcagacgaaatgttcggctcagctaacgggttggtgacaaaaccaccctgaactccaa 1832

                                                              
Query: 579  atttctgcctttcccacttgtaagaagttctgctcccctccgagctgttt 628
            | || |||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 1831 acttttgccttccccacttgtaagaagttctgctcccctccgaactgttt 1782
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  163 bits (82), Expect = 9e-37
 Identities = 149/170 (87%), Gaps = 1/170 (0%)
 Strand = Plus / Plus

                                                                            
Query: 459      ccttgacttctgtaaagccaaatccttccttctgccttcttgagtaacccgcagttctcc 518
                |||||||||  |||||| ||||||||| ||||||||||| |||| |  | || |||||| 
Sbjct: 30949612 ccttgactttggtaaagtcaaatcctttcttctgccttcctgagcagtc-gctgttctcg 30949670

                                                                            
Query: 519      caacagaagaaatatttggctcggctaacgggttggtgacaaatccaccctgaactccaa 578
                || |||| ||||| || ||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 30949671 cagcagacgaaatgttcggctcagctaacgggttggtgacaaaaccaccctgaactccaa 30949730

                                                                  
Query: 579      atttctgcctttcccacttgtaagaagttctgctcccctccgagctgttt 628
                | || |||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 30949731 acttttgccttccccacttgtaagaagttctgctcccctccgaactgttt 30949780
to top
>dbj|AP004815.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0516G10
          Length = 148937

 Score =  163 bits (82), Expect = 9e-37
 Identities = 149/170 (87%), Gaps = 1/170 (0%)
 Strand = Plus / Plus

                                                                        
Query: 459  ccttgacttctgtaaagccaaatccttccttctgccttcttgagtaacccgcagttctcc 518
            |||||||||  |||||| ||||||||| ||||||||||| |||| |  | || |||||| 
Sbjct: 4568 ccttgactttggtaaagtcaaatcctttcttctgccttcctgagcagtc-gctgttctcg 4626

                                                                        
Query: 519  caacagaagaaatatttggctcggctaacgggttggtgacaaatccaccctgaactccaa 578
            || |||| ||||| || ||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 4627 cagcagacgaaatgttcggctcagctaacgggttggtgacaaaaccaccctgaactccaa 4686

                                                              
Query: 579  atttctgcctttcccacttgtaagaagttctgctcccctccgagctgttt 628
            | || |||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 4687 acttttgccttccccacttgtaagaagttctgctcccctccgaactgttt 4736
to top
>dbj|AP005112.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0684F11
          Length = 147731

 Score =  163 bits (82), Expect = 9e-37
 Identities = 149/170 (87%), Gaps = 1/170 (0%)
 Strand = Plus / Plus

                                                                          
Query: 459    ccttgacttctgtaaagccaaatccttccttctgccttcttgagtaacccgcagttctcc 518
              |||||||||  |||||| ||||||||| ||||||||||| |||| |  | || |||||| 
Sbjct: 133189 ccttgactttggtaaagtcaaatcctttcttctgccttcctgagcagtc-gctgttctcg 133247

                                                                          
Query: 519    caacagaagaaatatttggctcggctaacgggttggtgacaaatccaccctgaactccaa 578
              || |||| ||||| || ||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 133248 cagcagacgaaatgttcggctcagctaacgggttggtgacaaaaccaccctgaactccaa 133307

                                                                
Query: 579    atttctgcctttcccacttgtaagaagttctgctcccctccgagctgttt 628
              | || |||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 133308 acttttgccttccccacttgtaagaagttctgctcccctccgaactgttt 133357
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  103 bits (52), Expect = 7e-19
 Identities = 78/86 (90%), Gaps = 3/86 (3%)
 Strand = Plus / Minus

                                                                           
Query: 533     tttggctcggctaacgggttggtgacaaatccaccctgaactccaaatttctgcctttcc 592
               |||||||| ||||| |||||||||||||   |||||||||||||||| |||||||| |||
Sbjct: 7544792 tttggctctgctaatgggttggtgacaa---caccctgaactccaaacttctgcctctcc 7544736

                                         
Query: 593     cacttgtaagaagttctgctcccctc 618
               ||||||||||||||||||||| ||||
Sbjct: 7544735 cacttgtaagaagttctgctctcctc 7544710
to top
>dbj|AP004725.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0412C04
          Length = 146849

 Score =  103 bits (52), Expect = 7e-19
 Identities = 78/86 (90%), Gaps = 3/86 (3%)
 Strand = Plus / Minus

                                                                          
Query: 533    tttggctcggctaacgggttggtgacaaatccaccctgaactccaaatttctgcctttcc 592
              |||||||| ||||| |||||||||||||   |||||||||||||||| |||||||| |||
Sbjct: 104723 tttggctctgctaatgggttggtgacaa---caccctgaactccaaacttctgcctctcc 104667

                                        
Query: 593    cacttgtaagaagttctgctcccctc 618
              ||||||||||||||||||||| ||||
Sbjct: 104666 cacttgtaagaagttctgctctcctc 104641
to top
>gb|AY106868.1| Zea mays PCO072630 mRNA sequence
          Length = 1321

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 94/108 (87%), Gaps = 2/108 (1%)
 Strand = Plus / Minus

                                                                       
Query: 522 cagaagaaatatttggctcggctaacgggttggtgacaaatccaccctgaactccaaatt 581
           |||| ||||| || ||||||||||| ||||| ||||||||  |||||||||  |||||  
Sbjct: 783 cagatgaaatgttcggctcggctaatgggtttgtgacaaa--caccctgaagcccaaacc 726

                                                           
Query: 582 tctgcctttcccacttgtaagaagttctgctcccctccgagctgtttg 629
           ||||||| |||||||||||||||||||||||||| || ||||||||||
Sbjct: 725 tctgcctctcccacttgtaagaagttctgctcccatctgagctgtttg 678
to top
>gb|AY111143.1| Zea mays CL50626_1 mRNA sequence
          Length = 627

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 72/86 (83%), Gaps = 3/86 (3%)
 Strand = Plus / Plus

                                                                       
Query: 536 ggctcggctaacgggttggtgacaaatccaccctgaactccaaatttctgc---ctttcc 592
           ||||| ||||| || |||| |||||| ||||| || |||||||||||||||   || |||
Sbjct: 439 ggctctgctaagggattggggacaaaaccaccatggactccaaatttctgctgtctgtcc 498

                                     
Query: 593 cacttgtaagaagttctgctcccctc 618
           |||||||||| | |||||||| ||||
Sbjct: 499 cacttgtaaggacttctgctctcctc 524
to top
>gb|AC100149.12| Mus musculus chromosome 10, clone RP23-43F3, complete sequence
          Length = 184927

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 566 ccctgaactccaaatttctgccttt 590
           |||||||||||||||||||||||||
Sbjct: 192 ccctgaactccaaatttctgccttt 216
to top
>gb|AC159380.8| Mus musculus 10 BAC RP24-460M18 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 196877

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 566    ccctgaactccaaatttctgccttt 590
              |||||||||||||||||||||||||
Sbjct: 171220 ccctgaactccaaatttctgccttt 171244
to top
>emb|AL353685.23| Human DNA sequence from clone RP11-31J20 on chromosome 9 Contains part
             of the ABCA1 gene for ATP-binding cassette sub-family A
             (ABC1) member 1, complete sequence
          Length = 129608

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 480   atccttccttctgccttcttga 501
             ||||||||||||||||||||||
Sbjct: 82660 atccttccttctgccttcttga 82639
to top
>gb|AF287262.1|AF287262 Homo sapiens ATP-binding cassette 1 sub-family A member 1 (ABCA1) and
             SNAP protein genes, complete cds
          Length = 201144

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 480   atccttccttctgccttcttga 501
             ||||||||||||||||||||||
Sbjct: 96266 atccttccttctgccttcttga 96287
to top
>gb|AF275948.1|AF275948 Homo sapiens ABCA1 (ABCA1) gene, complete cds
          Length = 149034

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 480   atccttccttctgccttcttga 501
             ||||||||||||||||||||||
Sbjct: 63648 atccttccttctgccttcttga 63669
to top
>gb|AC146896.15| Mus musculus chromosome X clone xcat-28-97f16, complete sequence
          Length = 163375

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 563   ccaccctgaactccaaatttc 583
             |||||||||||||||||||||
Sbjct: 54431 ccaccctgaactccaaatttc 54451
to top
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 212     cccaagtgaggatgcagctca 232
               |||||||||||||||||||||
Sbjct: 4110597 cccaagtgaggatgcagctca 4110617
to top
>ref|XM_391147.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG10971.1)
            partial mRNA
          Length = 1509

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 208  caaccccaagtgaggatgcagctca 232
            |||| ||||||||||||||||||||
Sbjct: 1146 caactccaagtgaggatgcagctca 1122
to top
>gb|AC093447.17| Mus musculus strain 129/Sv clone ct7-25g12 map X, complete sequence
          Length = 188211

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 563   ccaccctgaactccaaatttc 583
             |||||||||||||||||||||
Sbjct: 79005 ccaccctgaactccaaatttc 79025
to top
>gb|AC087376.5| Homo sapiens chromosome 11, clone RP11-230O19, complete sequence
          Length = 164441

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 13  atccaaaactatatacatcca 33
           |||||||||||||||||||||
Sbjct: 305 atccaaaactatatacatcca 285
to top
>gb|AC104978.2| Homo sapiens chromosome 11, clone RP11-244O16, complete sequence
          Length = 154105

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 13     atccaaaactatatacatcca 33
              |||||||||||||||||||||
Sbjct: 117113 atccaaaactatatacatcca 117093
to top
>emb|AL732391.7| Mouse DNA sequence from clone RP23-364H13 on chromosome X, complete
              sequence
          Length = 173841

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 563    ccaccctgaactccaaatttc 583
              |||||||||||||||||||||
Sbjct: 106972 ccaccctgaactccaaatttc 106992
to top
>gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, complete sequence
          Length = 206380

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 334    tagaggagaaaaaaccctccaaaa 357
              |||||| |||||||||||||||||
Sbjct: 192360 tagaggggaaaaaaccctccaaaa 192383
to top
>ref|XM_522913.1| PREDICTED: Pan troglodytes similar to KIAA1737 protein (LOC467516),
           mRNA
          Length = 1200

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 469 ctgaattcttacaccaaaatagcc 492
to top
>gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, complete sequence
          Length = 215514

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 334    tagaggagaaaaaaccctccaaaa 357
              |||||| |||||||||||||||||
Sbjct: 180390 tagaggggaaaaaaccctccaaaa 180367
to top
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 261    gcccagctcagtgactttgacatt 284
              |||||| |||||||||||||||||
Sbjct: 799308 gcccaggtcagtgactttgacatt 799285
to top
>gb|AC148869.1| Pan troglodytes fosmid clone CH1251-3642E8 from Y, complete
           sequence
          Length = 39487

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 240 gagttctacttcagacataa 259
           ||||||||||||||||||||
Sbjct: 389 gagttctacttcagacataa 370
to top
>ref|NM_033426.2| Homo sapiens KIAA1737 (KIAA1737), mRNA
          Length = 4397

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 648 ctgaattcttacaccaaaatagcc 671
to top
>gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, complete sequence
          Length = 149463

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 334   tagaggagaaaaaaccctccaaaa 357
             |||||| |||||||||||||||||
Sbjct: 55584 tagaggggaaaaaaccctccaaaa 55561
to top
>emb|CR769784.10| Zebrafish DNA sequence from clone DKEY-3N10 in linkage group 1, complete
              sequence
          Length = 230420

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 439    cttcatctcacctaaccaac 458
              ||||||||||||||||||||
Sbjct: 152775 cttcatctcacctaaccaac 152756
to top
>gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 250414

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 561   atccaccctgaactccaaatttct 584
             ||||||||||| ||||||||||||
Sbjct: 79150 atccaccctgacctccaaatttct 79173
to top
>gb|AC112644.3| Homo sapiens 3 BAC RP11-10O22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178521

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 484    ttccttctgccttcttgagt 503
              ||||||||||||||||||||
Sbjct: 116271 ttccttctgccttcttgagt 116252
to top
>gb|BC037300.2| Homo sapiens KIAA1737, mRNA (cDNA clone MGC:33650 IMAGE:4827858),
           complete cds
          Length = 4341

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 568 ctgaattcttacaccaaaatagcc 591
to top
>emb|AL604066.9| Mouse DNA sequence from clone RP23-174M12 on chromosome 11 Contains the
              3' end of a novel gene, the Mnt gene for max binding
              protein, two novel genes, the  Srr gene for serine
              racemase, the 5' end of a novel gene and five CpG islands,
              complete sequence
          Length = 184151

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 571    aactccaaatttctgccttt 590
              ||||||||||||||||||||
Sbjct: 145389 aactccaaatttctgccttt 145408
to top
>emb|CR859828.1| Pongo pygmaeus mRNA; cDNA DKFZp459E237 (from clone DKFZp459E237)
          Length = 4363

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 646 ctgaattcttacaccaaaatagcc 669
to top
>emb|AL834514.1|HSM805629 Homo sapiens mRNA; cDNA DKFZp762K087 (from clone DKFZp762K087)
          Length = 4262

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 551 ctgaattcttacaccaaaatagcc 574
to top
>dbj|AK125777.1| Homo sapiens cDNA FLJ43789 fis, clone TESTI2053242
          Length = 2546

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 471  taaagccaaatccttccttc 490
            ||||||||||||||||||||
Sbjct: 2527 taaagccaaatccttccttc 2546
to top
>dbj|AK096603.1| Homo sapiens cDNA FLJ39284 fis, clone OCBBF2011759
          Length = 4258

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 560 ctgaattcttacaccaaaatagcc 583
to top
>gb|AC010677.4| Homo sapiens chromosome 7 clone CTD-2304L4, complete sequence
          Length = 112659

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 626   tttggaacactggaggcaga 645
             ||||||||||||||||||||
Sbjct: 23278 tttggaacactggaggcaga 23297
to top
>ref|XM_941431.1| PREDICTED: Homo sapiens hypothetical protein LOC652101 (LOC652101),
           mRNA
          Length = 1156

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 484 ttccttctgccttcttgagt 503
           ||||||||||||||||||||
Sbjct: 971 ttccttctgccttcttgagt 952
to top
>ref|XM_930126.1| PREDICTED: Homo sapiens hypothetical protein LOC647109 (LOC647109),
           mRNA
          Length = 985

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 484 ttccttctgccttcttgagt 503
           ||||||||||||||||||||
Sbjct: 800 ttccttctgccttcttgagt 781
to top
>gb|AC115991.4| Homo sapiens chromosome 11, clone CTC-342M10, complete sequence
          Length = 48955

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    ttgtgactgaattcttacac 74
             ||||||||||||||||||||
Sbjct: 42476 ttgtgactgaattcttacac 42457
to top
>gb|AC007880.2| Homo sapiens BAC clone RP11-323F11 from 2, complete sequence
          Length = 122223

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 471   taaagccaaatccttccttc 490
             ||||||||||||||||||||
Sbjct: 14353 taaagccaaatccttccttc 14372
to top
>gb|AC008462.6|AC008462 Homo sapiens chromosome 5 clone CTC-352J10, complete sequence
          Length = 183591

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     agctgttttattatccaaaa 20
             ||||||||||||||||||||
Sbjct: 37098 agctgttttattatccaaaa 37079
to top
>gb|AC079602.15| Homo sapiens 12 BAC RP11-216P16 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172008

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 580    tttctgcctttcccacttgtaaga 603
              ||||||||||||||||| ||||||
Sbjct: 102772 tttctgcctttcccactggtaaga 102749
to top
>gb|AC060812.15| Homo sapiens chromosome 11, clone RP11-120E20, complete sequence
          Length = 184106

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 55     ttgtgactgaattcttacac 74
              ||||||||||||||||||||
Sbjct: 167634 ttgtgactgaattcttacac 167653
to top
>gb|AY154351.1| Ficedula hypoleuca isolate c2 growth hormone receptor (Ghr) gene,
           intron
          Length = 520

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 384 cagtgactttgacattgcaa 403
to top
>gb|AY154350.1| Ficedula hypoleuca isolate c1 growth hormone receptor (Ghr) gene,
           intron
          Length = 520

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 384 cagtgactttgacattgcaa 403
to top
>gb|AY154349.1| Ficedula hypoleuca isolate p3 growth hormone receptor (Ghr) gene,
           intron
          Length = 520

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 384 cagtgactttgacattgcaa 403
to top
>gb|AY154348.1| Ficedula albicollis isolate p2 growth hormone receptor (Ghr) gene,
           intron
          Length = 520

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 384 cagtgactttgacattgcaa 403
to top
>gb|AY154347.1| Ficedula albicollis isolate p1 growth hormone receptor (Ghr) gene,
           intron
          Length = 520

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 384 cagtgactttgacattgcaa 403
to top
>gb|AC007686.5|AC007686 Homo sapiens chromosome 14 clones CTD-2289B16, RP11-116N21, RP11-7F17,
              complete sequence
          Length = 181386

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 61     ctgaattcttacaccgaaatagcc 84
              ||||||||||||||| ||||||||
Sbjct: 176011 ctgaattcttacaccaaaatagcc 176034
to top
>emb|CR812957.13| Zebrafish DNA sequence from clone DKEY-41L5 in linkage group 1, complete
              sequence
          Length = 220462

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 439    cttcatctcacctaaccaac 458
              ||||||||||||||||||||
Sbjct: 146032 cttcatctcacctaaccaac 146051
to top
>dbj|AP006294.1| Homo sapiens genomic DNA, chromosome 11 clone:CTC-342M10, complete
             sequence
          Length = 83489

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    ttgtgactgaattcttacac 74
             ||||||||||||||||||||
Sbjct: 42475 ttgtgactgaattcttacac 42456
to top
>emb|AJ870019.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP24
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870018.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP23
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870017.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP21
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870016.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP19
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870015.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP11
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870014.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP9
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870013.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP8
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870012.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP6
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870011.1| Ficedula hypoleuca partial intron 5 of the ghr gene, isolate SP4
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870010.1| Ficedula parva partial intron 5 of the ghr gene, isolate Parv
          Length = 499

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 365 cagtgactttgacattgcaa 384
to top
>emb|AJ870009.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC10
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870008.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC9
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870007.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC8
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870006.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC7
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870005.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC6
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870004.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC5
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870003.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC4
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870002.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC3
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>emb|AJ870001.1| Ficedula albicollis partial intron 5 of the ghr gene, isolate IC2
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 cagtgactttgacattgcaa 288
           ||||||||||||||||||||
Sbjct: 373 cagtgactttgacattgcaa 392
to top
>dbj|AP004486.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT05B20, TM0019a,
             complete sequence
          Length = 73833

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 425   atcaaacgaaatatcttcatctca 448
             ||||||| ||||||||||||||||
Sbjct: 27887 atcaaactaaatatcttcatctca 27864
to top
>emb|AJ223837.1|MMU223837 Mus musculus Eef1a2 gene (mutated gene from wasted mice)
          Length = 18909

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 567   cctgaactccaaatttctgc 586
             ||||||||||||||||||||
Sbjct: 11082 cctgaactccaaatttctgc 11101
to top
>dbj|AB051524.1| Homo sapiens mRNA for KIAA1737 protein, partial cds
          Length = 4221

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 61  ctgaattcttacaccgaaatagcc 84
           ||||||||||||||| ||||||||
Sbjct: 523 ctgaattcttacaccaaaatagcc 546


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,556,630
Number of Sequences: 3902068
Number of extensions: 6556630
Number of successful extensions: 124984
Number of sequences better than 10.0: 74
Number of HSP's better than 10.0 without gapping: 74
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124737
Number of HSP's gapped (non-prelim): 239
length of query: 652
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 629
effective length of database: 17,143,297,704
effective search space: 10783134255816
effective search space used: 10783134255816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top