| Clone Name | rbags4l06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC127314.4| Mus musculus BAC clone RP23-217N4 from chromosome 18, complete sequence Length = 232320 Score = 40.1 bits (20), Expect = 1.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 tttccccaggtgatggagaa 52 |||||||||||||||||||| Sbjct: 212271 tttccccaggtgatggagaa 212290
>gb|AC129179.3| Mus musculus BAC clone RP23-240C24 from chromosome 18, complete sequence Length = 208462 Score = 40.1 bits (20), Expect = 1.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 tttccccaggtgatggagaa 52 |||||||||||||||||||| Sbjct: 135616 tttccccaggtgatggagaa 135597
>ref|XM_586655.2| PREDICTED: Bos taurus similar to calpain 6 (LOC539360), mRNA Length = 2313 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 6 gaaatccacaatgatatca 24 ||||||||||||||||||| Sbjct: 724 gaaatccacaatgatatca 706
>gb|AC110569.8| Mus musculus chromosome 15, clone RP23-309J17, complete sequence Length = 213398 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 35 tccccaggtgatggagaac 53 ||||||||||||||||||| Sbjct: 47207 tccccaggtgatggagaac 47225
>ref|XM_711616.1| Candida albicans SC5314 putative vacuolar protein sorting protein (CaO19_3399), mRNA Length = 2295 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 tgatatcatacagattttt 35 ||||||||||||||||||| Sbjct: 2082 tgatatcatacagattttt 2064
>ref|XM_711556.1| Candida albicans SC5314 putative vacuolar protein sorting protein (CaO19_10902), mRNA Length = 2295 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 tgatatcatacagattttt 35 ||||||||||||||||||| Sbjct: 2082 tgatatcatacagattttt 2064
>gb|AC073939.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-218B2, complete sequence Length = 195281 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 tatcatacagatttttccc 38 ||||||||||||||||||| Sbjct: 10298 tatcatacagatttttccc 10316
>emb|AL033391.1|CAC20C1 C.albicans cosmid Ca20C1 Length = 37968 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 tgatatcatacagattttt 35 ||||||||||||||||||| Sbjct: 7122 tgatatcatacagattttt 7140
>gb|AC012470.16| Homo sapiens chromosome 10 clone RP11-506P9, complete sequence Length = 122543 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 aatgatatcatacagattt 33 ||||||||||||||||||| Sbjct: 34577 aatgatatcatacagattt 34559
>gb|AC122686.6| Homo sapiens 12 BAC RP11-295J2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 121995 Score = 38.2 bits (19), Expect = 4.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 aatgatatcatacagatttttcc 37 |||||||||||||| |||||||| Sbjct: 66272 aatgatatcatacacatttttcc 66250
>emb|AL929596.11| Zebrafish DNA sequence from clone DKEY-53H9, complete sequence Length = 191874 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 43 tgatggagaactgccatcg 61 ||||||||||||||||||| Sbjct: 189961 tgatggagaactgccatcg 189979
>emb|BX088601.12| Zebrafish DNA sequence from clone DKEY-221L8, complete sequence Length = 33467 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 43 tgatggagaactgccatcg 61 ||||||||||||||||||| Sbjct: 87 tgatggagaactgccatcg 105
>gb|AC016968.24| Homo sapiens 3 BAC RP11-59J16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 152586 Score = 38.2 bits (19), Expect = 4.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 28 agatttttccccaggtgatggag 50 |||||||||||||||||| |||| Sbjct: 27483 agatttttccccaggtgagggag 27461
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region locus, strain C57BL/6 Length = 2500000 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 tatcatacagatttttccc 38 ||||||||||||||||||| Sbjct: 420121 tatcatacagatttttccc 420139
>gb|AC163348.5| Mus musculus BAC clone RP23-230L2 from chromosome 12, complete sequence Length = 233932 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 tatcatacagatttttccc 38 ||||||||||||||||||| Sbjct: 122133 tatcatacagatttttccc 122151
>emb|BX248414.5| Zebrafish DNA sequence from clone CH211-236E8, complete sequence Length = 149603 Score = 38.2 bits (19), Expect = 4.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 7 aaatccacaatgatatcat 25 ||||||||||||||||||| Sbjct: 59983 aaatccacaatgatatcat 59965 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 850,636 Number of Sequences: 3902068 Number of extensions: 850636 Number of successful extensions: 83877 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 83808 Number of HSP's gapped (non-prelim): 69 length of query: 96 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 75 effective length of database: 17,151,101,840 effective search space: 1286332638000 effective search space used: 1286332638000 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)