ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4l05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U49505.1|HVU49505 Hordeum vulgare profilin (Hvpro1) mRNA, com... 839 0.0
2emb|X89826.1|TAPRO2GEN T.aestivum mRNA for profilin (clone TaPRO2) 511 e-142
3emb|X89825.1|TAPRO1GEN T.aestivum mRNA for profilin (clone TaPRO1) 496 e-137
4emb|X89827.1|TAPRO3GEN T.aestivum mRNA for profilin (clone TaPRO3) 492 e-136
5ref|XM_550652.1| Oryza sativa (japonica cultivar-group), mRNA 329 6e-87
6dbj|AK121519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 6e-87
7dbj|AK058798.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 6e-87
8gb|AF201459.1|AF201459 Zea mays profilin 5 (PRO5) mRNA, complete... 297 2e-77
9gb|BT018328.1| Zea mays clone EL01T0208F04.c mRNA sequence 289 5e-75
10gb|AY103599.1| Zea mays PCO094927 mRNA sequence 287 2e-74
11gb|AF032370.1|AF032370 Zea mays profilin (PRO4) mRNA, complete cds 287 2e-74
12dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
13dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
14dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
15emb|X73279.1|ZMPRO1MR Z.mays ZmPRO1 mRNA for profilin 1 115 2e-22
16gb|AY109559.1| Zea mays CL2097_1 mRNA sequence 115 2e-22
17emb|Y09457.1|PPPROFIL3 P.pratense mRNA for profilin 3 105 2e-19
18emb|AJ565931.1|CME565931 Cucumis melo mRNA for profilin (cuc m 2... 98 4e-17
19emb|AJ507459.1|MDO507459 Malus x domestica mRNA for apple allerg... 98 4e-17
20emb|AJ491881.1|PPE491881 Prunus persica mRNA for profilin, aller... 98 4e-17
21gb|AF129425.1|AF129425 Prunus avium profilin mRNA, complete cds 98 4e-17
22gb|AF377949.1|AF377949 Ananas comosus profilin mRNA, complete cds 94 6e-16
23gb|AF129427.1|AF129427 Malus domestica GD4-2 profilin mRNA, comp... 92 2e-15
24emb|Y09458.1|PPPROFIL4 P.pratense mRNA for profilin 4 90 9e-15
25emb|AJ132397.1|HBR132397 Hevea brasiliensis mRNA for hevea brasi... 90 9e-15
26emb|AJ865015.1| Citrus sinensis mRNA for profilin allergen Cit s... 90 9e-15
27gb|DQ400579.1| Mangifera indica profilin 2 mRNA, complete cds 90 9e-15
28gb|AY081850.1| Prunus dulcis profilin (pru du 4.1) mRNA, complet... 90 9e-15
29gb|AF129428.1|AF129428 Malus domestica GD4-5 profilin mRNA, comp... 90 9e-15
30gb|AY049013.1| Litchi chinensis profilin mRNA, complete cds 88 4e-14
31gb|AF200184.1|AF200184 Lilium longiflorum profilin 1 mRNA, compl... 88 4e-14
32emb|AJ507458.1|MDO507458 Malus x domestica mRNA for apple allerg... 86 1e-13
33gb|AY081852.1| Prunus dulcis profilin (pru du 4.2) mRNA, complet... 86 1e-13
34emb|X93465.1|NTPRO2MR N.tabacum mRNA for profilin (clone NTPRO2) 84 6e-13
35emb|X82120.1|NTPROFLN N.tabacum mRNA for profilin 84 6e-13
36emb|Y09456.1|PPPROFIL2 P.pratense mRNA for profilin 2 82 2e-12
37gb|U50195.1|SLU50195 Solanum lycopersicum profilin (LePro1) mRNA... 82 2e-12
38emb|X77583.1|PPPROPXI P.pratense mRNA for profilin-Phl p XI 80 9e-12
39dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
40dbj|AP002743.1| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
41ref|NM_195688.1| Oryza sativa (japonica cultivar-group) Profilin... 74 5e-10
42ref|NM_195685.1| Oryza sativa (japonica cultivar-group) Profilin... 74 5e-10
43gb|AY268424.1| Humulus scandens profilin-like protein (LCM9) mRN... 74 5e-10
44emb|AJ130969.1|NTA130969 Nicotiana tabacum pronp1 gene, exons 1-3 74 5e-10
45gb|AF310253.1|AF310253 Oryza sativa profilin A mRNA, complete cds 74 5e-10
46dbj|AK121412.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 5e-10
47dbj|AK100089.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 5e-10
48gb|AY792613.1| Malus x domestica clone M4-2-FS8 profilin 2 (Mal ... 72 2e-09
49gb|AY792612.1| Malus x domestica clone M4-2-PM2 profilin 2 (Mal ... 72 2e-09
50gb|AY792611.1| Malus x domestica clone M4-2-FS10 profilin 2 (Mal... 72 2e-09
51gb|AY792610.1| Malus x domestica clone M4-2-PM7 profilin 2 (Mal ... 72 2e-09
52gb|DQ309464.1| Litchi chinensis profilin mRNA, complete cds 72 2e-09
53emb|AJ491882.1|PPE491882 Prunus persica mRNA for profilin, aller... 70 8e-09
54gb|AF377948.1|AF377948 Musa acuminata profilin mRNA, complete cds 70 8e-09
55gb|AY082337.1| Chenopodium album pollen allergen Che a 2 mRNA, c... 70 8e-09
56gb|M65179.1|BELPRFLN B.verrucosa profilin (BetvII) mRNA, complet... 68 3e-08
57emb|X73281.1|ZMPRO3MR Z.mays ZmPRO3 mRNA for profilin 3 66 1e-07
58dbj|AK070595.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
59gb|AF126263.1|AF126263 Phalaenopsis sp. 'KCbutterfly' putative p... 66 1e-07
60gb|AY898658.1| Crocus sativus profilin mRNA, complete cds 66 1e-07
61gb|AY726606.1| Arachis hypogaea profilin (PROF) mRNA, complete cds 64 5e-07
62gb|AY792617.1| Malus x domestica clone M4-5-FS4 profilin 3 (Mal ... 62 2e-06
63gb|AY792616.1| Malus x domestica clone M4-5-FS5 profilin 3 (Mal ... 62 2e-06
64gb|AY792615.1| Malus x domestica clone M4-5-PM2 profilin 3 (Mal ... 62 2e-06
65gb|AY792614.1| Malus x domestica clone M4-5-PM7 profilin 3 (Mal ... 62 2e-06
66gb|AC149269.11| Medicago truncatula clone mth2-102b19, complete ... 62 2e-06
67emb|Y15042.1|HBY15042 Hevea brasiliensis mRNA for profilin 62 2e-06
68emb|X73280.1|ZMPRO2MR Z.mays ZmPRO2 mRNA for profilin 2 62 2e-06
69gb|DQ270547.1| Mangifera indica profilin 1 (Man i 3.01) mRNA, co... 62 2e-06
70gb|AF092547.1|AF092547 Ricinus communis profilin (pro1) mRNA, co... 62 2e-06
71emb|AJ417566.1|PDA417566 Phoenix dactylifera mRNA for profilin (... 60 8e-06
72emb|Y12425.1|OEPROFIL1 Olea europaea mRNA for profilin 1 58 3e-05
73emb|Y08390.1|CDY08390 C.dactylon mRNA for profilin 1 58 3e-05
74gb|AC074354.8|AC074354 Genomic Sequence for Oryza sativa, Nippon... 58 3e-05
75dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
76gb|AY900012.1| Petroselinum crispum profilin 1 (PRF1) mRNA, comp... 58 3e-05
77gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 58 3e-05
78emb|X81982.1|PVPROFILN P.vulgaris mRNA for profilin 56 1e-04
79emb|AJ421030.1|AVU421030 Artemisia vulgaris mRNA for profilin, i... 56 1e-04
80gb|AY292385.2| Cucumis melo var. reticulatus profilin (Cu m2) mR... 54 5e-04
81gb|AY292386.3| Cucumis melo var. reticulatus cultivar Mashadi pr... 54 5e-04
82gb|AY292387.3| Cucumis melo var. reticulatus cultivar Mashadi pr... 54 5e-04
83gb|AY271295.2| Cucumis melo var. reticulatus profilin (Cuc m2) m... 54 5e-04
84ref|NM_119080.2| Arabidopsis thaliana PRF2 (PROFILIN 2); actin b... 54 5e-04
85gb|AY114048.1| Arabidopsis thaliana putative profilin 2 protein ... 54 5e-04
86gb|AY074350.1| Arabidopsis thaliana putative profilin 2 protein ... 54 5e-04
87emb|AJ223982.1|GMPRO1 Glycine max mRNA for profilin, PRO1 54 5e-04
88emb|AJ223981.1|GMPRO2 Glycine max mRNA for profilin, PRO2 54 5e-04
89gb|U43591.1|U43591 Arabidopsis thaliana profilin (PRF2) mRNA, co... 54 5e-04
90gb|AF119367.1|AF119367 Hevea brasiliensis clone hevb 8.10 latex ... 54 5e-04
91gb|AY109853.1| Zea mays CL2096_2 mRNA sequence 54 5e-04
92gb|DQ335252.1| Cinnamomum camphora profilin-like protein (Cin c ... 54 5e-04
93gb|U43326.1|ATU43326 Arabidopsis thaliana profilin 2 mRNA, compl... 54 5e-04
94ref|NM_125043.2| Arabidopsis thaliana PRF3 (PROFILIN 3); actin b... 52 0.002
95ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin b... 52 0.002
96gb|AY730591.1| Citrullus lanatus profilin mRNA, partial cds 52 0.002
97gb|BT000885.1| Arabidopsis thaliana clone C105361 putative profi... 52 0.002
98gb|AY034989.1| Arabidopsis thaliana putative profilin protein (A... 52 0.002
99gb|BT000264.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA,... 52 0.002
100gb|AY072427.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA,... 52 0.002
101gb|U43592.1|U43592 Arabidopsis thaliana profilin (PRF3) mRNA, co... 52 0.002
102gb|U43590.1|U43590 Arabidopsis thaliana profilin (PRF1) mRNA, co... 52 0.002
103emb|BX818797.1|CNS0A9XS Arabidopsis thaliana Full-length cDNA Co... 52 0.002
104emb|BX833469.1|CNS0A0EA Arabidopsis thaliana Full-length cDNA Co... 52 0.002
105gb|AY084285.1| Arabidopsis thaliana clone 102364 mRNA, complete ... 52 0.002
106dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
107gb|AF200186.1|AF200186 Lilium longiflorum profilin 3 mRNA, compl... 52 0.002
108gb|U43325.1|ATU43325 Arabidopsis thaliana profilin 1 mRNA, compl... 52 0.002
109emb|Y08389.1|CDY08389 C.dactylon mRNA for profilin 2 50 0.008
110gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map... 50 0.008
111gb|AY268426.1| Ambrosia artemisiifolia profilin-like protein (D1... 50 0.008
112gb|AY086576.1| Arabidopsis thaliana clone 25886 mRNA, complete s... 50 0.008
113gb|U43593.1|U43593 Arabidopsis thaliana profilin (PRF1) gene, co... 50 0.008
114gb|AF200185.1|AF200185 Lilium longiflorum profilin 2 mRNA, compl... 50 0.008
115gb|AY900014.1| Petroselinum crispum profilin 3 (PRF3) mRNA, comp... 50 0.008
116gb|U43322.1|ATU43322 Arabidopsis thaliana profilin 1 gene, compl... 50 0.008
117gb|DQ228336.1| Solanum tuberosum clone 145G03 profilin-like prot... 48 0.031
118emb|Y12430.1|OEPROFIL3 Olea europaea mRNA for profilin 3 48 0.031
119gb|AF049936.1|AF049936 Petunia x hybrida PGPS/NH20 (PGPS/NH20) m... 48 0.031
120gb|AF059616.1|AF059616 Arachis hypogaea profilin (Ara h 5) mRNA,... 48 0.031
121emb|AJ870450.1| Fragaria x ananassa microsatellite DNA, locus UF... 48 0.031
122ref|NM_119079.3| Arabidopsis thaliana PRF4; actin binding AT4G29... 46 0.12
123gb|DQ207877.1| Solanum tuberosum clone 092D10 profilin-like mRNA... 46 0.12
124gb|AY496123.1| Capsicum annuum profilin mRNA, complete cds 46 0.12
125emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, ... 46 0.12
126gb|BT024816.1| Arabidopsis thaliana At4g29340 gene, complete cds 46 0.12
127gb|AY894660.1| Ambrosia artemisiifolia profilin isoallergen 1 mR... 46 0.12
128gb|BT003946.1| Arabidopsis thaliana clone RAFL15-14-D07 (R20752)... 46 0.12
129gb|AY085179.1| Arabidopsis thaliana clone 13601 mRNA, complete s... 46 0.12
130gb|AF119366.1|AF119366 Hevea brasiliensis clone hevb 8.8 latex p... 46 0.12
131gb|AY900016.1| Petroselinum crispum profilin 5 (PRF5) mRNA, comp... 46 0.12
132gb|AY879597.1| Cucumis melo profilin (m2) mRNA, complete cds and... 46 0.12
133gb|U43323.1|ATU43323 Arabidopsis thaliana profilin 2 and profili... 46 0.12
134gb|AY268425.1| Ambrosia artemisiifolia profilin-like protein (A0... 44 0.48
135gb|AY499654.1| Capsicum annuum profilin mRNA, partial cds 44 0.48
136gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, co... 44 0.48
137emb|AJ417553.1|LES417553 Lycopersicon esculentum mRNA for profil... 44 0.48
138gb|AF327623.1|AF327623 Corylus avellana clone 7 minor allergen h... 44 0.48
139gb|AF327622.1|AF327622 Corylus avellana clone 6 minor allergen h... 44 0.48
140gb|U43594.1|U43594 Arabidopsis thaliana profilin (PRF4) gene, co... 44 0.48
141gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Can... 44 0.48
142gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, compl... 42 1.9
143gb|AY550179.1| Elaeis oleifera profilin mRNA, partial cds 42 1.9
144dbj|AK133754.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 42 1.9
145gb|AF456482.1| Daucus carota minor allergen Dau c 4 profilin mRN... 42 1.9
146gb|AF129423.1|AF129423 Apium graveolens profilin mRNA, complete cds 42 1.9
147gb|AC158222.6| Mus musculus chromosome 8, clone RP23-117M15, com... 42 1.9
148gb|AF352180.1|AF352180 Mus musculus pericentriolar material gene... 42 1.9
149emb|BX897672.1| Neurospora crassa DNA linkage group III BAC clon... 42 1.9
150gb|AY900015.1| Petroselinum crispum profilin 4 (PRF4) mRNA, comp... 42 1.9
151ref|NM_023662.1| Mus musculus pericentriolar material 1 (Pcm1), ... 42 1.9
152dbj|AB029291.1| Mus musculus pcm-1 mRNA for pericentriolar mater... 42 1.9
153gb|AY792609.1| Malus x domestica clone M4.01FS12 profilin 1 (Mal... 40 7.5
154gb|AY792608.1| Malus x domestica clone M4.01PM9 profilin 1 (Mal ... 40 7.5
155gb|AY792607.1| Malus x domestica clone M4.01FS6 profilin 1 (Mal ... 40 7.5
156gb|AY792606.1| Malus x domestica clone M4.01PM7 profilin 1 (Mal ... 40 7.5
157gb|AY792605.1| Malus x domestica clone M4.01FS7 profilin 1 (Mal ... 40 7.5
158ref|XM_422236.1| PREDICTED: Gallus gallus similar to KIAA1096 pr... 40 7.5
159gb|AC154768.2| Mus musculus BAC clone RP24-444E21 from chromosom... 40 7.5
160gb|AC123957.4| Mus musculus BAC clone RP23-302N2 from 12, comple... 40 7.5
161gb|DQ450945.1| Streptomyces sp. 98-62 polyketide synthase I prot... 40 7.5
162emb|Y13271.1|MAPROFILN Mercurialis annua mRNA for profilin 40 7.5
163emb|Y12429.1|OEPROFIL2 Olea europaea mRNA for profilin 2 40 7.5
164emb|AJ507457.1|MDO507457 Malus x domestica mRNA for apple allerg... 40 7.5
165gb|AC139528.16| Botryllus schlosseri clone subsf-555i12, complet... 40 7.5
166gb|AC138022.14| Botryllus schlosseri clone subsf-533i14, complet... 40 7.5
167emb|AL834316.1|HSM805358 Homo sapiens mRNA; cDNA DKFZp434G1729 (... 40 7.5
168dbj|AK128284.1| Homo sapiens cDNA FLJ46422 fis, clone THYMU3013241 40 7.5
169dbj|AK127979.1| Homo sapiens cDNA FLJ46094 fis, clone TESTI2018687 40 7.5
170ref|XM_938028.1| PREDICTED: Homo sapiens chromosome 19 open read... 40 7.5
171ref|XM_371195.4| PREDICTED: Homo sapiens chromosome 19 open read... 40 7.5
172gb|AF129424.1|AF129424 Pyrus communis profilin mRNA, complete cds 40 7.5
173gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 40 7.5
174dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 40 7.5
175gb|AF129426.1|AF129426 Malus domestica GD4-1 profilin mRNA, comp... 40 7.5
176gb|AC102657.13| Mus musculus chromosome 10, clone RP23-15N10, co... 40 7.5

>gb|U49505.1|HVU49505 Hordeum vulgare profilin (Hvpro1) mRNA, complete cds
          Length = 780

 Score =  839 bits (423), Expect = 0.0
 Identities = 464/475 (97%), Gaps = 2/475 (0%)
 Strand = Plus / Minus

                                                                       
Query: 82  ccttcgacacgtcaccaaccgacaaaccccaagctagattattcactgcatatatcatgc 141
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 630 ccttcgacacatcaccaaccgacaaaccccaagctagattattcactgcatatatcatgc 571

                                                                       
Query: 142 ggtacgccaagcggatagatgcaaagcccacaggagcaaacttagtcccagacgaccaaa 201
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 ggtacgccaagcagatagatgcaaagcccacaggagcaaacttagtcccagacgaccaaa 511

                                                                       
Query: 202 ataacaacatatcagggtgggcttagaaaccctgctcgaccaggtagtcgccaagcctct 261
           |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ataacaacatatcaggggaggcttagaaaccctgctcgaccaggtagtcgccaagcctct 451

                                                                       
Query: 262 ccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaagaatcaggg 321
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 450 ccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccgagaatcaggg 391

                                                                       
Query: 322 ccatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccc 381
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 390 gcatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccc 331

                                                                       
Query: 382 caggttcaccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaa 441
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 caggttcaccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaa 271

                                                                       
Query: 442 gatgtccgggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggg 501
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 270 gatgtccgggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaact-gg 212

                                                                  
Query: 502 gggaagttgggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||||| ||||||| || ||||||||| |||||||||||||||
Sbjct: 211 gggaagttgggggactggacccagactct-cccgtcgtgaccgaggatggcggcg 158



 Score =  103 bits (52), Expect = 6e-19
 Identities = 52/52 (100%)
 Strand = Plus / Minus

                                                               
Query: 1   cattactcagcgaaagagcagctgagtttgatacgacacgatgccaaacatt 52
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 713 cattactcagcgaaagagcagctgagtttgatacgacacgatgccaaacatt 662



to top

>emb|X89826.1|TAPRO2GEN T.aestivum mRNA for profilin (clone TaPRO2)
          Length = 492

 Score =  511 bits (258), Expect = e-142
 Identities = 302/314 (96%), Gaps = 2/314 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 427 aggtagtcgccgagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 368

                                                                       
Query: 303 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 362
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 367 tagataccaagaatcagggccatgccggtcttcttgatagtaatgccaccggtgcccttc 308

                                                                       
Query: 363 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaagg 422
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 307 tttcctcggatgacaaccccaggttcaccttggatgaccatgtactttgtgcctccaagg 248

                                                                       
Query: 423 aaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccagcaatc 482
           |||||||||||||||||||| ||||| ||||| |||||||| |||| |||||||||||||
Sbjct: 247 aaaagaccagttggtgcaaggtgtccaggttcttcaaagtctttaacgatgccagcaatc 188

                                                                       
Query: 483 tcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgtcgtggc 542
           ||||||||||||||||  ||||||||||||||||| ||||||||||||| ||||||||||
Sbjct: 187 tcctcaggcttgaact-tggggaagttgggggactcggcccagacgctg-ccgtcgtggc 130

                         
Query: 543 cgaggatggcggcg 556
           ||||||||||||||
Sbjct: 129 cgaggatggcggcg 116



to top

>emb|X89825.1|TAPRO1GEN T.aestivum mRNA for profilin (clone TaPRO1)
          Length = 454

 Score =  496 bits (250), Expect = e-137
 Identities = 300/314 (95%), Gaps = 2/314 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 418 aggtaatcgccgagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 359

                                                                       
Query: 303 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 362
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 358 tagataccaagaatcagggccatgccggtcttcttgatagtaatgccaccggtgcccttc 299

                                                                       
Query: 363 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaagg 422
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 298 tttcctcggatgacaaccccaggttcaccttggatgaccatgtactttgtgcctccaagg 239

                                                                       
Query: 423 aaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccagcaatc 482
           |||||||||||||||||||| ||||| ||||| |||||||| |||| |||||||||||||
Sbjct: 238 aaaagaccagttggtgcaaggtgtccaggttcttcaaagtctttaacgatgccagcaatc 179

                                                                       
Query: 483 tcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgtcgtggc 542
           ||||||||||||||||  ||||||||||||||||| || |||||||||| ||||||||||
Sbjct: 178 tcctcaggcttgaact-tggggaagttgggggactcggtccagacgctg-ccgtcgtggc 121

                         
Query: 543 cgaggatggcggcg 556
           ||||||||||||||
Sbjct: 120 cgaggatggcggcg 107



to top

>emb|X89827.1|TAPRO3GEN T.aestivum mRNA for profilin (clone TaPRO3)
          Length = 489

 Score =  492 bits (248), Expect = e-136
 Identities = 310/328 (94%), Gaps = 2/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 229 aaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggag 288
           ||||||| |||| |||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 441 aaccctgatcgatcaggtaatcgccgagcctctccacgaccaaattgcactggccaggag 382

                                                                       
Query: 289 tcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgc 348
           ||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 381 tcatgggttcatcgtagataccaagaatcagggccatgccggtcttcttgatagtgatgc 322

                                                                       
Query: 349 caccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatt 408
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 321 caccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtact 262

                                                                       
Query: 409 ttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaa 468
           |||||||||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||
Sbjct: 261 ttgtgcctccaaggaaaagaccagttggtgcaaggtgtccaggttcttcaaagtctttaa 202

                                                                       
Query: 469 tgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggcccagacg 528
            |||||||||| ||||||| |||||||||| ||||||||||||||||||| |||||||||
Sbjct: 201 cgatgccagcattctcctcgggcttgaact-gggggaagttgggggactgcgcccagacg 143

                                       
Query: 529 ctgcccgtcgtggccgaggatggcggcg 556
           ||| ||||||||||||||||||||||||
Sbjct: 142 ctg-ccgtcgtggccgaggatggcggcg 116



to top

>ref|XM_550652.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 775

 Score =  329 bits (166), Expect = 6e-87
 Identities = 294/334 (88%), Gaps = 2/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
           ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 503 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 444

                                                                       
Query: 283 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 342
           | || ||||| |||||||| ||||| ||||||||||  | || ||| |||||||||| | 
Sbjct: 443 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttgacac 384

                                                                       
Query: 343 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 402
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 383 atatgcctccagtgcccttctttcctcggatgacaacccctggttcaccttggatcacca 324

                                                                       
Query: 403 tgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagt 462
           ||||||||||||| ||||||||||||||||||||||| |||   |||||||| |||||||
Sbjct: 323 tgtattttgtgcccccaaggaaaagaccagttggtgcgagactgccgggttcatcaaagt 264

                                                                       
Query: 463 ccttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggcc 522
           |||| |||||||||| |||||||||||||||| ||| | ||||||||||||||||| |||
Sbjct: 263 ccttcatgatgccagtaatctcctcaggcttgtact-gcgggaagttgggggactgcgcc 205

                                             
Query: 523 cagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| ||||||||||||| ||||||||||
Sbjct: 204 cagacgctg-ccgtcgtggccgacgatggcggcg 172



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                            
Query: 19  cagctgagtttgatacgacacgatgccaaacat 51
           |||||||||||||||||||||||||||||||||
Sbjct: 696 cagctgagtttgatacgacacgatgccaaacat 664



to top

>dbj|AK121519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028A03, full
           insert sequence
          Length = 776

 Score =  329 bits (166), Expect = 6e-87
 Identities = 294/334 (88%), Gaps = 2/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
           ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 504 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 445

                                                                       
Query: 283 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 342
           | || ||||| |||||||| ||||| ||||||||||  | || ||| |||||||||| | 
Sbjct: 444 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttgacac 385

                                                                       
Query: 343 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 402
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 384 atatgcctccagtgcccttctttcctcggatgacaacccctggttcaccttggatcacca 325

                                                                       
Query: 403 tgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagt 462
           ||||||||||||| ||||||||||||||||||||||| |||   |||||||| |||||||
Sbjct: 324 tgtattttgtgcccccaaggaaaagaccagttggtgcgagactgccgggttcatcaaagt 265

                                                                       
Query: 463 ccttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggcc 522
           |||| |||||||||| |||||||||||||||| ||| | ||||||||||||||||| |||
Sbjct: 264 ccttcatgatgccagtaatctcctcaggcttgtact-gcgggaagttgggggactgcgcc 206

                                             
Query: 523 cagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| ||||||||||||| ||||||||||
Sbjct: 205 cagacgctg-ccgtcgtggccgacgatggcggcg 173



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                            
Query: 19  cagctgagtttgatacgacacgatgccaaacat 51
           |||||||||||||||||||||||||||||||||
Sbjct: 697 cagctgagtttgatacgacacgatgccaaacat 665



to top

>dbj|AK058798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H10, full
           insert sequence
          Length = 775

 Score =  329 bits (166), Expect = 6e-87
 Identities = 294/334 (88%), Gaps = 2/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
           ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 503 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 444

                                                                       
Query: 283 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 342
           | || ||||| |||||||| ||||| ||||||||||  | || ||| |||||||||| | 
Sbjct: 443 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttgacac 384

                                                                       
Query: 343 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 402
             ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 383 atatgcctccagtgcccttctttcctcggatgacaacccctggttcaccttggatcacca 324

                                                                       
Query: 403 tgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagt 462
           ||||||||||||| ||||||||||||||||||||||| |||   |||||||| |||||||
Sbjct: 323 tgtattttgtgcccccaaggaaaagaccagttggtgcgagactgccgggttcatcaaagt 264

                                                                       
Query: 463 ccttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggcc 522
           |||| |||||||||| |||||||||||||||| ||| | ||||||||||||||||| |||
Sbjct: 263 ccttcatgatgccagtaatctcctcaggcttgtact-gcgggaagttgggggactgcgcc 205

                                             
Query: 523 cagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| ||||||||||||| ||||||||||
Sbjct: 204 cagacgctg-ccgtcgtggccgacgatggcggcg 172



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                            
Query: 19  cagctgagtttgatacgacacgatgccaaacat 51
           |||||||||||||||||||||||||||||||||
Sbjct: 696 cagctgagtttgatacgacacgatgccaaacat 664



to top

>gb|AF201459.1|AF201459 Zea mays profilin 5 (PRO5) mRNA, complete cds
          Length = 703

 Score =  297 bits (150), Expect = 2e-77
 Identities = 290/334 (86%), Gaps = 2/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
           ||||||| ||||| |||| |||||| ||||| ||||||||||| |||| |||||| || |
Sbjct: 475 cttagaagccctgttcgatcaggtaatcgccgagcctctccaccaccatattgcattgcc 416

                                                                       
Query: 283 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 342
           | |||||||| |||||||| |||||||| | ||||| || |||||| || ||||||||||
Sbjct: 415 ctggagtcattggctcatcatagataccgataatcaaggacatgccagttttcttgatag 356

                                                                       
Query: 343 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 402
           ||||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 355 taatgcctccagtgcccttctttcctcggatgacaactccaggttcaccttggatcacca 296

                                                                       
Query: 403 tgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagt 462
           |||| || || |||||||  |||||||||||||||||||||  ||| ||||| |||||||
Sbjct: 295 tgtacttcgtacctccaacaaaaagaccagttggtgcaagagttccaggttcatcaaagt 236

                                                                       
Query: 463 ccttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggcc 522
           |||| || || ||||||| |||||||||||| ||||  |||||||||   |||||| |||
Sbjct: 235 cctttatcatcccagcaacctcctcaggctttaact-cggggaagttctcggactgtgcc 177

                                             
Query: 523 cagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| ||||||||||||| ||||||||||
Sbjct: 176 cagacgctg-ccgtcgtggccgacgatggcggcg 144



to top

>gb|BT018328.1| Zea mays clone EL01T0208F04.c mRNA sequence
          Length = 958

 Score =  289 bits (146), Expect = 5e-75
 Identities = 289/334 (86%), Gaps = 2/334 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
           ||||||| ||||| |||| |||||| ||||| ||||||||||| |||| |||||| || |
Sbjct: 419 cttagaagccctgttcgatcaggtaatcgccgagcctctccaccaccatattgcattgcc 360

                                                                       
Query: 283 caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatag 342
           | |||||||| |||||||| |||||||| | ||||| || |||||| || ||||||||||
Sbjct: 359 ctggagtcattggctcatcatagataccgataatcaaggacatgccagttttcttgatag 300

                                                                       
Query: 343 taatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgacca 402
           ||||||| || |||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 299 taatgcctccagtgcccttctttcctcggatgacaactccaggttcaccttggatcacca 240

                                                                       
Query: 403 tgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagt 462
           |||| || || |||||||  |||||||||||||||||||||  ||| ||||| || ||||
Sbjct: 239 tgtacttcgtacctccaacaaaaagaccagttggtgcaagagttccaggttcatcgaagt 180

                                                                       
Query: 463 ccttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggcc 522
           |||| || || ||||||| |||||||||||| ||||  |||||||||   |||||| |||
Sbjct: 179 cctttatcatcccagcaacctcctcaggctttaact-cggggaagttctcggactgtgcc 121

                                             
Query: 523 cagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| ||||||||||||| ||||||||||
Sbjct: 120 cagacgctg-ccgtcgtggccgacgatggcggcg 88



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 1   cattactcagcgaaagagcagctgagtt 28
           |||||||||| |||| ||||||||||||
Sbjct: 862 cattactcagggaaacagcagctgagtt 835



to top

>gb|AY103599.1| Zea mays PCO094927 mRNA sequence
          Length = 883

 Score =  287 bits (145), Expect = 2e-74
 Identities = 288/333 (86%), Gaps = 2/333 (0%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
           |||||| |||||||||| |||||| ||||| ||||||||||| ||||  ||||| || ||
Sbjct: 530 ttagaagccctgctcgatcaggtaatcgccgagcctctccaccaccatgttgcattgccc 471

                                                                       
Query: 284 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
            |||||||| ||||| ||||||| ||||| ||||| || |||||| || |||||||||||
Sbjct: 470 tggagtcattggctcgtcgtagacaccaataatcaaggacatgccggttttcttgatagt 411

                                                                       
Query: 344 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 403
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 410 aatgcccccagtgcccttctttcctcggatgacaactccaggttcaccttggatcaccat 351

                                                                       
Query: 404 gtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtc 463
           ||| ||||| ||||||| ||||||||||||||||||||||   || ||||| ||||||||
Sbjct: 350 gtactttgtacctccaacgaaaagaccagttggtgcaagagtaccaggttcatcaaagtc 291

                                                                       
Query: 464 cttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggccc 523
           ||| ||||| ||||||| |||||||||||| ||||  ||||||| |   |||||| ||||
Sbjct: 290 ctttatgataccagcaacctcctcaggctttaact-cggggaagctctcggactgcgccc 232

                                            
Query: 524 agacgctgcccgtcgtggccgaggatggcggcg 556
           | |||||| |||||||| |||| ||||||||||
Sbjct: 231 aaacgctg-ccgtcgtgaccgacgatggcggcg 200



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 45/48 (93%), Gaps = 1/48 (2%)
 Strand = Plus / Minus

                                                           
Query: 1   cattactcagcgaaagagcagctgagttt-gatacgacacgatgccaa 47
           ||||||||||||||| ||||||||||||| |||||||| |||||||||
Sbjct: 749 cattactcagcgaaacagcagctgagtttcgatacgacgcgatgccaa 702



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 109 cccaagctagattattcactgcat 132
           ||||||||| ||||||||||||||
Sbjct: 651 cccaagctaaattattcactgcat 628



to top

>gb|AF032370.1|AF032370 Zea mays profilin (PRO4) mRNA, complete cds
          Length = 798

 Score =  287 bits (145), Expect = 2e-74
 Identities = 288/333 (86%), Gaps = 2/333 (0%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
           |||||| |||||||||| |||||| ||||| ||||||||||| ||||  ||||| || ||
Sbjct: 478 ttagaagccctgctcgatcaggtaatcgccgagcctctccaccaccatgttgcattgccc 419

                                                                       
Query: 284 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
            |||||||| ||||| ||||||| ||||| ||||| || |||||| || |||||||||||
Sbjct: 418 tggagtcattggctcgtcgtagacaccaataatcaaggacatgccggttttcttgatagt 359

                                                                       
Query: 344 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 403
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 358 aatgcccccagtgcccttctttcctcggatgacaactccaggttcaccttggatcaccat 299

                                                                       
Query: 404 gtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtc 463
           ||| ||||| ||||||| ||||||||||||||||||||||   || ||||| ||||||||
Sbjct: 298 gtactttgtacctccaacgaaaagaccagttggtgcaagagtaccaggttcatcaaagtc 239

                                                                       
Query: 464 cttaatgatgccagcaatctcctcaggcttgaactggggggaagttgggggactgggccc 523
           ||| ||||| ||||||| |||||||||||| ||||  ||||||| |   |||||| ||||
Sbjct: 238 ctttatgataccagcaacctcctcaggctttaact-cggggaagctctcggactgcgccc 180

                                            
Query: 524 agacgctgcccgtcgtggccgaggatggcggcg 556
           | |||||| |||||||| |||| ||||||||||
Sbjct: 179 aaacgctg-ccgtcgtgaccgacgatggcggcg 148



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 45/48 (93%), Gaps = 1/48 (2%)
 Strand = Plus / Minus

                                                           
Query: 1   cattactcagcgaaagagcagctgagttt-gatacgacacgatgccaa 47
           ||||||||||||||| ||||||||||||| |||||||| |||||||||
Sbjct: 697 cattactcagcgaaacagcagctgagtttcgatacgacgcgatgccaa 650



 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 109 cccaagctagattattcactgcat 132
           ||||||||| ||||||||||||||
Sbjct: 599 cccaagctaaattattcactgcat 576



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  194 bits (98), Expect = 2e-46
 Identities = 131/142 (92%)
 Strand = Plus / Minus

                                                                           
Query: 358     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
               ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 2690735 ccttctttcctcggatgacaacccctggttcaccttggatcaccatgtattttgtgcccc 2690676

                                                                           
Query: 418     caaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccag 477
               |||||||||||||||||||||| |||   |||||||| ||||||||||| ||||||||||
Sbjct: 2690675 caaggaaaagaccagttggtgcgagactgccgggttcatcaaagtccttcatgatgccag 2690616

                                     
Query: 478     caatctcctcaggcttgaactg 499
                |||||||||||||||| ||||
Sbjct: 2690615 taatctcctcaggcttgtactg 2690594



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                           
Query: 223     cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
               ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 2691751 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 2691692

                                                                        
Query: 283     caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttga 339
               | || ||||| |||||||| ||||| ||||||||||  | || ||| ||||||||||
Sbjct: 2691691 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttga 2691635



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 52/55 (94%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                      
Query: 502     gggaagttgggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
               ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||
Sbjct: 2689435 gggaagttgggggactgcgcccagacgctg-ccgtcgtggccgacgatggcggcg 2689382



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                                
Query: 19      cagctgagtttgatacgacacgatgccaaacat 51
               |||||||||||||||||||||||||||||||||
Sbjct: 2691944 cagctgagtttgatacgacacgatgccaaacat 2691912



to top

>dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0710H01
          Length = 187107

 Score =  194 bits (98), Expect = 2e-46
 Identities = 131/142 (92%)
 Strand = Plus / Minus

                                                                          
Query: 358    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
              ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 146076 ccttctttcctcggatgacaacccctggttcaccttggatcaccatgtattttgtgcccc 146017

                                                                          
Query: 418    caaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccag 477
              |||||||||||||||||||||| |||   |||||||| ||||||||||| ||||||||||
Sbjct: 146016 caaggaaaagaccagttggtgcgagactgccgggttcatcaaagtccttcatgatgccag 145957

                                    
Query: 478    caatctcctcaggcttgaactg 499
               |||||||||||||||| ||||
Sbjct: 145956 taatctcctcaggcttgtactg 145935



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                          
Query: 223    cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
              ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 147092 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 147033

                                                                       
Query: 283    caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttga 339
              | || ||||| |||||||| ||||| ||||||||||  | || ||| ||||||||||
Sbjct: 147032 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttga 146976



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 52/55 (94%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                     
Query: 502    gggaagttgggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
              ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||
Sbjct: 144776 gggaagttgggggactgcgcccagacgctg-ccgtcgtggccgacgatggcggcg 144723



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                               
Query: 19     cagctgagtttgatacgacacgatgccaaacat 51
              |||||||||||||||||||||||||||||||||
Sbjct: 147285 cagctgagtttgatacgacacgatgccaaacat 147253



to top

>dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0529C07
          Length = 174011

 Score =  194 bits (98), Expect = 2e-46
 Identities = 131/142 (92%)
 Strand = Plus / Minus

                                                                          
Query: 358    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
              ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
Sbjct: 102482 ccttctttcctcggatgacaacccctggttcaccttggatcaccatgtattttgtgcccc 102423

                                                                          
Query: 418    caaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccag 477
              |||||||||||||||||||||| |||   |||||||| ||||||||||| ||||||||||
Sbjct: 102422 caaggaaaagaccagttggtgcgagactgccgggttcatcaaagtccttcatgatgccag 102363

                                    
Query: 478    caatctcctcaggcttgaactg 499
               |||||||||||||||| ||||
Sbjct: 102362 taatctcctcaggcttgtactg 102341



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                          
Query: 223    cttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggc 282
              ||||| |||||||||||| ||| || ||||||||||||||||| | ||  ||||||||||
Sbjct: 103498 cttagcaaccctgctcgatcagataatcgccaagcctctccacaatcatgttgcactggc 103439

                                                                       
Query: 283    caggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttga 339
              | || ||||| |||||||| ||||| ||||||||||  | || ||| ||||||||||
Sbjct: 103438 ctggggtcatcggctcatcatagattccaagaatcaacgacaggccagtcttcttga 103382



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 52/55 (94%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                     
Query: 502    gggaagttgggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
              ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||
Sbjct: 101182 gggaagttgggggactgcgcccagacgctg-ccgtcgtggccgacgatggcggcg 101129



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                               
Query: 19     cagctgagtttgatacgacacgatgccaaacat 51
              |||||||||||||||||||||||||||||||||
Sbjct: 103691 cagctgagtttgatacgacacgatgccaaacat 103659



to top

>emb|X73279.1|ZMPRO1MR Z.mays ZmPRO1 mRNA for profilin 1
          Length = 1048

 Score =  115 bits (58), Expect = 2e-22
 Identities = 222/274 (81%), Gaps = 2/274 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           ||||| |||| |||||||||||| ||||| ||||| ||||  |||||||| || ||||||
Sbjct: 516 ccctgttcgagcaggtagtcgcccagcctttccaccaccaggttgcactgcccgggagtc 457

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgccc-gtcttcttgatagtaatgcc 349
           || ||||| |||||||| ||||  || || | | ||||| || ||||| | ||| |||||
Sbjct: 456 atcggctcgtcgtagatgccaatgatgagtgac-tgccctgttttcttcacagtgatgcc 398

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
            ||||  |||||||| || ||||||||| | |||||||| ||||||||||||||||| ||
Sbjct: 397 cccggatcccttcttgccacggatgacagctccaggttcgccttggatgaccatgtactt 338

                                                                       
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaat 469
            |||||||| ||||  || || || || || || || || || ||||| || ||||| ||
Sbjct: 337 ggtgcctcccaggatcaggccggtcggggcgaggtgccccggctcgtcgaaatccttcat 278

                                             
Query: 470 gatgccagcaatctcctcaggcttgaactggggg 503
           |||| |||| |||||||| |||||||||| ||||
Sbjct: 277 gatggcagccatctcctcgggcttgaactcgggg 244



to top

>gb|AY109559.1| Zea mays CL2097_1 mRNA sequence
          Length = 983

 Score =  115 bits (58), Expect = 2e-22
 Identities = 222/274 (81%), Gaps = 2/274 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           ||||| |||| |||||||||||| ||||| ||||| ||||  |||||||| || ||||||
Sbjct: 513 ccctgttcgagcaggtagtcgcccagcctttccaccaccaggttgcactgcccgggagtc 454

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgccc-gtcttcttgatagtaatgcc 349
           || ||||| |||||||| ||||  || || | | ||||| || ||||| | ||| |||||
Sbjct: 453 atcggctcgtcgtagatgccaatgatgagtgac-tgccctgttttcttcacagtgatgcc 395

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
            ||||  |||||||| || ||||||||| | |||||||| ||||||||||||||||| ||
Sbjct: 394 tccggatcccttcttgccacggatgacagctccaggttcgccttggatgaccatgtactt 335

                                                                       
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaat 469
            |||||||| ||||  || || || || || || || || || ||||| || ||||| ||
Sbjct: 334 ggtgcctcccaggatcaggccggtcggggcgaggtgccccggctcgtcgaaatccttcat 275

                                             
Query: 470 gatgccagcaatctcctcaggcttgaactggggg 503
           |||| |||| |||||||| |||||||||| ||||
Sbjct: 274 gatggcagccatctcctcgggcttgaactcgggg 241



to top

>emb|Y09457.1|PPPROFIL3 P.pratense mRNA for profilin 3
          Length = 396

 Score =  105 bits (53), Expect = 2e-19
 Identities = 139/165 (84%), Gaps = 2/165 (1%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||||||||||||||||||||| ||||  |||||||| ||||| |||||||||||||||
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcatcg 318

                                                                       
Query: 303 tagataccaagaatcagggccatgccc-gtcttcttgatagtaatgccaccggtgccctt 361
           ||||| || | || ||| ||| ||||| |||||||| || || ||||| || |  |||||
Sbjct: 317 tagatgccgacaaccagcgcc-tgccctgtcttctttatggtgatgcctcctgctccctt 259

                                                        
Query: 362 ctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
           ||| || ||||||||  | || |||||||| ||||||||||||||
Sbjct: 258 cttgccacggatgaccgcgccgggttcaccctggatgaccatgta 214



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 86/100 (86%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 453 tcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagttggg 512
           ||||| || ||||| |||||||| |  ||||||||||||||||||| ||||||||| || 
Sbjct: 167 tcgtccaaatccttcatgatgccggtgatctcctcaggcttgaact-gggggaagtcggc 109

                                                   
Query: 513 ggactgggcccagacgctgcccgtcgtggccgaggatggc 552
           |  ||||||||||||| || ||||||||||||| ||||||
Sbjct: 108 gctctgggcccagacggtg-ccgtcgtggccgaagatggc 70



to top

>emb|AJ565931.1|CME565931 Cucumis melo mRNA for profilin (cuc m 2 gene)
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 172/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 331

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 271

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 211

                                            
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||| | ||||||||| |||||
Sbjct: 210 tgtcccaccaaggaataaaccagttggggcaag 178



to top

>emb|AJ507459.1|MDO507459 Malus x domestica mRNA for apple allergen profilin (pf-3 gene),
           clone 3
          Length = 683

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 163/201 (81%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
           ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 396 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 337

                                                                       
Query: 284 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
           ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 336 aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 277

                                                                       
Query: 344 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 403
           ||| || || | ||||||||||||||| |||||| | || |||||||| ||||| |||||
Sbjct: 276 aattccgcccgagcccttctttcctcgaatgacagcgccgggttcaccctggatcaccat 217

                                
Query: 404 gtattttgtgcctccaaggaa 424
            || || || || ||||||||
Sbjct: 216 atacttcgtcccaccaaggaa 196



to top

>emb|AJ491881.1|PPE491881 Prunus persica mRNA for profilin, allergen Pru p 4.01
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 172/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 331

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 271

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 211

                                            
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||| | ||||||||| |||||
Sbjct: 210 tgtcccaccaaggaataaaccagttggggcaag 178



to top

>gb|AF129425.1|AF129425 Prunus avium profilin mRNA, complete cds
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 172/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcaacaatcatgttgcactgccctggagt 331

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 271

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| |||||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatattt 211

                                            
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||| |  |||||||| |||||
Sbjct: 210 tgtcccaccaaggaataacccagttggggcaag 178



to top

>gb|AF377949.1|AF377949 Ananas comosus profilin mRNA, complete cds
          Length = 396

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 77/87 (88%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           |||||||||||||| ||||||||||| || || ||||||||||||||||||||||| || 
Sbjct: 263 cccttctttcctcgaatgacaacccctggctctccttggatgaccatgtattttgtaccg 204

                                      
Query: 417 ccaaggaaaagaccagttggtgcaaga 443
           |||||| | | ||||||||| ||||||
Sbjct: 203 ccaaggtataaaccagttggagcaaga 177



to top

>gb|AF129427.1|AF129427 Malus domestica GD4-2 profilin mRNA, complete cds
          Length = 396

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 139/170 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcgtagatacca 311
           ||||||||||| || ||||  ||||| |||||||||||||| |||||||| || || |||
Sbjct: 368 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctcatcataaatccca 309

                                                                       
Query: 312 agaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcgg 371
           |  | ||  |||||     ||||||||| |||||  ||||| | ||||||||||||||| 
Sbjct: 308 atcagcaaagccattgtgctcttcttgacagtaacaccacctgggcccttctttcctcga 249

                                                             
Query: 372 atgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaag 421
           || ||||| || |||||||| ||||||||||||||||| || ||||||||
Sbjct: 248 atcacaactcctggttcaccctggatgaccatgtatttggtccctccaag 199



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||| |||| |||||||| ||||||||||
Sbjct: 105 ctgggcccagacgctg-ccgttgtggccgatgatggcggcg 66



to top

>emb|Y09458.1|PPPROFIL4 P.pratense mRNA for profilin 4
          Length = 396

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 137/165 (83%), Gaps = 2/165 (1%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||||||||||||||||||||| ||||  |||||||| ||||| ||||||||||| |||
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcgtcg 318

                                                                       
Query: 303 tagataccaagaatcagggccatgccc-gtcttcttgatagtaatgccaccggtgccctt 361
           ||||| || |  | ||| ||| ||||| |||||||| || || ||||| || |  |||||
Sbjct: 317 tagatgccgacgaccagcgcc-tgcccggtcttctttatggtgatgcctcctgctccctt 259

                                                        
Query: 362 ctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
           ||| || ||||||||  | || |||||||| ||||||||||||||
Sbjct: 258 cttgccacggatgaccgcgccgggttcaccctggatgaccatgta 214



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 87/100 (87%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 453 tcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagttggg 512
           ||||| || ||||| |||||||| |  ||||||||||||||||||| ||||||||| || 
Sbjct: 167 tcgtcgaaatccttcatgatgccggtgatctcctcaggcttgaact-gggggaagtcggc 109

                                                   
Query: 513 ggactgggcccagacgctgcccgtcgtggccgaggatggc 552
           |  ||||||||||||| || ||||||||||||||||||||
Sbjct: 108 gctctgggcccagacggtg-ccgtcgtggccgaggatggc 70



to top

>emb|AJ132397.1|HBR132397 Hevea brasiliensis mRNA for hevea brasiliensis profilin (Hev b 8)
          Length = 396

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 248/313 (79%), Gaps = 2/313 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||||||||||||||| || || | ||  |||||||| || |||||||| |||||||||
Sbjct: 377 aggtagtcgccaagcctttcaacaatcatgttgcactgccctggagtcattggctcatcg 318

                                                                       
Query: 303 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 362
           ||||||||||  || | ||||      |||||||| | |||||  ||||| | |||||||
Sbjct: 317 tagataccaattattaaggcctgattagtcttcttaacagtaacaccaccagggcccttc 258

                                                                       
Query: 363 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaagg 422
           || || || |||||| | || || || |||||||| ||||||||||||||||| |||| |
Sbjct: 257 ttcccccgaatgacagctcctggctcgccttggatcaccatgtattttgtgccaccaatg 198

                                                                       
Query: 423 aaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccagcaatc 482
            | |  |||||||| |||||   ||| ||||||| ||| ||  | || |||||||  || 
Sbjct: 197 tacaatccagttggagcaagcgttccaggttcgtgaaaatcactcataatgccagtgatt 138

                                                                       
Query: 483 tcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgtcgtggc 542
           || |||| |||||||| | |||||||||| |  ||||||||| |||||| ||||| ||||
Sbjct: 137 tcttcagacttgaact-gagggaagttggcgctctgggcccaaacgctg-ccgtcttggc 80

                        
Query: 543 cgaggatggcggc 555
           ||| |||||||||
Sbjct: 79  cgatgatggcggc 67



to top

>emb|AJ865015.1| Citrus sinensis mRNA for profilin allergen Cit s 2.0102 (cit s
           2.0102 gene)
          Length = 396

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 171/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 390 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 331

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||  |||||||| || |||||||  || ||||||      |||||||| | | |||||||
Sbjct: 330 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacaataatgcc 271

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 270 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 211

                                            
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||| | ||||||||| |||||
Sbjct: 210 tgtcccaccaaggaataaaccagttggggcaag 178



to top

>gb|DQ400579.1| Mangifera indica profilin 2 mRNA, complete cds
          Length = 660

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 226/281 (80%), Gaps = 4/281 (1%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 332
           |||||||| ||||||||||| |||||||| ||||||||||  |  | ||||||||  |||
Sbjct: 347 ttgcactgtccaggagtcattggctcatcatagataccaatgacaaaggccatgctggtc 288

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           || |||| |||||  ||||| |  |||||||||||||| |||||| | || || || |||
Sbjct: 287 tttttgacagtaacaccaccaggtcccttctttcctcgaatgacagctcctggctcccct 228

                                                                       
Query: 393 tggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgt-ccggg 451
           ||||| ||||| || || || || |||||  | || |||||||||||||| ||| || ||
Sbjct: 227 tggatcaccatatacttcgtaccaccaagatatagtccagttggtgcaag-tgtaccagg 169

                                                                       
Query: 452 ttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagttgg 511
           ||| |  ||||| ||| ||||||||| ||  || |||||||| |||| | ||||||||||
Sbjct: 168 ttcattgaagtcattattgatgccagtaacttcttcaggcttcaact-gagggaagttgg 110

                                                    
Query: 512 gggactgggcccagacgctgcccgtcgtggccgaggatggc 552
            |  ||||||||  |||||| ||||| ||||||||||||||
Sbjct: 109 cgctctgggcccgaacgctg-ccgtcctggccgaggatggc 70



to top

>gb|AY081850.1| Prunus dulcis profilin (pru du 4.1) mRNA, complete cds
          Length = 924

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 171/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 526 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 467

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 466 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 407

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 406 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 347

                                            
Query: 410 tgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||| |  |||||||| |||||
Sbjct: 346 tgtcccaccaaggaataacccagttggggcaag 314



to top

>gb|AF129428.1|AF129428 Malus domestica GD4-5 profilin mRNA, complete cds
          Length = 396

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 162/201 (80%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
           ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 396 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 337

                                                                       
Query: 284 aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
           ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 336 aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 277

                                                                       
Query: 344 aatgccaccggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccat 403
           ||| || || |  |||||||||||||| |||||| | || |||||||| ||||| |||||
Sbjct: 276 aattccgcccgaacccttctttcctcgaatgacagcgccgggttcaccctggatcaccat 217

                                
Query: 404 gtattttgtgcctccaaggaa 424
            || || || || ||||||||
Sbjct: 216 atacttcgtcccaccaaggaa 196



to top

>gb|AY049013.1| Litchi chinensis profilin mRNA, complete cds
          Length = 396

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 163/200 (81%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||| ||||| ||||||||| | ||||| ||||| ||||| |||||||| |||||||| 
Sbjct: 263 cccttttttccacggatgacagctccaggctcaccctggataaccatgtactttgtgcca 204

                                                                       
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgcca 476
           || |||   |  |||||||| |||||    || ||||| || ||||| || |||||  | 
Sbjct: 203 ccgaggtgcaacccagttggggcaagggaaccaggttcatcgaagtctttcatgatcgct 144

                                                                       
Query: 477 gcaatctcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgt 536
           ||||||||  ||||||||||||| ||| ||||||| |  |||||||||||||||| ||||
Sbjct: 143 gcaatctcagcaggcttgaactgaggg-aagttggcgctctgggcccagacgctg-ccgt 86

                               
Query: 537 cgtggccgaggatggcggcg 556
           ||||||||| ||||||||||
Sbjct: 85  cgtggccgatgatggcggcg 66



to top

>gb|AF200184.1|AF200184 Lilium longiflorum profilin 1 mRNA, complete cds
          Length = 752

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||| ||||| ||||||||||| | ||||||||||||||  |||||||| || |||||
Sbjct: 438 accctgatcgacaaggtagtcgcccatcctctccacgaccatgttgcactgccctggagt 379

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||| || || ||||||||||| | ||| || |||  ||| |||||||| ||||| |  ||
Sbjct: 378 catcggttcctcgtagataccgaaaataagagcctggcctgtcttcttaatagtcacacc 319

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| |  ||||||||||| ||||| ||| | ||||| || ||||| || ||||| |||||
Sbjct: 318 accagatcccttctttccacggataacagctccaggctctccttgaatcaccatatattt 259



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 480 atctcctcaggcttgaactgggg 502
           |||||||||||||||||||||||
Sbjct: 188 atctcctcaggcttgaactgggg 166



to top

>emb|AJ507458.1|MDO507458 Malus x domestica mRNA for apple allergen profilin (pf-2 gene),
           clone 2
          Length = 593

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 79/91 (86%)
 Strand = Plus / Minus

                                                                       
Query: 331 tcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcac 390
           ||||||||| |||||  ||||| | ||||||||||||||| || ||||| || |||||||
Sbjct: 289 tcttcttgacagtaacaccaccagggcccttctttcctcgaatcacaactcctggttcac 230

                                          
Query: 391 cttggatgaccatgtattttgtgcctccaag 421
           | ||||||||||||||||| || ||||||||
Sbjct: 229 cctggatgaccatgtatttggtccctccaag 199



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 39/41 (95%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 105 ctgggcccagacgctgcc-gtcgtggccgatgatggcggcg 66



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 252 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatc 301
           ||||||||||| || ||||  ||||| |||||||||||||| ||||||||
Sbjct: 368 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctcatc 319



to top

>gb|AY081852.1| Prunus dulcis profilin (pru du 4.2) mRNA, complete cds
          Length = 742

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 157/195 (80%)
 Strand = Plus / Minus

                                                                       
Query: 230 accctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagt 289
           |||||||||||  ||||| ||||||||||| || || | ||  |||||||| || |||||
Sbjct: 404 accctgctcgataaggtaatcgccaagcctttcgacaatcatgttgcactgccctggagt 345

                                                                       
Query: 290 catgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgcc 349
           ||  |||||||| || |||||||  || ||||||      |||||||| | |||||||||
Sbjct: 344 caaaggctcatcatatataccaatgatgagggcctgattggtcttcttaacagtaatgcc 285

                                                                       
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattt 409
           ||| | ||||||||||||||| |||||| | || | |||||||||||| ||||| || ||
Sbjct: 284 accagagcccttctttcctcgaatgacagcaccggcttcaccttggatcaccatatactt 225

                          
Query: 410 tgtgcctccaaggaa 424
           ||| || ||||||||
Sbjct: 224 tgtcccaccaaggaa 210



to top

>emb|X93465.1|NTPRO2MR N.tabacum mRNA for profilin (clone NTPRO2)
          Length = 713

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 156/194 (80%)
 Strand = Plus / Minus

                                                                       
Query: 267 accaaattgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatg 326
           |||| ||||||||| || |||||||  || || || |||||||||| |||||| |||  |
Sbjct: 415 accatattgcactgtcctggagtcactggttcctcatagataccaaaaatcagagcctgg 356

                                                                       
Query: 327 cccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggt 386
              || |||||||| || || ||||| |  |||||||| || || |||||| | ||||||
Sbjct: 355 ttagttttcttgatggttattccaccagatcccttcttcccacgaatgacagcgccaggt 296

                                                                       
Query: 387 tcaccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgt 446
           || |||||||| |||||||||||||  || |||||||| | ||||||||| || ||||||
Sbjct: 295 tctccttggattaccatgtattttgccccgccaaggaataaaccagttggagctagatgt 236

                         
Query: 447 ccgggttcgtcaaa 460
           || ||||| |||||
Sbjct: 235 ccaggttcatcaaa 222



to top

>emb|X82120.1|NTPROFLN N.tabacum mRNA for profilin
          Length = 653

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           |||||||| || ||||||||| | |||||||| |||||||| |||||||||||||  || 
Sbjct: 309 cccttcttcccacggatgacagcgccaggttctccttggattaccatgtattttgccccg 250

                                                 
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttc 454
           |||||||| | ||||||||| || |||||||| |||||
Sbjct: 249 ccaaggaataaaccagttggagctagatgtccaggttc 212



to top

>emb|Y09456.1|PPPROFIL2 P.pratense mRNA for profilin 2
          Length = 396

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 136/165 (82%), Gaps = 2/165 (1%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||||||||||||||||||||| ||||  |||||||| ||||| ||||||||||| || 
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcgtca 318

                                                                       
Query: 303 tagataccaagaatcagggccatgccc-gtcttcttgatagtaatgccaccggtgccctt 361
           ||||| || |  | ||| ||| ||||| |||||||| || || ||||| || |  |||||
Sbjct: 317 tagatgccgacgaccagcgcc-tgcccggtcttctttatggtgatgcctcctgctccctt 259

                                                        
Query: 362 ctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
           ||| || ||||||||  | || |||||||| ||||||||||||||
Sbjct: 258 cttgccacggatgaccgcgccgggttcaccctggatgaccatgta 214



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 87/100 (87%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 453 tcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagttggg 512
           ||||| || ||||| |||||||| |  ||||||||||||||||||| ||||||||| || 
Sbjct: 167 tcgtcgaaatccttcatgatgccggtgatctcctcaggcttgaact-gggggaagtcggc 109

                                                   
Query: 513 ggactgggcccagacgctgcccgtcgtggccgaggatggc 552
           |  ||||||||||||| || ||||||||||||||||||||
Sbjct: 108 gctctgggcccagacggtg-ccgtcgtggccgaggatggc 70



to top

>gb|U50195.1|SLU50195 Solanum lycopersicum profilin (LePro1) mRNA, complete cds
          Length = 610

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||| ||||| || ||||| |  ||||| || || ||||| ||| | |||||||| 
Sbjct: 296 gtcttcttaatagttattccaccaggaccctttttcccgcggataacagcaccaggttct 237

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           ||||| ||||||||||||||||| ||  ||||||| ||||||||||| || |||||||| 
Sbjct: 236 ccttgaatgaccatgtattttgtacccgcaaggaatagaccagttggagctagatgtcca 177

                
Query: 450 ggttc 454
           |||||
Sbjct: 176 ggttc 172



to top

>emb|X77583.1|PPPROPXI P.pratense mRNA for profilin-Phl p XI
          Length = 396

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 87/100 (87%), Gaps = 2/100 (2%)
 Strand = Plus / Minus

                                                                       
Query: 453 tcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagttggg 512
           ||||| || ||||| |||||||| |  ||||||||||||||||||| ||||||||| || 
Sbjct: 167 tcgtcgaaatccttcatgatgccggtgatctcctcaggcttgaact-gggggaagtcggc 109

                                                   
Query: 513 ggactgggcccagacgctgcccgtcgtggccgaggatggc 552
           |  ||||||||||||| || ||||||||||||||||||||
Sbjct: 108 gctctgggcccagacggtg-ccgtcgtggccgaggatggc 70



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||||||||||||||||||||| ||||  |||||||| ||||| ||||||||||| || 
Sbjct: 377 aggtagtcgccaagcctctccaccaccatgttgcactgcccaggggtcatgggctcgtca 318

                
Query: 303 tagat 307
           |||||
Sbjct: 317 tagat 313



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                           
Query: 226     agaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccag 285
               |||||||||| || || ||||| ||||||||||||||||| ||||  |||||||||||||
Sbjct: 4868241 agaaaccctgttcaacaaggtaatcgccaagcctctccacaaccatgttgcactggccag 4868300

                      
Query: 286     gagtcat 292
               |||||||
Sbjct: 4868301 gagtcat 4868307



to top

>dbj|AP002743.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0710E05
          Length = 179714

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                          
Query: 226    agaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccag 285
              |||||||||| || || ||||| ||||||||||||||||| ||||  |||||||||||||
Sbjct: 112890 agaaaccctgttcaacaaggtaatcgccaagcctctccacaaccatgttgcactggccag 112949

                     
Query: 286    gagtcat 292
              |||||||
Sbjct: 112950 gagtcat 112956



to top

>ref|NM_195688.1| Oryza sativa (japonica cultivar-group) Profilin A
           (OSJNBa0065C16.11), mRNA
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 389 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 330

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 349
           |||||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 329 atgggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcactgtgatgcc 271

                                                                    
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 270 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 214



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 101 gcccagacggtgcc-gtcgtggccgacgatggcggcg 66



to top

>ref|NM_195685.1| Oryza sativa (japonica cultivar-group) Profilin A
           (OSJNBa0065C16.14), mRNA
          Length = 396

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 389 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 330

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 349
           || ||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 329 atcggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcaccgtgatgcc 271

                                                                    
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 270 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 214



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 101 gcccagacggtgcc-gtcgtggccgacgatggcggcg 66



to top

>gb|AY268424.1| Humulus scandens profilin-like protein (LCM9) mRNA, complete cds
          Length = 633

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||||| ||| ||| | || ||||| |||||||| ||||| ||||||||||| 
Sbjct: 263 cccttctttcctctgataacagcacctggttccccttggatcaccatatattttgtgcca 204

                                                                       
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgcca 476
           |||||  | |  ||||||||||||||   ||| ||||||| |||||| || |||||||||
Sbjct: 203 ccaagatacaagccagttggtgcaagtgttccaggttcgttaaagtcattcatgatgcca 144

            
Query: 477 g 477
           |
Sbjct: 143 g 143



to top

>emb|AJ130969.1|NTA130969 Nicotiana tabacum pronp1 gene, exons 1-3
          Length = 3797

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 358  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
            ||||||| || ||||||||| | |||||||| |||||||| ||||||||||| |  || |
Sbjct: 1775 ccttcttcccacggatgacagcgccaggttctccttggattaccatgtatttcgccccgc 1716

                                                 
Query: 418  caaggaaaagaccagttggtgcaagatgtccgggttc 454
            ||||||| | ||||||||| || |||||||| |||||
Sbjct: 1715 caaggaataaaccagttggagctagatgtccaggttc 1679



to top

>gb|AF310253.1|AF310253 Oryza sativa profilin A mRNA, complete cds
          Length = 812

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 506 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 447

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 349
           || ||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 446 atcggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcaccgtgatgcc 388

                                                                    
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 387 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 331



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 218 gcccagacggtgcc-gtcgtggccgacgatggcggcg 183



to top

>dbj|AK121412.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132P11, full
           insert sequence
          Length = 880

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 493 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 434

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 349
           |||||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 433 atgggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcactgtgatgcc 375

                                                                    
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 374 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 318



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 205 gcccagacggtgcc-gtcgtggccgacgatggcggcg 170



to top

>dbj|AK100089.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003I11, full
           insert sequence
          Length = 830

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 486 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 427

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgcccg-tcttcttgatagtaatgcc 349
           |||||||| |||||||| || |  | ||| ||| |||||| ||||||| |  || |||||
Sbjct: 426 atgggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcactgtgatgcc 368

                                                                    
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
            || |  |||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 367 tcctgatcccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 311



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 198 gcccagacggtgcc-gtcgtggccgacgatggcggcg 163



to top

>gb|AY792613.1| Malus x domestica clone M4-2-FS8 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 418 caag 421
           ||||
Sbjct: 450 caag 447



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 39/41 (95%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 105 ctgggcccagacgctgcc-gtcgtggccgatgatggcggcg 66



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 252 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctc 298
           ||||||||||| || ||||  ||||| |||||||||||||| |||||
Sbjct: 835 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctc 789



to top

>gb|AY792612.1| Malus x domestica clone M4-2-PM2 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 418 caag 421
           ||||
Sbjct: 450 caag 447



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 39/41 (95%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 105 ctgggcccagacgctgcc-gtcgtggccgatgatggcggcg 66



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 252 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctc 298
           ||||||||||| || ||||  ||||| |||||||||||||| |||||
Sbjct: 835 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctc 789



to top

>gb|AY792611.1| Malus x domestica clone M4-2-FS10 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 418 caag 421
           ||||
Sbjct: 450 caag 447



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 39/41 (95%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 105 ctgggcccagacgctgcc-gtcgtggccgatgatggcggcg 66



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 252 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctc 298
           ||||||||||| || ||||  ||||| |||||||||||||| |||||
Sbjct: 835 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctc 789



to top

>gb|AY792610.1| Malus x domestica clone M4-2-PM7 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 862

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| || ||||| || |||||||| ||||||||||||||||| || ||||
Sbjct: 510 ccttctttcctcgaatcacaactcctggttcaccctggatgaccatgtatttggtccctc 451

               
Query: 418 caag 421
           ||||
Sbjct: 450 caag 447



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 39/41 (95%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           |||||||||||||||||| ||||||||||| ||||||||||
Sbjct: 105 ctgggcccagacgctgcc-gtcgtggccgatgatggcggcg 66



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 252 ccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatc 301
           ||||||||||| || ||||  ||||| |||||||||||||| ||||||||
Sbjct: 834 ccaagcctctcaacaaccatgttgcattggccaggagtcatcggctcatc 785



to top

>gb|DQ309464.1| Litchi chinensis profilin mRNA, complete cds
          Length = 689

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 152/188 (80%), Gaps = 2/188 (1%)
 Strand = Plus / Minus

                                                                       
Query: 369 cggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctccaaggaaaaga 428
           ||||||||| | ||||| ||||| ||||| |||||||| |||||||| || |||   |  
Sbjct: 251 cggatgacagctccaggctcaccctggataaccatgtactttgtgccaccgaggtgcaac 192

                                                                       
Query: 429 ccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccagcaatctcctca 488
           ||||| || |||||    || ||||| |||||||| || |||||  | | ||||||  ||
Sbjct: 191 ccagtgggggcaagggaaccaggttcatcaaagtctttcatgatcgctgtaatctcaaca 132

                                                                       
Query: 489 ggcttgaactggggggaagttgggggactgggcccagacgctgcccgtcgtggccgagga 548
           ||||||||||| ||| ||||||| |  |||||||||||||||| ||||||||||||| ||
Sbjct: 131 ggcttgaactgaggg-aagttggcgctctgggcccagacgctg-ccgtcgtggccgatga 74

                   
Query: 549 tggcggcg 556
           ||||||||
Sbjct: 73  tggcggcg 66



to top

>emb|AJ491882.1|PPE491882 Prunus persica mRNA for profilin, allergen Pru p 4.02
          Length = 396

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                       
Query: 331 tcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcac 390
           ||||||||| |||||  ||||| |  |||||||||||||  |||||| | || || || |
Sbjct: 289 tcttcttgacagtaacaccacctggtcccttctttcctctaatgacagctcctggctctc 230

                                          
Query: 391 cttggatgaccatgtattttgtgcctccaag 421
           |||||||||||||||| ||||||||||||||
Sbjct: 229 cttggatgaccatgtactttgtgcctccaag 199



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 225 tagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcca 284
           |||| ||||||||| ||||| || || |||||||| || || | ||  ||||| ||||||
Sbjct: 395 tagagaccctgctcaaccagataatcaccaagcctttcaacaatcatgttgcattggcca 336

                            
Query: 285 ggagtcatgggctcatc 301
           |||||||| ||||||||
Sbjct: 335 ggagtcattggctcatc 319



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||||||| ||||||||||| ||||||||||
Sbjct: 105 ctgggcccaaacgctgcc-gtcgtggccgatgatggcggcg 66



to top

>gb|AF377948.1|AF377948 Musa acuminata profilin mRNA, complete cds
          Length = 396

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 246 tagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcat 300
           |||||||||||||||||||| |||| |||||| || ||||| |||||||||||||
Sbjct: 374 tagtcgccaagcctctccactaccatattgcattgaccaggcgtcatgggctcat 320



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 160/200 (80%), Gaps = 2/200 (1%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           |||||||| ||||| || ||| | || ||||| |||||||| |||||||| || || || 
Sbjct: 263 cccttcttccctcgaataacagctcctggttccccttggataaccatgtacttcgtccca 204

                                                                       
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgcca 476
           |||||| | | ||||||||| ||||||   || ||||| || ||||| || || ||  ||
Sbjct: 203 ccaaggtataaaccagttggagcaagagacccaggttcatcgaagtctttcataattgca 144

                                                                       
Query: 477 gcaatctcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgt 536
           |||||||| ||||||||| |||| ||| |||  |  |  |||||||||||||||| || |
Sbjct: 143 gcaatctcttcaggcttgcactgaggg-aaggcgtcgctctgggcccagacgctg-ccat 86

                               
Query: 537 cgtggccgaggatggcggcg 556
           ||||||||| ||||||||||
Sbjct: 85  cgtggccgacgatggcggcg 66



to top

>gb|AY082337.1| Chenopodium album pollen allergen Che a 2 mRNA, complete cds
          Length = 396

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggc 296
           |||||||||||||| |||| ||| || || |||| ||||||||| |||||||||||||||
Sbjct: 383 tcgaccaggtagtcaccaatcctttcaacaaccatattgcactgaccaggagtcatgggc 324

              
Query: 297 tca 299
           |||
Sbjct: 323 tca 321



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                       
Query: 356 gcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 415
           |||||||||||||| ||| ||  | ||||| || |||||||| ||||| |||||||||||
Sbjct: 264 gcccttctttcctctgatcacgtctccaggctcgccttggataaccatatattttgtgcc 205

                  
Query: 416 tccaagg 422
            ||||||
Sbjct: 204 accaagg 198



to top

>gb|M65179.1|BELPRFLN B.verrucosa profilin (BetvII) mRNA, complete cds
          Length = 660

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 136/170 (80%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||| |||||||| || || |  ||||||||||| ||||||||| | ||||  || 
Sbjct: 375 gtcttctttatagtaatacctccagatcccttctttccacggatgacagcaccagcctct 316

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           || |||||||||||||||||| |||| ||||||   |  || || || |||||||| || 
Sbjct: 315 ccctggatgaccatgtattttatgcccccaaggtgtaagcccgtcggagcaagatgaccc 256

                                                             
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactg 499
           || || ||||||||||| ||||| ||||  || |||| |||||| |||||
Sbjct: 255 ggctcctcaaagtccttcatgataccagtgatttcctgaggcttaaactg 206



to top

>emb|X73281.1|ZMPRO3MR Z.mays ZmPRO3 mRNA for profilin 3
          Length = 777

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 138/173 (79%)
 Strand = Plus / Minus

                                                                       
Query: 234 tgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatg 293
           ||||| || |||||||| || |||||||| || ||||  |||||||| ||||| ||||||
Sbjct: 509 tgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgtccaggggtcatg 450

                                                                       
Query: 294 ggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccg 353
           ||||| |||||||| || |  | ||| |||   || |||||||| | ||| ||||| || 
Sbjct: 449 ggctcgtcgtagatgccgatcaccagcgcctgtccggtcttcttcacagttatgcctcca 390

                                                                
Query: 354 gtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
           |  |||||||| || ||||||||| | || || || |||||||||||||||||
Sbjct: 389 gatcccttcttcccgcggatgacagcgccgggctcgccttggatgaccatgta 337



to top

>dbj|AK070595.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023058I07, full
           insert sequence
          Length = 880

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 143/177 (80%), Gaps = 2/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 506 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 447

                                                                       
Query: 291 atgggctcatcgtagataccaagaatcagggccatgccc-gtcttcttgatagtaatgcc 349
           || ||||| |||||||| || |  | ||| ||| ||||| |||||||| |  || |||||
Sbjct: 446 atcggctcgtcgtagatgccgaccaccagcgcc-tgcccggtcttcttcaccgtgatgcc 388

                                                                    
Query: 350 accggtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
            || |  |||||||| || || |||||| | |||||||||||| |||||||||||||
Sbjct: 387 tcctgatcccttcttgccacgaatgacagcgccaggttcacctcggatgaccatgta 331



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 218 gcccagacggtgcc-gtcgtggccgacgatggcggcg 183



to top

>gb|AF126263.1|AF126263 Phalaenopsis sp. 'KCbutterfly' putative profilin mRNA, complete cds
          Length = 718

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           ||||||||||||||||| || |  |||||||| ||||| || ||| ||||||||||||||
Sbjct: 429 ttcttgatagtaatgcctccagaacccttcttccctcgaataacagccccaggttcacct 370

                            
Query: 393 tggatgaccatgtattt 409
           || || ||||| |||||
Sbjct: 369 tgtataaccatatattt 353



to top

>gb|AY898658.1| Crocus sativus profilin mRNA, complete cds
          Length = 396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           ||||| ||||| |||||||| || ||||| |||||||||||||| ||||| || ||||| 
Sbjct: 377 aggtaatcgccgagcctctcaacaaccaagttgcactggccaggggtcatcggttcatca 318

                                                                       
Query: 303 tagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttc 362
           ||||  ||||  ||||  ||||||    | |||||||||||||  ||||| |  ||||||
Sbjct: 317 tagagcccaaagatcaaagccatgttacttttcttgatagtaacaccaccagaacccttc 258

                                                            
Query: 363 tttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
           || ||||| || ||||| || || || |||||||| |||||||| ||||
Sbjct: 257 ttccctcgaataacaacacctggctcgccttggataaccatgtactttg 209



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                            
Query: 520 gcccagacgctgcccgtcgtggccgaggatggc 552
           |||||||||||||| ||| ||||||||||||||
Sbjct: 101 gcccagacgctgcc-gtcatggccgaggatggc 70



to top

>gb|AY726606.1| Arachis hypogaea profilin (PROF) mRNA, complete cds
          Length = 604

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 179/226 (79%), Gaps = 2/226 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||| |||||||  ||||| |  ||||| |||| | |||||||| | || || |||
Sbjct: 395 gtcttcttaatagtaacaccaccaggacccttntttcnttggatgacagctccgggctca 336

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||| ||||| |||||||| || || ||| |||| ||||| || |||||   ||||
Sbjct: 335 ccttggattaccatatattttgttccaccgaggtaaagtccagtaggagcaagtgttccg 276

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           || ||  | || || || |||||  |||  || |||||||||||||||| | ||||| ||
Sbjct: 275 ggctccgcgaaatcattcatgatagcagtgatttcctcaggcttgaact-gagggaaatt 217

                                                         
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggc 555
           || |  ||| ||||| |||||| ||||| |||||||||||||||||
Sbjct: 216 ggagctctgagcccaaacgctg-ccgtcttggccgaggatggcggc 172



to top

>gb|AY792617.1| Malus x domestica clone M4-5-FS4 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1033

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 224  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1033 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 974

                                                                        
Query: 284  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 973  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 914

               
Query: 344  aat 346
            |||
Sbjct: 913  aat 911



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 651 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 592

                                                                       
Query: 418 caaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccag 477
           ||||||| |  |||||||| |||||   ||||||||  || || || || |  ||  |||
Sbjct: 591 caaggaataatccagttggggcaagtgttccgggttgatcgaaatctttcagaattgcag 532

                                
Query: 478 caatctcctcaggcttgaact 498
           |||||||||||||||| ||||
Sbjct: 531 caatctcctcaggcttaaact 511



to top

>gb|AY792616.1| Malus x domestica clone M4-5-FS5 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 224  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1032 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 973

                                                                        
Query: 284  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 972  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 913

               
Query: 344  aat 346
            |||
Sbjct: 912  aat 910



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 650 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 591

                                                                       
Query: 418 caaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccag 477
           ||||||| |  |||||||| |||||   ||||||||  || || || || |  ||  |||
Sbjct: 590 caaggaataatccagttggggcaagtgttccgggttgatcgaaatctttcagaattgcag 531

                                
Query: 478 caatctcctcaggcttgaact 498
           |||||||||||||||| ||||
Sbjct: 530 caatctcctcaggcttaaact 510



to top

>gb|AY792615.1| Malus x domestica clone M4-5-PM2 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 224  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1032 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 973

                                                                        
Query: 284  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 972  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 913

               
Query: 344  aat 346
            |||
Sbjct: 912  aat 910



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 650 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 591

                                                                       
Query: 418 caaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccag 477
           ||||||| |  |||||||| |||||   ||||||||  || || || || |  ||  |||
Sbjct: 590 caaggaataatccagttggggcaagtgttccgggttgatcgaaatctttcagaattgcag 531

                                
Query: 478 caatctcctcaggcttgaact 498
           |||||||||||||||| ||||
Sbjct: 530 caatctcctcaggcttaaact 510



to top

>gb|AY792614.1| Malus x domestica clone M4-5-PM7 profilin 3 (Mal d 4.03) gene,
            complete cds
          Length = 1030

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Minus

                                                                        
Query: 224  ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
            ||||| |||||||||||  ||||| ||||| |||||||| || || |  |||||||| ||
Sbjct: 1030 ttagagaccctgctcgataaggtaatcgcccagcctctcaacaactatgttgcactgccc 971

                                                                        
Query: 284  aggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagt 343
            ||||||||  |||||||| || ||||| |  | |||||||  ||  ||||||||||||||
Sbjct: 970  aggagtcacaggctcatcatatataccgattaacagggcctggctggtcttcttgatagt 911

               
Query: 344  aat 346
            |||
Sbjct: 910  aat 908



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcctc 417
           ||||||||||||| |||||| | || |||||||| ||||| ||||| || || || || |
Sbjct: 648 ccttctttcctcgaatgacagcgccgggttcaccctggatcaccatatacttcgtcccac 589

                  
Query: 418 caaggaa 424
           |||||||
Sbjct: 588 caaggaa 582



to top

>gb|AC149269.11| Medicago truncatula clone mth2-102b19, complete sequence
          Length = 128294

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 429   ccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccagcaatctcctca 488
             ||||| |||||||||||||| |||||||| || || || ||||| |||| |||||| |||
Sbjct: 15742 ccagtaggtgcaagatgtcctggttcgtcgaaatctttcatgataccagtaatctcatca 15801

                        
Query: 489   ggcttgaactg 499
             ||||| |||||
Sbjct: 15802 ggcttaaactg 15812



to top

>emb|Y15042.1|HBY15042 Hevea brasiliensis mRNA for profilin
          Length = 396

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 132/163 (80%), Gaps = 2/163 (1%)
 Strand = Plus / Minus

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||| ||||||||||||||||| || |||   | ||||||||| || ||   ||| 
Sbjct: 230 ccttggatcaccatgtattttgtgccacccaggtgcaaaccagttggagctagtgttcca 171

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           ||||||||||||||  | || ||| |||  || || |||| |||||||| | ||||||||
Sbjct: 170 ggttcgtcaaagtcactcataatggcagtgatttcttcagacttgaact-gagggaagtt 112

                                                      
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggc 552
           || |  |||||||||||||||| ||||| ||||||| ||||||
Sbjct: 111 ggagctctgggcccagacgctg-ccgtcttggccgatgatggc 70



to top

>emb|X73280.1|ZMPRO2MR Z.mays ZmPRO2 mRNA for profilin 2
          Length = 830

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 242 caggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatc 301
           |||||||||||| ||||| ||||| ||||  |||||||| ||||| ||||| ||||| ||
Sbjct: 470 caggtagtcgcccagcctttccaccaccatgttgcactgcccaggcgtcatcggctcgtc 411

                      
Query: 302 gtagataccaa 312
           |||||| ||||
Sbjct: 410 gtagatgccaa 400



to top

>gb|DQ270547.1| Mangifera indica profilin 1 (Man i 3.01) mRNA, complete cds
          Length = 656

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 332
           |||||||| ||||||||||| |||||||| ||||||||||  |  | |||||||   |||
Sbjct: 347 ttgcactgtccaggagtcattggctcatcatagataccaatgacaaaggccatgttggtc 288

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           || |||| |||||  ||||| |  ||||||||||| || || ||| | ||||| ||||| 
Sbjct: 287 tttttgacagtaacaccaccaggacccttctttccacgaatcacagctccaggctcaccc 228

                                  
Query: 393 tggatgaccatgtattttgtgcc 415
           ||||| |||||||| || |||||
Sbjct: 227 tggattaccatgtacttagtgcc 205



to top

>gb|AF092547.1|AF092547 Ricinus communis profilin (pro1) mRNA, complete cds
          Length = 737

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 332
           |||||||| || |||||||| |||||||| ||||||||||  |||| ||||      |||
Sbjct: 424 ttgcactgccctggagtcattggctcatcatagataccaatgatcaaggcctgattggtc 365

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           ||||| | |||||  ||||| |  |||||||| ||||| |||||| | || || || |||
Sbjct: 364 ttcttaacagtaacaccacccggtcccttcttccctcgaatgacagctcctggctcgcct 305

                                  
Query: 393 tggatgaccatgtattttgtgcc 415
           ||||||||||||||||| |||||
Sbjct: 304 tggatgaccatgtatttagtgcc 282



to top

>emb|AJ417566.1|PDA417566 Phoenix dactylifera mRNA for profilin (pro gene)
          Length = 396

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 243 aggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggctcatcg 302
           |||||||| || | |||||| || ||||  ||||||||||| |||||||||||||| |||
Sbjct: 377 aggtagtcacccaacctctcaacaaccatgttgcactggcctggagtcatgggctcttcg 318

                     
Query: 303 tagataccaa 312
           ||||| ||||
Sbjct: 317 tagatgccaa 308



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgt 412
           ||||||||||| ||||| ||| | |||||||| |||||||| ||||| ||||||||
Sbjct: 263 cccttctttccacggataacagctccaggttctccttggataaccatatattttgt 208



to top

>emb|Y12425.1|OEPROFIL1 Olea europaea mRNA for profilin 1
          Length = 405

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 146/185 (78%)
 Strand = Plus / Minus

                                                                       
Query: 237 tcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatgggc 296
           |||||||||||||| || | |||||| || ||||  ||||| || || ||||| |  |||
Sbjct: 392 tcgaccaggtagtctcccaacctctcgacaaccatgttgcattgtcctggagttacaggc 333

                                                                       
Query: 297 tcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccggtg 356
           || ||||||||||||| ||  || ||   ||| |||||||| || ||||| ||||| |  
Sbjct: 332 tcctcgtagataccaaaaactagtgcttggccagtcttcttaatggtaataccaccagat 273

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||| ||||||||| | ||||  || ||||| || ||||| || ||||| |||
Sbjct: 272 cccttctttccacggatgacagctccagcctctccttgaatcaccatatactttgttcct 213

                
Query: 417 ccaag 421
           |||||
Sbjct: 212 ccaag 208



to top

>emb|Y08390.1|CDY08390 C.dactylon mRNA for profilin 1
          Length = 396

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 113/141 (80%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||| ||||||||  | || || || || |||||||||||||| || |||   
Sbjct: 263 cccttctttccgcggatgacggcgccgggctcgccctggatgaccatgtacttggtgggg 204

                                                                       
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgcca 476
           || ||||| || || || |||||||||   ||||| ||||| |||||||| ||||||   
Sbjct: 203 ccgaggaagaggccggtgggtgcaagaaacccgggctcgtcgaagtccttcatgatgttg 144

                                
Query: 477 gcaatctcctcaggcttgaac 497
           || ||||||||||||||||||
Sbjct: 143 gccatctcctcaggcttgaac 123



to top

>gb|AC074354.8|AC074354 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0065C16, from Chromosome 10, complete sequence
          Length = 146391

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 358   ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
             ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 68751 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 68799



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                         
Query: 231   ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
             |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 68500 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 68559

                              
Query: 291   atgggctcatcgtagat 307
             || ||||| ||||||||
Sbjct: 68560 atcggctcgtcgtagat 68576



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 231   ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
             |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 59549 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 59490

                              
Query: 291   atgggctcatcgtagat 307
             |||||||| ||||||||
Sbjct: 59489 atgggctcgtcgtagat 59473



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 358   ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
             ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 59289 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 59241



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 520   gcccagacgctgcccgtcgtggccgaggatggcggcg 556
             ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 69015 gcccagacggtgcc-gtcgtggccgacgatggcggcg 69050



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                  
Query: 520   gcccagacgctgcccgtcgtggccgaggatggcggcg 556
             ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 59025 gcccagacggtgcc-gtcgtggccgacgatggcggcg 58990



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 358     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8461501 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8461549



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                           
Query: 231     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
               |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 8461241 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 8461300

                                
Query: 291     atgggctcatcgtagat 307
               |||||||| ||||||||
Sbjct: 8461301 atgggctcgtcgtagat 8461317



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 231     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
               |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 8452290 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 8452231

                                
Query: 291     atgggctcatcgtagat 307
               || ||||| ||||||||
Sbjct: 8452230 atcggctcgtcgtagat 8452214



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 358     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8452039 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8451991



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 520     gcccagacgctgcccgtcgtggccgaggatggcggcg 556
               ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 8461765 gcccagacggtgcc-gtcgtggccgacgatggcggcg 8461800



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                    
Query: 520     gcccagacgctgcccgtcgtggccgaggatggcggcg 556
               ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 8451775 gcccagacggtgcc-gtcgtggccgacgatggcggcg 8451740



to top

>gb|AY900012.1| Petroselinum crispum profilin 1 (PRF1) mRNA, complete cds
          Length = 811

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           ||||| || |||||||| ||||| || |||||| | || ||||| || |||||||| || 
Sbjct: 292 ccttgaatcaccatgtactttgttccaccaaggtacagtccagtaggagcaagatggcca 233

                                                    
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcagg 490
           ||||| |||||||| || || || ||||||||||| |||||
Sbjct: 232 ggttcatcaaagtctttcataataccagcaatctcttcagg 192



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 358     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8466600 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8466648



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                           
Query: 231     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
               |||||||| || |||||||| || |||||||| || ||||  |||||||| || || |||
Sbjct: 8466340 ccctgctctacgaggtagtcaccgagcctctcaaccaccatgttgcactgccccggggtc 8466399

                                
Query: 291     atgggctcatcgtagat 307
               |||||||| ||||||||
Sbjct: 8466400 atgggctcgtcgtagat 8466416



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 231     ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
               |||||||| || ||||||||||| |||||||| || ||||  |||||||| || || |||
Sbjct: 8457389 ccctgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactgccctggggtc 8457330

                                
Query: 291     atgggctcatcgtagat 307
               || ||||| ||||||||
Sbjct: 8457329 atcggctcgtcgtagat 8457313



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 358     ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
               ||||||| || || |||||| | ||||||||||||||||||||||||||
Sbjct: 8457138 ccttcttgccacgaatgacagcgccaggttcaccttggatgaccatgta 8457090



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 520     gcccagacgctgcccgtcgtggccgaggatggcggcg 556
               ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 8466864 gcccagacggtgcc-gtcgtggccgacgatggcggcg 8466899



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                    
Query: 520     gcccagacgctgcccgtcgtggccgaggatggcggcg 556
               ||||||||| |||| ||||||||||| ||||||||||
Sbjct: 8456874 gcccagacggtgcc-gtcgtggccgacgatggcggcg 8456839



to top

>emb|X81982.1|PVPROFILN P.vulgaris mRNA for profilin
          Length = 759

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           |||||||| ||||| ||||||   || |||||||||||||||||||| ||||| ||||| 
Sbjct: 313 cccttcttgcctcgaatgacagagccgggttcaccttggatgaccatatatttagtgcca 254

               
Query: 417 ccaa 420
           ||||
Sbjct: 253 ccaa 250



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||| |||||||| ||| ||||||||||||||||||
Sbjct: 151 gcccaaacgctgcc-gtcttggccgaggatggcggcg 116



to top

>emb|AJ421030.1|AVU421030 Artemisia vulgaris mRNA for profilin, isoallergen 1
          Length = 676

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||| || |||||| | ||||  ||||||||||| |||||||||||||  || 
Sbjct: 301 cccttctttccacgaatgacagctccagcctcaccttggataaccatgtattttgcacca 242

                   
Query: 417 ccaaggaa 424
           ||||||||
Sbjct: 241 ccaaggaa 234



to top

>gb|AY292385.2| Cucumis melo var. reticulatus profilin (Cu m2) mRNA, complete cds
          Length = 634

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           |||||| ||||| |||||||| || |||| | | | ||||||||| |||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaag 178



to top

>gb|AY292386.3| Cucumis melo var. reticulatus cultivar Mashadi profilin (Cuc m2)
           mRNA, complete cds; alternatively polyadenylated 2
          Length = 655

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           |||||| ||||| |||||||| || |||| | | | ||||||||| |||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaag 178



to top

>gb|AY292387.3| Cucumis melo var. reticulatus cultivar Mashadi profilin (Cuc m2)
           mRNA, complete cds; alternatively polyadenylated 3
          Length = 779

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           |||||| ||||| |||||||| || |||| | | | ||||||||| |||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaag 178



to top

>gb|AY271295.2| Cucumis melo var. reticulatus profilin (Cuc m2) mRNA, complete cds
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| | |||||  ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtaaccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           |||||| ||||| |||||||| || |||| | | | ||||||||| |||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaag 178



to top

>ref|NM_119080.2| Arabidopsis thaliana PRF2 (PROFILIN 2); actin binding AT4G29350
           (PRF2) mRNA, complete cds
          Length = 760

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 179/227 (78%), Gaps = 2/227 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||||||||| |  ||||| |  ||||| || |||||||||||  | ||||  |||
Sbjct: 396 gtcttcttgatagtgactccaccaggtccctttttccctcggatgacggctccagcctca 337

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||  |||||||| ||    || |||||||| || || ||||| ||||||||||||
Sbjct: 336 ccttggacaaccatgtacttctcaccgccaaggaatagcccggttggggcaagatgtccg 277

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           | ||| |||||||| ||  |||| || || |||||  ||||||| ||||| ||| ||| |
Sbjct: 276 gcttcttcaaagtctttgttgattcctgctatctctgcaggcttcaactgagggaaagct 217

                                                          
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
            | |  ||| |||||||| ||| ||||| ||||||| ||||||||||
Sbjct: 216 -gagctctgagcccagacactg-ccgtcttggccgaagatggcggcg 172



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 aggtagtcgccaagcctctccacgaccaaattgca 277
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 483 aggtaatcgccgagcctctccacgaccaagttgca 449



to top

>gb|AY114048.1| Arabidopsis thaliana putative profilin 2 protein (At4g29350) mRNA,
           complete cds
          Length = 427

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 179/227 (78%), Gaps = 2/227 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||||||||| |  ||||| |  ||||| || |||||||||||  | ||||  |||
Sbjct: 290 gtcttcttgatagtgactccaccaggtccctttttccctcggatgacggctccagcctca 231

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||  |||||||| ||    || |||||||| || || ||||| ||||||||||||
Sbjct: 230 ccttggacaaccatgtacttctcaccgccaaggaatagcccggttggggcaagatgtccg 171

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           | ||| |||||||| ||  |||| || || |||||  ||||||| ||||| ||| ||| |
Sbjct: 170 gcttcttcaaagtctttgttgattcctgctatctctgcaggcttcaactgagggaaagct 111

                                                          
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
            | |  ||| |||||||| ||| ||||| ||||||| ||||||||||
Sbjct: 110 -gagctctgagcccagacactg-ccgtcttggccgaagatggcggcg 66



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 aggtagtcgccaagcctctccacgaccaaattgca 277
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 377 aggtaatcgccgagcctctccacgaccaagttgca 343



to top

>gb|AY074350.1| Arabidopsis thaliana putative profilin 2 protein (At4g29350) mRNA,
           complete cds
          Length = 759

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 179/227 (78%), Gaps = 2/227 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||||||||| |  ||||| |  ||||| || |||||||||||  | ||||  |||
Sbjct: 383 gtcttcttgatagtgactccaccaggtccctttttccctcggatgacggctccagcctca 324

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||  |||||||| ||    || |||||||| || || ||||| ||||||||||||
Sbjct: 323 ccttggacaaccatgtacttctcaccgccaaggaatagcccggttggggcaagatgtccg 264

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           | ||| |||||||| ||  |||| || || |||||  ||||||| ||||| ||| ||| |
Sbjct: 263 gcttcttcaaagtctttgttgattcctgctatctctgcaggcttcaactgagggaaagct 204

                                                          
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
            | |  ||| |||||||| ||| ||||| ||||||| ||||||||||
Sbjct: 203 -gagctctgagcccagacactg-ccgtcttggccgaagatggcggcg 159



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 aggtagtcgccaagcctctccacgaccaaattgca 277
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 470 aggtaatcgccgagcctctccacgaccaagttgca 436



to top

>emb|AJ223982.1|GMPRO1 Glycine max mRNA for profilin, PRO1
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 415
           |||||||| ||||| |||||| | || |||||||| ||||||||||| ||||| |||||
Sbjct: 263 cccttcttccctcgaatgacagcaccgggttcaccctggatgaccatatatttggtgcc 205



to top

>emb|AJ223981.1|GMPRO2 Glycine max mRNA for profilin, PRO2
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 415
           |||||||| ||||| |||||| | || |||||||| ||||||||||| ||||| |||||
Sbjct: 263 cccttcttccctcgaatgacagcaccgggttcaccctggatgaccatatatttggtgcc 205



to top

>gb|U43591.1|U43591 Arabidopsis thaliana profilin (PRF2) mRNA, complete cds
          Length = 644

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 179/227 (78%), Gaps = 2/227 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||||||||| |  ||||| |  ||||| || |||||||||||  | ||||  |||
Sbjct: 358 gtcttcttgatagtgactccaccaggtccctttttccctcggatgacggctccagcctca 299

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||  |||||||| ||    || |||||||| || || ||||| ||||||||||||
Sbjct: 298 ccttggacaaccatgtacttctcaccgccaaggaatagcccggttggggcaagatgtccg 239

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           | ||| |||||||| ||  |||| || || |||||  ||||||| ||||| ||| ||| |
Sbjct: 238 gcttcttcaaagtctttgttgattcctgctatctctgcaggcttcaactgagggaaagct 179

                                                          
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
            | |  ||| |||||||| ||| ||||| ||||||| ||||||||||
Sbjct: 178 -gagctctgagcccagacactg-ccgtcttggccgaagatggcggcg 134



to top

>gb|AF119367.1|AF119367 Hevea brasiliensis clone hevb 8.10 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 132/167 (79%)
 Strand = Plus / Minus

                                                                       
Query: 255 agcctctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaaga 314
           |||||||| |||| ||  |||||||| || |||||||  || |||||||| ||||||| |
Sbjct: 365 agcctctctacgatcatgttgcactgtcctggagtcaatggttcatcgtaaataccaata 306

                                                                       
Query: 315 atcagggccatgcccgtcttcttgatagtaatgccaccggtgcccttctttcctcggatg 374
           || || ||   ||| || ||||| | |||||||||||| |  ||||||||||| || || 
Sbjct: 305 atgagagcttggccggttttcttcacagtaatgccaccagaacccttctttccacgaatc 246

                                                          
Query: 375 acaaccccaggttcaccttggatgaccatgtattttgtgcctccaag 421
           ||| | || || || || ||||| |||||||| |||||||| |||||
Sbjct: 245 acagctccgggctctccctggatcaccatgtactttgtgccaccaag 199



to top

>gb|AY109853.1| Zea mays CL2096_2 mRNA sequence
          Length = 821

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 234 tgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtcatg 293
           ||||| || ||||||||||| |||||||| || ||||  ||||||||||| |   |||||
Sbjct: 478 tgctctacgaggtagtcgccgagcctctcgaccaccatgttgcactggccggtcntcatg 419

                         
Query: 294 ggctcatcgtagat 307
           ||||| ||||||||
Sbjct: 418 ggctcgtcgtagat 405



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgta 406
           |||||||| || ||||||||| | || || || |||||||||||||||||
Sbjct: 355 cccttcttcccgcggatgacagcgccgggctcgccttggatgaccatgta 306



to top

>gb|DQ335252.1| Cinnamomum camphora profilin-like protein (Cin c 1) mRNA, complete
           cds
          Length = 697

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 177/227 (77%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 332
           ||||||||||| || |||| ||||||||| |||||||| | ||| |  ||   ||| || 
Sbjct: 347 ttgcactggcctggggtcaagggctcatcatagataccgaaaattaaagcttggccggtt 288

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           ||||| ||||| || ||||| |  ||||||||||| ||||| ||| | ||||| || |||
Sbjct: 287 ttcttaatagtgataccaccagatcccttctttccacggataacagcaccaggctctcct 228

                                                                       
Query: 393 tggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccgggt 452
           || || ||||| || ||||| || |||||| | | |||||| || ||||| | ||| |||
Sbjct: 227 tgaataaccatatactttgtacccccaaggtataaaccagtaggggcaaggtatcctggt 168

                                                          
Query: 453 tcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactg 499
           || | ||| || || ||||| |||   |||||||||||||| |||||
Sbjct: 167 tcattaaaatcgttcatgataccattgatctcctcaggcttaaactg 121



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||||||||| || ||||||||||| ||| ||||||
Sbjct: 105 ctgggcccagacgcttcc-gtcgtggccgacgatcgcggcg 66



to top

>gb|U43326.1|ATU43326 Arabidopsis thaliana profilin 2 mRNA, complete cds
          Length = 712

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 179/227 (78%), Gaps = 2/227 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||||||||| |  ||||| |  ||||| || |||||||||||  | ||||  |||
Sbjct: 333 gtcttcttgatagtgactccaccaggtccctttttccctcggatgacggctccagcctca 274

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||  |||||||| ||    || |||||||| || || ||||| ||||||||||||
Sbjct: 273 ccttggacaaccatgtacttctcaccgccaaggaatagcccggttggggcaagatgtccg 214

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           | ||| |||||||| ||  |||| || || |||||  ||||||| ||||| ||| ||| |
Sbjct: 213 gcttcttcaaagtctttgttgattcctgctatctctgcaggcttcaactgagggaaagct 154

                                                          
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
            | |  ||| |||||||| ||| ||||| ||||||| ||||||||||
Sbjct: 153 -gagctctgagcccagacactg-ccgtcttggccgaagatggcggcg 109



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 aggtagtcgccaagcctctccacgaccaaattgca 277
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 420 aggtaatcgccgagcctctccacgaccaagttgca 386



to top

>ref|NM_125043.2| Arabidopsis thaliana PRF3 (PROFILIN 3); actin binding AT5G56600
           (PRF3) mRNA, complete cds
          Length = 701

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 259 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 472 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 419



to top

>ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin binding AT2G19760
           (PRF1) mRNA, complete cds
          Length = 783

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 363 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 310



to top

>gb|AY730591.1| Citrullus lanatus profilin mRNA, partial cds
          Length = 393

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 231 ccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggccaggagtc 290
           ||||||||||  ||||| || |||||||| || || | || ||||||||| |||||||||
Sbjct: 389 ccctgctcgataaggtaatccccaagcctttcaacaatcatattgcactgaccaggagtc 330

                                 
Query: 291 atgggctcatcgtagataccaa 312
           || || ||||| ||||| ||||
Sbjct: 329 attggttcatcatagatgccaa 308



to top

>gb|BT000885.1| Arabidopsis thaliana clone C105361 putative profilin protein
           (At5g56600) mRNA, complete cds
          Length = 538

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 259 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 472 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 419



to top

>gb|AY034989.1| Arabidopsis thaliana putative profilin protein (At5g56600) mRNA,
           partial cds
          Length = 675

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 259 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 463 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 410



to top

>gb|BT000264.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA, complete cds
          Length = 527

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 263 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 210



to top

>gb|AY072427.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA, complete cds
          Length = 717

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 347 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 294



to top

>gb|U43592.1|U43592 Arabidopsis thaliana profilin (PRF3) mRNA, complete cds
          Length = 584

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 259 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 402 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 349



to top

>gb|U43590.1|U43590 Arabidopsis thaliana profilin (PRF1) mRNA, complete cds
          Length = 710

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 339 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 286



to top

>emb|BX818797.1|CNS0A9XS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB14ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 670

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 329 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 276



to top

>emb|BX833469.1|CNS0A0EA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL57ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 633

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 259 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 445 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 392



to top

>gb|AY084285.1| Arabidopsis thaliana clone 102364 mRNA, complete sequence
          Length = 686

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 259 tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
           ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 457 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 404



to top

>dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK19
          Length = 84129

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 259  tctccacgaccaaattgcactggccaggagtcatgggctcatcgtagataccaa 312
            ||||||| |||| |||||| || ||||||||||| || ||||| ||||||||||
Sbjct: 8122 tctccacaaccatattgcattgtccaggagtcattggttcatcatagataccaa 8175



to top

>gb|AF200186.1|AF200186 Lilium longiflorum profilin 3 mRNA, complete cds
          Length = 700

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 255 agcctctccacgaccaaattgcactggccaggagtcatgggctcatcgta 304
           ||||||||||| ||||  |||||||| ||||||||||| ||||| |||||
Sbjct: 402 agcctctccacaaccatgttgcactgaccaggagtcattggctcgtcgta 353



to top

>gb|U43325.1|ATU43325 Arabidopsis thaliana profilin 1 mRNA, complete cds
          Length = 800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
           |||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 363 cccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 310



to top

>emb|Y08389.1|CDY08389 C.dactylon mRNA for profilin 2
          Length = 396

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||| ||||||||  | || || || || |||||||||||||| || |||   
Sbjct: 263 cccttctttccgcggatgacggcgccgggctcgccctggatgaccatgtacttggtgggg 204

                                                                       
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgcca 476
           |||||||| || || || || ||||||   || || ||||| |||||||| ||||||   
Sbjct: 203 ccaaggaagaggccggtgggggcaagaaacccaggctcgtcgaagtccttcatgatgttg 144

                                
Query: 477 gcaatctcctcaggcttgaac 497
           || ||||||||||||||||||
Sbjct: 143 gccatctcctcaggcttgaac 123



to top

>gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map mi148, complete
              sequence
          Length = 126386

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                   
Query: 358    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
              ||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 106095 ccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 106043



to top

>gb|AY268426.1| Ambrosia artemisiifolia profilin-like protein (D106) mRNA, complete
           cds
          Length = 632

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
           |||||||||||| ||||  || ||||| ||| ||||||| || | ||  ||||| || ||
Sbjct: 396 ttagaaaccctgttcgaggagatagtcaccaggcctctcaacaagcatgttgcattgtcc 337

                                        
Query: 284 aggagtcatgggctcatcgtagataccaa 312
            ||||||||||| ||||| ||||||||||
Sbjct: 336 tggagtcatgggttcatcatagataccaa 308



to top

>gb|AY086576.1| Arabidopsis thaliana clone 25886 mRNA, complete sequence
          Length = 754

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 178/227 (78%), Gaps = 2/227 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtcttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttca 389
           |||||||||||||| |  ||||| |  || || || |||||||||||  | ||||  |||
Sbjct: 396 gtcttcttgatagtgactccaccaggtccstttttccctcggatgacggctccagcctca 337

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           |||||||  |||||||| ||    || |||||||| || || ||||| ||||||||||||
Sbjct: 336 ccttggacaaccatgtacttctcaccgccaaggaatagcccggttggggcaagatgtccg 277

                                                                       
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactggggggaagtt 509
           | ||| |||||||| ||  |||| || || |||||  ||||||| ||||| ||| ||| |
Sbjct: 276 gcttcttcaaagtctttgttgattcctgctatctctgcaggcttcaactgagggaaagct 217

                                                          
Query: 510 gggggactgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
            | |  ||| |||||||| ||| ||||| ||||||| ||||||||||
Sbjct: 216 -gagctctgagcccagacactg-ccgtcttggccgaagatggcggcg 172



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 243 aggtagtcgccaagcctctccacgaccaaattgca 277
           ||||| ||||| ||||||||||||||||| |||||
Sbjct: 483 aggtaatcgccgagcctctccacgaccaagttgca 449



to top

>gb|U43593.1|U43593 Arabidopsis thaliana profilin (PRF1) gene, complete cds
          Length = 1833

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 358  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
            ||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 1328 ccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 1276



to top

>gb|AF200185.1|AF200185 Lilium longiflorum profilin 2 mRNA, complete cds
          Length = 614

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 516 ctgggcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||||||||| |||||| ||||||||||| ||||||||||
Sbjct: 147 ctgggcccagatgctgcc-gtcgtggccgatgatggcggcg 108



to top

>gb|AY900014.1| Petroselinum crispum profilin 3 (PRF3) mRNA, complete cds
          Length = 790

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 390 ccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccg 449
           ||||| || ||||| || ||||| || |||||| | || ||||| || |||||||| || 
Sbjct: 292 ccttgaatcaccatatactttgttccaccaaggtacagtccagtgggagcaagatggcca 233

                                                    
Query: 450 ggttcgtcaaagtccttaatgatgccagcaatctcctcagg 490
           ||||| |||||||| || || || ||||||||||| |||||
Sbjct: 232 ggttcatcaaagtctttcataataccagcaatctcttcagg 192



to top

>gb|U43322.1|ATU43322 Arabidopsis thaliana profilin 1 gene, complete cds
          Length = 3113

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 358  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtatttt 410
            ||||||| |||||||| ||| | ||  ||||||||||||| ||||||||||||
Sbjct: 2449 ccttcttccctcggatcacagctccttgttcaccttggataaccatgtatttt 2397



to top

>gb|DQ228336.1| Solanum tuberosum clone 145G03 profilin-like protein mRNA, complete
           cds
          Length = 645

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 177/228 (77%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           ||||||||| ||||||||||| |||||||| || || ||||  ||||  |||  |   ||
Sbjct: 383 attgcactgtccaggagtcatcggctcatcatatattccaatgatcaaagcctggttggt 324

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| || || || ||||| |  |||||||| |||||||| ||| | || || || ||
Sbjct: 323 cttcttaatggtgataccacctggacccttcttccctcggatcacagctcctggctctcc 264

                                                                       
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaagatgtccggg 451
           ||| || |||||||||||||| || |||||  | | ||||||||| |||||   ||| ||
Sbjct: 263 ttgaatcaccatgtattttgttcccccaagatacaaaccagttggagcaagtgttcccgg 204

                                                           
Query: 452 ttcgtcaaagtccttaatgatgccagcaatctcctcaggcttgaactg 499
           |||  ||||||| || |||||||| |  || || || |||||||||||
Sbjct: 203 ttccgcaaagtcattcatgatgcctgatatttcttctggcttgaactg 156



to top

>emb|Y12430.1|OEPROFIL3 Olea europaea mRNA for profilin 3
          Length = 405

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 294 ggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccg 353
           ||||| ||||||||||||| ||  || ||   ||| |||||||| || ||||| ||||| 
Sbjct: 335 ggctcctcgtagataccaaaaactagtgcttggccagtcttcttaatggtaataccacca 276

                                                                       
Query: 354 gtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtg 413
           |  ||||||||||| ||||||||| | ||||  || ||||| || ||||| || ||||| 
Sbjct: 275 gatcccttctttccacggatgacagctccagcctctccttgaatcaccatatactttgtt 216

                   
Query: 414 cctccaag 421
           ||||||||
Sbjct: 215 cctccaag 208



to top

>gb|AF049936.1|AF049936 Petunia x hybrida PGPS/NH20 (PGPS/NH20) mRNA, partial cds
          Length = 629

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 381 ccaggttcaccttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgca 440
           |||||||||||||| || ||||| |||||||  ||  ||||||| |||||||| || |||
Sbjct: 219 ccaggttcaccttgaattaccatatattttgccccagcaaggaatagaccagtgggagca 160

                               
Query: 441 agatgtccgggttcgtcaaa 460
           |||  ||| ||||| |||||
Sbjct: 159 agaaatccaggttcatcaaa 140



to top

>gb|AF059616.1|AF059616 Arachis hypogaea profilin (Ara h 5) mRNA, complete cds
          Length = 743

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 384 ggttcaccttggatgaccatgtattttgtgcc 415
           |||||||||||||| ||||||||||| |||||
Sbjct: 252 ggttcaccttggataaccatgtatttggtgcc 221



to top

>emb|AJ870450.1| Fragaria x ananassa microsatellite DNA, locus UFFa09F09
          Length = 218

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 68/80 (85%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                       
Query: 477 gcaatctcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgt 536
           |||||||| || ||||| ||||| ||| ||||||| |  ||| | |||||||||||| ||
Sbjct: 218 gcaatctcttccggcttaaactgaggg-aagttggagctctgagaccagacgctgcc-gt 161

                               
Query: 537 cgtggccgaggatggcggcg 556
           | ||||||||||||||||||
Sbjct: 160 cttggccgaggatggcggcg 141



to top

>ref|NM_119079.3| Arabidopsis thaliana PRF4; actin binding AT4G29340 (PRF4) mRNA,
           complete cds
          Length = 707

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 343 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 289



to top

>gb|DQ207877.1| Solanum tuberosum clone 092D10 profilin-like mRNA, complete cds
          Length = 750

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 134/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           ||||||||| ||||||||||| |||||||| || || ||||  ||||  |||  |   ||
Sbjct: 485 attgcactgtccaggagtcatcggctcatcatatattccaatgatcaaagcctggttggt 426

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| || || || ||||| |  |||||||| |||||||| ||| | || || || ||
Sbjct: 425 cttcttaatggtgataccacctggacccttcttccctcggatcacagctcctggctctcc 366

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||||||||| || |||||  | | ||||||||| |||||
Sbjct: 365 ttgaatcaccatgtattttgttcccccaagatacaaaccagttggagcaag 315



to top

>gb|AY496123.1| Capsicum annuum profilin mRNA, complete cds
          Length = 647

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 134/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           ||||||||| ||||||||||| |||||||| || || ||||  ||||  |||  |   ||
Sbjct: 379 attgcactgcccaggagtcattggctcatcatatattccaatgatcaaagcctggttggt 320

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| || || || ||||| |  |||||||| |||||||| || || || || || ||
Sbjct: 319 cttcttaatggtgataccacctggacccttcttccctcggatcaccactcctggctctcc 260

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           ||| || |||||||||||||| || |||||  | | ||||||||| |||||
Sbjct: 259 ttgaatcaccatgtattttgttcccccaagatacaaaccagttggagcaag 209



to top

>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70
          Length = 198429

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 243    aggtagtcgccaagcctctccacgaccaaattgca 277
              ||||| ||||| ||||||||||||||||| |||||
Sbjct: 179180 aggtaatcgccgagcctctccacgaccaagttgca 179146



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 417    ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtc 463
              |||||||| || || ||||| ||||||||||||| ||| ||||||||
Sbjct: 178895 ccaaggaatagcccggttggggcaagatgtccggcttcttcaaagtc 178849



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 358    ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
              ||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 176328 ccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 176275



to top

>gb|BT024816.1| Arabidopsis thaliana At4g29340 gene, complete cds
          Length = 405

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 272 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 218



to top

>gb|AY894660.1| Ambrosia artemisiifolia profilin isoallergen 1 mRNA, complete cds
          Length = 791

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
           ||||||||||| || || ||| | ||||| ||||||||||| |||||||| ||||
Sbjct: 275 cccttctttccacgaataacagctccaggctcaccttggattaccatgtactttg 221



to top

>gb|BT003946.1| Arabidopsis thaliana clone RAFL15-14-D07 (R20752) putative profilin
           3 (At4g29340) mRNA, complete cds
          Length = 723

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 343 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 289



to top

>gb|AY085179.1| Arabidopsis thaliana clone 13601 mRNA, complete sequence
          Length = 705

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
           |||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 341 cccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 287



to top

>gb|AF119366.1|AF119366 Hevea brasiliensis clone hevb 8.8 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 157/199 (78%), Gaps = 2/199 (1%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||| || || ||| ||||||| || || ||||| |||||||| |||||||  
Sbjct: 263 cccttctttccacgaatcacagccccaggctctccctggatcaccatgtactttgtgcta 204

                                                                       
Query: 417 ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgcca 476
           ||||||   | ||||||||| |||||   ||| ||||| ||||| || || |||||  ||
Sbjct: 203 ccaaggtgcaaaccagttggggcaagggatccaggttcatcaaaatctttcatgatagca 144

                                                                       
Query: 477 gcaatctcctcaggcttgaactggggggaagttgggggactgggcccagacgctgcccgt 536
           |||| ||| || | ||| |||| | |||||| ||| |  ||||||||| |||||| || |
Sbjct: 143 gcaacctcatctgacttaaact-gagggaagctggagctctgggcccacacgctg-ccat 86

                              
Query: 537 cgtggccgaggatggcggc 555
           ||||||||| ||| |||||
Sbjct: 85  cgtggccgatgatagcggc 67



to top

>gb|AY900016.1| Petroselinum crispum profilin 5 (PRF5) mRNA, complete cds
          Length = 764

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcc 415
           |||||||||||||| |||||| |   |||||||||||| || ||||| || ||||||||
Sbjct: 447 cccttctttcctcgtatgacagcattaggttcaccttgaatcaccatatactttgtgcc 389



to top

>gb|AY879597.1| Cucumis melo profilin (m2) mRNA, complete cds and 3' UTR
          Length = 576

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 134/171 (78%)
 Strand = Plus / Minus

                                                                       
Query: 272 attgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgt 331
           |||||| || ||||||||||| || ||||| ||||||||||  |  |  ||||| || ||
Sbjct: 348 attgcattgaccaggagtcattggttcatcatagataccaatgactaaagccataccagt 289

                                                                       
Query: 332 cttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacc 391
           |||||| | ||||   ||||| | ||||||||| || || || ||| | ||||| || ||
Sbjct: 288 cttcttaacagtagccccacctgggcccttcttcccacgaataacagctccaggctcccc 229

                                                              
Query: 392 ttggatgaccatgtattttgtgcctccaaggaaaagaccagttggtgcaag 442
           |||||| ||||| |||||||| || |||| | | | ||||||||| |||||
Sbjct: 228 ttggattaccatatattttgtaccaccaatgtacaaaccagttggagcaag 178



to top

>gb|U43323.1|ATU43323 Arabidopsis thaliana profilin 2 and profilin 3 genes, complete cds
          Length = 5329

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 243  aggtagtcgccaagcctctccacgaccaaattgca 277
            ||||| ||||| ||||||||||||||||| |||||
Sbjct: 4995 aggtaatcgccgagcctctccacgaccaagttgca 4961



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 417  ccaaggaaaagaccagttggtgcaagatgtccgggttcgtcaaagtc 463
            |||||||| || || ||||| ||||||||||||| ||| ||||||||
Sbjct: 4710 ccaaggaatagcccggttggggcaagatgtccggcttcttcaaagtc 4664



 Score = 44.1 bits (22), Expect = 0.48
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 358  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
            ||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 2142 ccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 2089



to top

>gb|AY268425.1| Ambrosia artemisiifolia profilin-like protein (A0418) mRNA,
           complete cds
          Length = 645

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 82/102 (80%)
 Strand = Plus / Minus

                                                                       
Query: 224 ttagaaaccctgctcgaccaggtagtcgccaagcctctccacgaccaaattgcactggcc 283
           |||||||||||| ||||  || ||||| |||||||| || || | ||  ||||| |||||
Sbjct: 396 ttagaaaccctgttcgaggagatagtcaccaagcctttcaacaatcatgttgcattggcc 337

                                                     
Query: 284 aggagtcatgggctcatcgtagataccaagaatcagggccat 325
            |||| ||| |||||||| ||||| ||||  |||| ||||||
Sbjct: 336 tggagccattggctcatcatagattccaatgatcaaggccat 295



to top

>gb|AY499654.1| Capsicum annuum profilin mRNA, partial cds
          Length = 329

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 272 attgcactggccaggagtcatgggctcatc 301
           ||||||||| ||||||||||| ||||||||
Sbjct: 118 attgcactgcccaggagtcattggctcatc 89



to top

>gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, complete sequence
          Length = 209838

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 317  cagggccatgcccgtcttcttg 338
            ||||||||||||||||||||||
Sbjct: 3385 cagggccatgcccgtcttcttg 3364



to top

>emb|AJ417553.1|LES417553 Lycopersicon esculentum mRNA for profilin, allergen Lyc e 1
          Length = 581

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 272 attgcactggccaggagtcatgggctcatc 301
           ||||||||| ||||||||||| ||||||||
Sbjct: 348 attgcactgtccaggagtcatcggctcatc 319



to top

>gb|AF327623.1|AF327623 Corylus avellana clone 7 minor allergen hazelnut profilin mRNA,
           complete cds
          Length = 396

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 118/150 (78%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 332
           |||||||| ||||||||||| || ||||| || |||||||  |||| ||||   |  || 
Sbjct: 347 ttgcactgcccaggagtcattggttcatcatatataccaatgatcaaggcctgactagtt 288

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           || ||||  ||||  ||||| | ||||||||| ||||| || ||| | || || || |||
Sbjct: 287 tttttgacggtaacaccaccagggcccttcttccctcgaataacagctcccggctcgcct 228

                                         
Query: 393 tggatgaccatgtattttgtgcctccaagg 422
           ||||| |||||||| |||||||| ||||||
Sbjct: 227 tggatcaccatgtactttgtgccaccaagg 198



to top

>gb|AF327622.1|AF327622 Corylus avellana clone 6 minor allergen hazelnut profilin mRNA,
           complete cds
          Length = 396

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 118/150 (78%)
 Strand = Plus / Minus

                                                                       
Query: 273 ttgcactggccaggagtcatgggctcatcgtagataccaagaatcagggccatgcccgtc 332
           |||||||| ||||||||||| || ||||| || |||||||  |||| ||||   |  |||
Sbjct: 347 ttgcactgcccaggagtcattggttcatcatatataccaatgatcaaggcctgactagtc 288

                                                                       
Query: 333 ttcttgatagtaatgccaccggtgcccttctttcctcggatgacaaccccaggttcacct 392
           || ||||  ||||  ||||| | ||||||||| | ||| || ||| | || || || |||
Sbjct: 287 tttttgacggtaacaccaccagggcccttcttccttcgaataacagctcccggctcgcct 228

                                         
Query: 393 tggatgaccatgtattttgtgcctccaagg 422
           ||||| |||||||| |||||||| ||||||
Sbjct: 227 tggatcaccatgtactttgtgccaccaagg 198



to top

>gb|U43594.1|U43594 Arabidopsis thaliana profilin (PRF4) gene, complete cds
          Length = 1792

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                  
Query: 358  ccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttg 411
            ||||||| || ||||| ||| |||| || ||||||||||| |||||||| ||||
Sbjct: 1284 ccttcttgccacggattacagccccgggctcaccttggatcaccatgtactttg 1231



to top

>gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 219072

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 317   cagggccatgcccgtcttcttg 338
             ||||||||||||||||||||||
Sbjct: 78872 cagggccatgcccgtcttcttg 78893



to top

>gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, complete sequence
          Length = 214694

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 159    gatgcaaagcccacaggagca 179
              |||||||||||||||||||||
Sbjct: 118838 gatgcaaagcccacaggagca 118858



to top

>gb|AY550179.1| Elaeis oleifera profilin mRNA, partial cds
          Length = 452

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 536 tcgtggccgaggatggcggcg 556
           |||||||||||||||||||||
Sbjct: 140 tcgtggccgaggatggcggcg 120



to top

>dbj|AK133754.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730406J02 product:pericentriolar
            material 1, full insert sequence
          Length = 2634

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 159  gatgcaaagcccacaggagca 179
            |||||||||||||||||||||
Sbjct: 1720 gatgcaaagcccacaggagca 1700



to top

>gb|AF456482.1| Daucus carota minor allergen Dau c 4 profilin mRNA, complete cds
          Length = 405

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 34/37 (91%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 520 gcccagacgctgcccgtcgtggccgaggatggcggcg 556
           ||||| |||||||| ||||||||||| ||||||||||
Sbjct: 110 gcccaaacgctgcc-gtcgtggccgatgatggcggcg 75



to top

>gb|AF129423.1|AF129423 Apium graveolens profilin mRNA, complete cds
          Length = 405

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 429 ccagttggtgcaagatgtccgggttcgtcaaagtccttaatgatgccagcaatctcctca 488
           ||||| |||||||| || || || ||||| ||||| || || || ||||||||||| |||
Sbjct: 200 ccagtaggtgcaaggtggccaggctcgtcgaagtctttcataataccagcaatctcttca 141

                
Query: 489 ggctt 493
           |||||
Sbjct: 140 ggctt 136



to top

>gb|AC158222.6| Mus musculus chromosome 8, clone RP23-117M15, complete sequence
          Length = 207233

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 159  gatgcaaagcccacaggagca 179
            |||||||||||||||||||||
Sbjct: 8815 gatgcaaagcccacaggagca 8795



to top

>gb|AF352180.1|AF352180 Mus musculus pericentriolar material gene 1 protein (Pcm1) mRNA,
            alternatively spliced, partial cds
          Length = 6010

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 159  gatgcaaagcccacaggagca 179
            |||||||||||||||||||||
Sbjct: 1368 gatgcaaagcccacaggagca 1348



to top

>emb|BX897672.1| Neurospora crassa DNA linkage group III BAC clone B2H10
          Length = 66518

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 434   tggtgcaagatgtccgggttc 454
             |||||||||||||||||||||
Sbjct: 16099 tggtgcaagatgtccgggttc 16079



to top

>gb|AY900015.1| Petroselinum crispum profilin 4 (PRF4) mRNA, complete cds
          Length = 708

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 453 tcgtcaaagtccttaatgatgccagcaatctcctcaggctt 493
           ||||||||||| || || || ||||||||||| ||||||||
Sbjct: 237 tcgtcaaagtctttcataataccagcaatctcttcaggctt 197



to top

>ref|NM_023662.1| Mus musculus pericentriolar material 1 (Pcm1), mRNA
          Length = 6674

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 159  gatgcaaagcccacaggagca 179
            |||||||||||||||||||||
Sbjct: 1585 gatgcaaagcccacaggagca 1565



to top

>dbj|AB029291.1| Mus musculus pcm-1 mRNA for pericentriolar material-1, complete cds
          Length = 6674

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 159  gatgcaaagcccacaggagca 179
            |||||||||||||||||||||
Sbjct: 1585 gatgcaaagcccacaggagca 1565



to top

>gb|AY792609.1| Malus x domestica clone M4.01FS12 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AY792608.1| Malus x domestica clone M4.01PM9 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AY792607.1| Malus x domestica clone M4.01FS6 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AY792606.1| Malus x domestica clone M4.01PM7 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AY792605.1| Malus x domestica clone M4.01FS7 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>ref|XM_422236.1| PREDICTED: Gallus gallus similar to KIAA1096 protein (LOC424393),
            mRNA
          Length = 11679

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 116  tagattattcactgcatata 135
            ||||||||||||||||||||
Sbjct: 8979 tagattattcactgcatata 8960



to top

>gb|AC154768.2| Mus musculus BAC clone RP24-444E21 from chromosome 14, complete
             sequence
          Length = 135417

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 215   agggtgggcttagaaaccct 234
             ||||||||||||||||||||
Sbjct: 11386 agggtgggcttagaaaccct 11367



to top

>gb|AC123957.4| Mus musculus BAC clone RP23-302N2 from 12, complete sequence
          Length = 206661

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 394   ggatgaccatgtattttgtg 413
             ||||||||||||||||||||
Sbjct: 69836 ggatgaccatgtattttgtg 69855



to top

>gb|DQ450945.1| Streptomyces sp. 98-62 polyketide synthase I protein genes, partial
            cds
          Length = 11626

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 533  ccgtcgtggccgaggatggcggcg 556
            |||||||||||||||| |||||||
Sbjct: 4402 ccgtcgtggccgaggacggcggcg 4379



to top

>emb|Y13271.1|MAPROFILN Mercurialis annua mRNA for profilin
          Length = 402

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 357 cccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtgcct 416
           ||||||||||| ||||| ||| | |||  ||| || ||||| ||||| ||||||||||||
Sbjct: 269 cccttctttccacggattacagcgccactttcgccctggataaccatatattttgtgcct 210



to top

>emb|Y12429.1|OEPROFIL2 Olea europaea mRNA for profilin 2
          Length = 405

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 101/128 (78%)
 Strand = Plus / Minus

                                                                       
Query: 294 ggctcatcgtagataccaagaatcagggccatgcccgtcttcttgatagtaatgccaccg 353
           ||||| ||||||||||||| ||  || ||   ||| |||||||| || ||||| ||||| 
Sbjct: 335 ggctcctcgtagataccaaaaactagtgcttggccagtcttcttaatggtaataccacca 276

                                                                       
Query: 354 gtgcccttctttcctcggatgacaaccccaggttcaccttggatgaccatgtattttgtg 413
           |  ||||||||||| ||||||||  | ||||  || ||||| || ||||| || ||||| 
Sbjct: 275 gatcccttctttccacggatgacggctccagcctctccttgaatcaccatatactttgtt 216

                   
Query: 414 cctccaag 421
           ||||||||
Sbjct: 215 cctccaag 208



to top

>emb|AJ507457.1|MDO507457 Malus x domestica mRNA for apple allergen profilin (pf-1 gene),
           clone 1
          Length = 705

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AC139528.16| Botryllus schlosseri clone subsf-555i12, complete sequence
          Length = 40814

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 455 gtcaaagtccttaatgatgc 474
           ||||||||||||||||||||
Sbjct: 252 gtcaaagtccttaatgatgc 271



to top

>gb|AC138022.14| Botryllus schlosseri clone subsf-533i14, complete sequence
          Length = 44370

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 455  gtcaaagtccttaatgatgc 474
            ||||||||||||||||||||
Sbjct: 6375 gtcaaagtccttaatgatgc 6356



to top

>emb|AL834316.1|HSM805358 Homo sapiens mRNA; cDNA DKFZp434G1729 (from clone DKFZp434G1729)
          Length = 1967

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 501 ggggaagttgggggactgggccca 524
           ||||||||||| ||||||||||||
Sbjct: 885 ggggaagttggaggactgggccca 908



to top

>dbj|AK128284.1| Homo sapiens cDNA FLJ46422 fis, clone THYMU3013241
          Length = 3057

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 501 ggggaagttgggggactgggccca 524
           ||||||||||| ||||||||||||
Sbjct: 566 ggggaagttggaggactgggccca 589



to top

>dbj|AK127979.1| Homo sapiens cDNA FLJ46094 fis, clone TESTI2018687
          Length = 3159

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 501  ggggaagttgggggactgggccca 524
            ||||||||||| ||||||||||||
Sbjct: 2108 ggggaagttggaggactgggccca 2131



to top

>ref|XM_938028.1| PREDICTED: Homo sapiens chromosome 19 open reading frame 16
            (C19orf16), mRNA
          Length = 2897

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 501  ggggaagttgggggactgggccca 524
            ||||||||||| ||||||||||||
Sbjct: 1846 ggggaagttggaggactgggccca 1869



to top

>ref|XM_371195.4| PREDICTED: Homo sapiens chromosome 19 open reading frame 16
            (C19orf16), mRNA
          Length = 2257

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 501  ggggaagttgggggactgggccca 524
            ||||||||||| ||||||||||||
Sbjct: 1447 ggggaagttggaggactgggccca 1470



to top

>gb|AF129424.1|AF129424 Pyrus communis profilin mRNA, complete cds
          Length = 396

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence
          Length = 134793

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 501   ggggaagttgggggactgggccca 524
             ||||||||||| ||||||||||||
Sbjct: 67234 ggggaagttggaggactgggccca 67211



to top

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 408     tttgtgcctccaaggaaaag 427
               ||||||||||||||||||||
Sbjct: 2695148 tttgtgcctccaaggaaaag 2695129



to top

>gb|AF129426.1|AF129426 Malus domestica GD4-1 profilin mRNA, complete cds
          Length = 396

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 533 ccgtcgtggccgaggatggc 552
           ||||||||||||||||||||
Sbjct: 89  ccgtcgtggccgaggatggc 70



to top

>gb|AC102657.13| Mus musculus chromosome 10, clone RP23-15N10, complete sequence
          Length = 186954

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 384   ggttcaccttggatgaccat 403
             ||||||||||||||||||||
Sbjct: 43853 ggttcaccttggatgaccat 43872


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,661,639
Number of Sequences: 3902068
Number of extensions: 3661639
Number of successful extensions: 60125
Number of sequences better than 10.0: 176
Number of HSP's better than 10.0 without gapping: 175
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 59563
Number of HSP's gapped (non-prelim): 497
length of query: 556
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 533
effective length of database: 17,143,297,704
effective search space: 9137377676232
effective search space used: 9137377676232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top