Clone Name	rbags4k16
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|X74545.1|TAATP2 T.aestivum atp-2 mRNA for ATP synthase beta ...	232	2e-58
2	gb|BT018722.1| Zea mays clone EL01N0518D08.d mRNA sequence	172	2e-40
3	gb|AY103634.1| Zea mays PCO073309 mRNA sequence	172	2e-40
4	ref|XM_475868.1| Oryza sativa (japonica cultivar-group), predic...	170	7e-40
5	gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome...	170	7e-40
6	gb|AC093956.2| Oryza sativa (japonica cultivar-group) chromosome...	170	7e-40
7	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	170	7e-40
8	dbj|AK061681.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	7e-40
9	gb|BT016806.1| Zea mays clone Contig639 mRNA sequence	163	2e-37
10	emb|X54233.1|ZMATP2MT Maize ATP2 mRNA for mitochondrial ATP synt...	163	2e-37
11	gb|M36087.1|MZEMT2BATP Zea mays mitochondrial F-1-ATPase subunit...	163	2e-37
12	ref|NM_192090.1| Oryza sativa (japonica cultivar-group), predic...	155	4e-35
13	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	155	4e-35
14	dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic D...	155	4e-35
15	emb|Y15178.1|SBY15178 Sorghum bicolor F1-ATP synthase, cultivar ...	155	4e-35
16	dbj|AK071414.1| Oryza sativa (japonica cultivar-group) cDNA clon...	155	4e-35
17	dbj|AK064953.1| Oryza sativa (japonica cultivar-group) cDNA clon...	155	4e-35
18	gb|AY108796.1| Zea mays PCO073308 mRNA sequence	155	4e-35
19	emb|Y15179.1|SBY15179 Sorghum bicolor F1-ATP synthase, cultivar ...	147	1e-32
20	gb|BT012914.1| Lycopersicon esculentum clone 114032R, mRNA sequence	139	3e-30
21	gb|U96498.1|U96498 Nicotiana sylvestris ATPase beta subunit (nsa...	139	3e-30
22	gb|U96497.1|NSU96497 Nicotiana sylvestris ATPase beta subunit (n...	139	3e-30
23	dbj|D10491.1|RICATPB Oryza sativa (japonica cultivar-group) mRNA...	139	3e-30
24	emb|X58498.1|HBATPB H.brasiliensis mRNA for mitochondrial ATP sy...	131	6e-28
25	emb|X02868.1|NPATP21 Nicotiana plubaginifolia atp2-1 gene for mi...	131	6e-28
26	gb|L27812.1|ACTPKIWC Actinidia deliciosa var. deliciosa (pKIWI50...	129	2e-27
27	gb|AC144731.15| Medicago truncatula clone mth2-5g18, complete se...	121	6e-25
28	gb|U96496.1|NSU96496 Nicotiana sylvestris ATPase beta subunit (n...	115	4e-23
29	dbj|AB003549.1| Pisum sativum mRNA for F1 ATPase, complete cds	109	2e-21
30	ref|NM_120953.2| Arabidopsis thaliana ATP binding / hydrogen-exp...	105	4e-20
31	gb|BT000796.1| Arabidopsis thaliana unknown protein (At5g08670) ...	105	4e-20
32	gb|AY117269.1| Arabidopsis thaliana unknown protein (At5g08670) ...	105	4e-20
33	gb|AY080681.1| Arabidopsis thaliana unknown protein (At5g08670) ...	105	4e-20
34	emb|AL590346.1|ATT2K12 Arabidopsis thaliana DNA chromosome 5, BA...	105	4e-20
35	emb|AJ271468.1|ATH271468 Arabidopsis thaliana mRNA for mitochond...	105	4e-20
36	gb|AY113178.1| Arabidopsis thaliana At5g08670/At5g08670 mRNA, co...	105	4e-20
37	gb|AY054222.1| Arabidopsis thaliana At5g08670 mRNA, complete cds	105	4e-20
38	dbj|AK118538.1| Arabidopsis thaliana At5g08670 mRNA for putative...	105	4e-20
39	emb|AJ843974.1| Plantago major partial mRNA for mitochondrial F0...	100	2e-18
40	emb|X61624.1|CRATP2 Chlamydomonas reinhardtii atp2 (atpB) mRNA	100	2e-18
41	ref|NM_120954.2| Arabidopsis thaliana ATP binding / hydrogen-exp...	98	9e-18
42	gb|AY113847.1| Arabidopsis thaliana unknown protein (At5g08690) ...	98	9e-18
43	gb|AY079341.1| Arabidopsis thaliana unknown protein (At5g08690) ...	98	9e-18
44	gb|AY050995.1| Arabidopsis thaliana unknown protein (At5g08690) ...	98	9e-18
45	emb|BX833989.1|CNS09Z5M Arabidopsis thaliana Full-length cDNA Co...	98	9e-18
46	dbj|AK118582.1| Arabidopsis thaliana At5g08690 mRNA for putative...	98	9e-18
47	ref|XM_694742.1| PREDICTED: Danio rerio similar to ATP synthase ...	94	1e-16
48	gb|AY580223.1| Lestes congener ATP synthase beta subunit mRNA, p...	84	1e-13
49	ref|NM_147850.2| Arabidopsis thaliana ATP binding / hydrogen-exp...	82	5e-13
50	gb|BT005920.1| Arabidopsis thaliana At5g08680 gene, complete cds	82	5e-13
51	dbj|AK117922.1| Arabidopsis thaliana At5g08680 mRNA for putative...	82	5e-13
52	gb|U96499.1|U96499 Nicotiana sylvestris ATPase beta subunit (nsa...	82	5e-13
53	emb|CR734911.2|CNS0GTU6 Tetraodon nigroviridis full-length cDNA	80	2e-12
54	emb|CR731188.2|CNS0GR4P Tetraodon nigroviridis full-length cDNA	80	2e-12
55	emb|CR730449.2|CNS0GQK6 Tetraodon nigroviridis full-length cDNA	80	2e-12
56	emb|CR729021.2|CNS0GPGJ Tetraodon nigroviridis full-length cDNA	80	2e-12
57	emb|CR722562.2|CNS0GKH4 Tetraodon nigroviridis full-length cDNA	80	2e-12
58	emb|CR703126.2|CNS0G5HE Tetraodon nigroviridis full-length cDNA	80	2e-12
59	emb|CR698947.2|CNS0G29B Tetraodon nigroviridis full-length cDNA	80	2e-12
60	emb|CR696789.2|CNS0G0LD Tetraodon nigroviridis full-length cDNA	80	2e-12
61	emb|CR694503.2|CNS0FYTV Tetraodon nigroviridis full-length cDNA	80	2e-12
62	emb|CR690119.2|CNS0FVG3 Tetraodon nigroviridis full-length cDNA	80	2e-12
63	emb|CR689132.2|CNS0FUOO Tetraodon nigroviridis full-length cDNA	80	2e-12
64	emb|CR680456.2|CNS0FNZO Tetraodon nigroviridis full-length cDNA	80	2e-12
65	emb|CR680138.2|CNS0FNQU Tetraodon nigroviridis full-length cDNA	80	2e-12
66	emb|CR673940.2|CNS0FIZE Tetraodon nigroviridis full-length cDNA	80	2e-12
67	emb|CR670454.2|CNS0FGAK Tetraodon nigroviridis full-length cDNA	80	2e-12
68	emb|CR666515.2|CNS0FD95 Tetraodon nigroviridis full-length cDNA	80	2e-12
69	emb|CR659396.2|CNS0F7RE Tetraodon nigroviridis full-length cDNA	80	2e-12
70	emb|CR658808.2|CNS0F7B2 Tetraodon nigroviridis full-length cDNA	80	2e-12
71	emb|CR650139.2|CNS0F0M9 Tetraodon nigroviridis full-length cDNA	80	2e-12
72	emb|CR648745.2|CNS0EZJJ Tetraodon nigroviridis full-length cDNA	80	2e-12
73	emb|CR645891.2|CNS0EXC9 Tetraodon nigroviridis full-length cDNA	80	2e-12
74	emb|CR645267.2|CNS0EWUX Tetraodon nigroviridis full-length cDNA	80	2e-12
75	emb|CR641909.2|CNS0EU9N Tetraodon nigroviridis full-length cDNA	80	2e-12
76	emb|CR639100.2|CNS0ES3M Tetraodon nigroviridis full-length cDNA	80	2e-12
77	emb|X60303.1|DCATPSBS D.carota gene for ATP synthase b subunit	80	2e-12
78	gb|BC095620.1| Danio rerio zgc:111961, mRNA (cDNA clone MGC:1119...	78	8e-12
79	ref|NM_001024429.1| Danio rerio zgc:111961 (zgc:111961), mRNA	78	8e-12
80	dbj|AK221961.1| Arabidopsis thaliana mRNA for H+-transporting AT...	74	1e-10
81	emb|CR691590.2|CNS0FWKY Tetraodon nigroviridis full-length cDNA	72	5e-10
82	gb|AY580264.1| Modiolus americanus ATP synthase beta subunit mRN...	70	2e-09
83	gb|AY580209.1| Enallagma aspersum ATP synthase beta subunit mRNA...	70	2e-09
84	emb|BX004890.11| Zebrafish DNA sequence from clone DKEY-9A6 in l...	66	3e-08
85	emb|AL928821.6| Zebrafish DNA sequence from clone CH211-127N10, ...	66	3e-08
86	gb|AY431217.1| Aedes aegypti ASAP ID: 37237 ATP synthase mRNA se...	64	1e-07
87	gb|DQ358698.1| Pinctada fucata ATP synthase beta subunit mRNA, c...	62	5e-07
88	dbj|AB023582.1| Cyprinus carpio mRNA for ATP synthase beta-subun...	62	5e-07
89	ref|XM_967388.1| PREDICTED: Tribolium castaneum similar to CG111...	60	2e-06
90	gb|BC067388.1| Xenopus tropicalis hypothetical protein MGC76033,...	58	8e-06
91	ref|XM_453538.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D10703g ...	58	8e-06
92	gb|AY580269.1| Mytilus edulis ATP synthase beta subunit mRNA, pa...	58	8e-06
93	ref|XM_748496.1| Aspergillus fumigatus Af293 ATP synthase F1, su...	58	8e-06
94	ref|XM_384488.1| Gibberella zeae PH-1 chromosome 2 ATPB_NEUCR AT...	58	8e-06
95	gb|BC046741.1| Xenopus laevis ATP synthase, H+ transporting mito...	58	8e-06
96	emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	58	8e-06
97	gb|DQ087473.1| Microciona prolifera ATP synthase beta subunit mR...	58	8e-06
98	ref|NM_001001256.1| Xenopus tropicalis hypothetical protein MGC7...	58	8e-06
99	emb|CR762341.2| Xenopus tropicalis finished cDNA, clone TGas077c21	58	8e-06
100	gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete ge...	58	8e-06
101	gb|U37764.1|KLU37764 Kluyveromyces lactis F1 ATPase beta subunit...	58	8e-06
102	ref|XM_509149.1| PREDICTED: Pan troglodytes ATP synthase, H+ tra...	56	3e-05
103	emb|BX321856.1| Nitrosomonas europaea ATCC 19718, complete genom...	56	3e-05
104	gb|AY580230.1| Nucula proxima ATP synthase beta subunit mRNA, pa...	54	1e-04
105	ref|XM_500475.1| Yarrowia lipolytica CLIB122, YALI0B03982g predi...	54	1e-04
106	gb|DQ087492.1| Nereis vexillosa ATP synthase beta subunit mRNA, ...	54	1e-04
107	gb|DQ417168.1| Ictalurus punctatus clone SAAF04R ATP synthase be...	54	1e-04
108	emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1...	54	1e-04
109	emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome	52	5e-04
110	gb|DQ087452.1| Lineus viridis ATP synthase beta subunit mRNA, pa...	52	5e-04
111	dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co...	52	5e-04
112	dbj|AB104883.1| Zygosaccharomyces rouxii ZrATP2 gene for mitocho...	52	5e-04
113	ref|NM_001031391.1| Gallus gallus ATP synthase, H+ transporting,...	50	0.002
114	ref|XM_708288.1| Candida albicans SC5314 mitochondrial F1F0-ATPa...	50	0.002
115	ref|XM_708241.1| Candida albicans SC5314 mitochondrial F1F0-ATPa...	50	0.002
116	gb|AY580258.1| Mytilus californianus ATP synthase beta subunit m...	50	0.002
117	ref|XM_446820.1| Candida glabrata CBS138, CAGL0H00506g partial mRNA	50	0.002
118	emb|BX054584.1|CNS09EA4 Single read from an extremity of a full-...	50	0.002
119	emb|BX052275.1|CNS09CHZ Single read from an extremity of a full-...	50	0.002
120	emb|BX050670.1|CNS09B9E Single read from an extremity of a full-...	50	0.002
121	emb|BX043854.1|CNS09602 Single read from an extremity of a full-...	50	0.002
122	emb|BX036739.1|CNS090IF Single read from an extremity of a full-...	50	0.002
123	emb|BX035307.1|CNS08ZEN Single read from an extremity of a full-...	50	0.002
124	emb|BX018705.1|CNS08MLH Single read from an extremity of a full-...	50	0.002
125	emb|BX015733.1|CNS08KAX Single read from an extremity of a full-...	50	0.002
126	emb|BX009326.1|CNS08FCY Single read from an extremity of a full-...	50	0.002
127	emb|Z49621.1|SCYJR121W S.cerevisiae chromosome X reading frame O...	50	0.002
128	emb|CR628337.1| Legionella pneumophila str. Lens complete genome	50	0.002
129	emb|CR380954.1| Candida glabrata strain CBS138 chromosome H comp...	50	0.002
130	gb|DQ087466.1| Leucosolenia sp. KP-2005 ATP synthase beta subuni...	50	0.002
131	emb|AJ719809.1| Gallus gallus mRNA for hypothetical protein, clo...	50	0.002
132	gb|CP000282.1| Saccharophagus degradans 2-40, complete genome	50	0.002
133	dbj|AB226303.1| Aspergillus oryzae cDNA, contig sequence: AoEST3165	50	0.002
134	dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010	50	0.002
135	ref|XM_320445.2| Anopheles gambiae str. PEST ENSANGP00000016863 ...	50	0.002
136	ref|XM_320446.1| Anopheles gambiae str. PEST ENSANGP00000024137 ...	50	0.002
137	ref|XM_320423.2| Anopheles gambiae str. PEST ENSANGP00000016868 ...	50	0.002
138	dbj|AK108995.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.002
139	gb|U46215.1|SCU46215 Saccharomyces cerevisiae D273-10B F1-ATPase...	50	0.002
140	gb|M12082.1|YSCATP21 Yeast (S.cerevisiae) nuclear ATP2 gene enco...	50	0.002
141	gb|K00560.1|YSCATP2 yeast (s.cerevisiae) mitochondrial atpase be...	50	0.002
142	gb|CP000025.1| Campylobacter jejuni RM1221, complete genome	48	0.007
143	gb|BC087041.1| Rattus norvegicus cDNA clone IMAGE:7106871, conta...	48	0.007
144	gb|DQ228960.1| Toxoplasma gondii mitochondrial F1-ATP synthase b...	48	0.007
145	gb|AC166817.3| Mus musculus BAC clone RP24-530C16 from chromosom...	48	0.007
146	gb|BC016512.1| Homo sapiens ATP synthase, H+ transporting, mitoc...	48	0.007
147	ref|NM_134364.1| Rattus norvegicus ATP synthase, H+ transporting...	48	0.007
148	ref|XM_654827.1| Aspergillus nidulans FGSC A4 ATP synthase subun...	48	0.007
149	gb|AY580293.1| Ptychodera flava ATP synthase beta subunit mRNA, ...	48	0.007
150	gb|AY580175.1| Asterina miniata ATP synthase beta subunit mRNA, ...	48	0.007
151	gb|BC013253.1| Mus musculus ATP synthase, H+ transporting mitoch...	48	0.007
152	gb|AC090681.13| Homo sapiens 12 BAC RP11-369C14 (Roswell Park Ca...	48	0.007
153	gb|BC037127.1| Mus musculus ATP synthase, H+ transporting mitoch...	48	0.007
154	gb|BC099743.1| Rattus norvegicus ATP synthase, H+ transporting, ...	48	0.007
155	emb|X05606.1|HSATPB Human mRNA fragment for ATP synthetase beta-...	48	0.007
156	emb|X03559.1|HSATPFIB Human mRNA for F1-ATPase beta subunit (F-1...	48	0.007
157	gb|DQ087446.1| Cerebratulus lacteus ATP synthase beta subunit mR...	48	0.007
158	emb|CR615964.1| full-length cDNA clone CS0DA007YB22 of Neuroblas...	48	0.007
159	emb|CR615631.1| full-length cDNA clone CS0DG004YI11 of B cells (...	48	0.007
160	emb|CR626774.1| full-length cDNA clone CS0DA007YG13 of Neuroblas...	48	0.007
161	emb|CR626584.1| full-length cDNA clone CL0BB028ZB11 of Neuroblas...	48	0.007
162	emb|CR626365.1| full-length cDNA clone CS0DF038YK02 of Fetal bra...	48	0.007
163	emb|CR624633.1| full-length cDNA clone CS0DA009YB03 of Neuroblas...	48	0.007
164	emb|CR625698.1| full-length cDNA clone CS0DE006YI17 of Placenta ...	48	0.007
165	emb|CR625161.1| full-length cDNA clone CS0DN004YJ22 of Adult bra...	48	0.007
166	emb|CR625069.1| full-length cDNA clone CS0DJ010YG06 of T cells (...	48	0.007
167	emb|CR624993.1| full-length cDNA clone CL0BB016ZB02 of Neuroblas...	48	0.007
168	emb|CR624825.1| full-length cDNA clone CS0CAP003YB05 of Thymus o...	48	0.007
169	emb|CR624581.1| full-length cDNA clone CS0DA007YF24 of Neuroblas...	48	0.007
170	emb|CR624353.1| full-length cDNA clone CS0DA001YE22 of Neuroblas...	48	0.007
171	emb|CR623794.1| full-length cDNA clone CS0DG006YE01 of B cells (...	48	0.007
172	emb|CR623765.1| full-length cDNA clone CS0DH002YL16 of T cells (...	48	0.007
173	emb|CR623584.1| full-length cDNA clone CS0DA007YC17 of Neuroblas...	48	0.007
174	emb|CR622605.1| full-length cDNA clone CS0DH003YM11 of T cells (...	48	0.007
175	emb|CR621900.1| full-length cDNA clone CS0DF028YA05 of Fetal bra...	48	0.007
176	emb|CR621538.1| full-length cDNA clone CS0DF008YB01 of Fetal bra...	48	0.007
177	dbj|AK127078.1| Homo sapiens cDNA FLJ45135 fis, clone BRAWH30382...	48	0.007
178	emb|CR621144.1| full-length cDNA clone CS0DN003YE18 of Adult bra...	48	0.007
179	emb|CR621061.1| full-length cDNA clone CS0DI066YH08 of Placenta ...	48	0.007
180	emb|CR620227.1| full-length cDNA clone CS0DI001YB20 of Placenta ...	48	0.007
181	emb|CR619791.1| full-length cDNA clone CS0DM003YB20 of Fetal liv...	48	0.007
182	emb|CR619766.1| full-length cDNA clone CS0DA012YH03 of Neuroblas...	48	0.007
183	emb|CR619267.1| full-length cDNA clone CS0DI054YI24 of Placenta ...	48	0.007
184	emb|CR617438.1| full-length cDNA clone CS0DA012YG12 of Neuroblas...	48	0.007
185	emb|CR617726.1| full-length cDNA clone CS0DI066YL08 of Placenta ...	48	0.007
186	emb|CR615488.1| full-length cDNA clone CS0DF030YP14 of Fetal bra...	48	0.007
187	emb|CR616381.1| full-length cDNA clone CL0BB023ZD05 of Neuroblas...	48	0.007
188	emb|CR615169.1| full-length cDNA clone CS0DI009YF23 of Placenta ...	48	0.007
189	emb|CR614784.1| full-length cDNA clone CS0DI012YB03 of Placenta ...	48	0.007
190	emb|CR614182.1| full-length cDNA clone CS0DF002YI09 of Fetal bra...	48	0.007
191	emb|CR613578.1| full-length cDNA clone CS0DI073YA21 of Placenta ...	48	0.007
192	emb|CR609559.1| full-length cDNA clone CS0DG006YC05 of B cells (...	48	0.007
193	emb|CR613316.1| full-length cDNA clone CS0DF015YF22 of Fetal bra...	48	0.007
194	emb|CR612947.1| full-length cDNA clone CS0DE010YJ12 of Placenta ...	48	0.007
195	emb|CR612886.1| full-length cDNA clone CS0DA008YH19 of Neuroblas...	48	0.007
196	emb|CR611938.1| full-length cDNA clone CS0DI060YI05 of Placenta ...	48	0.007
197	emb|CR611417.1| full-length cDNA clone CS0DA003YG11 of Neuroblas...	48	0.007
198	emb|CR611415.1| full-length cDNA clone CS0DF037YC19 of Fetal bra...	48	0.007
199	emb|CR611259.1| full-length cDNA clone CS0DG002YL07 of B cells (...	48	0.007
200	emb|CR609220.1| full-length cDNA clone CS0DG002YG10 of B cells (...	48	0.007
201	emb|CR609212.1| full-length cDNA clone CS0DE007YC20 of Placenta ...	48	0.007
202	emb|CR609186.1| full-length cDNA clone CS0DI037YM20 of Placenta ...	48	0.007
203	emb|CR607778.1| full-length cDNA clone CS0DA002YL04 of Neuroblas...	48	0.007
204	emb|CR608193.1| full-length cDNA clone CS0DE002YH17 of Placenta ...	48	0.007
205	emb|CR608124.1| full-length cDNA clone CS0DN004YF13 of Adult bra...	48	0.007
206	emb|CR607664.1| full-length cDNA clone CS0DA001YJ16 of Neuroblas...	48	0.007
207	emb|CR604659.1| full-length cDNA clone CS0DG006YJ02 of B cells (...	48	0.007
208	emb|CR605146.1| full-length cDNA clone CS0DA005YB21 of Neuroblas...	48	0.007
209	emb|CR605104.1| full-length cDNA clone CS0DJ003YI03 of T cells (...	48	0.007
210	emb|CR605483.1| full-length cDNA clone CS0DA004YB01 of Neuroblas...	48	0.007
211	emb|CR605460.1| full-length cDNA clone CS0DA012YF09 of Neuroblas...	48	0.007
212	emb|CR605250.1| full-length cDNA clone CS0DA005YJ03 of Neuroblas...	48	0.007
213	emb|CR603704.1| full-length cDNA clone CS0DG001YA04 of B cells (...	48	0.007
214	emb|CR602930.1| full-length cDNA clone CS0DH005YN05 of T cells (...	48	0.007
215	emb|CR603074.1| full-length cDNA clone CS0DM003YL13 of Fetal liv...	48	0.007
216	emb|CR602257.1| full-length cDNA clone CS0DF038YF18 of Fetal bra...	48	0.007
217	emb|CR601166.1| full-length cDNA clone CS0DI053YF24 of Placenta ...	48	0.007
218	emb|CR600999.1| full-length cDNA clone CS0DF034YI21 of Fetal bra...	48	0.007
219	emb|CR600712.1| full-length cDNA clone CS0DA011YD08 of Neuroblas...	48	0.007
220	emb|CR600201.1| full-length cDNA clone CS0DI035YL24 of Placenta ...	48	0.007
221	emb|CR597668.1| full-length cDNA clone CS0DI033YL08 of Placenta ...	48	0.007
222	emb|CR597508.1| full-length cDNA clone CS0DF014YA14 of Fetal bra...	48	0.007
223	emb|CR596952.1| full-length cDNA clone CS0DF030YJ06 of Fetal bra...	48	0.007
224	emb|CR596818.1| full-length cDNA clone CS0DK004YL09 of HeLa cell...	48	0.007
225	emb|CR595794.1| full-length cDNA clone CS0DF025YF17 of Fetal bra...	48	0.007
226	emb|CR595373.1| full-length cDNA clone CS0DE001YF20 of Placenta ...	48	0.007
227	emb|CR595274.1| full-length cDNA clone CL0BB003ZC04 of Neuroblas...	48	0.007
228	emb|CR594107.1| full-length cDNA clone CS0DA004YM04 of Neuroblas...	48	0.007
229	emb|CR594490.1| full-length cDNA clone CS0DG002YJ20 of B cells (...	48	0.007
230	emb|CR593868.1| full-length cDNA clone CS0DA005YK09 of Neuroblas...	48	0.007
231	emb|CR591449.1| full-length cDNA clone CS0DF036YN07 of Fetal bra...	48	0.007
232	emb|CR590902.1| full-length cDNA clone CS0DF036YA16 of Fetal bra...	48	0.007
233	emb|CR590194.1| full-length cDNA clone CS0DA011YI09 of Neuroblas...	48	0.007
234	dbj|AB206839.1| Acidithiobacillus ferrooxidans atpI, atpB, atpE,...	48	0.007
235	dbj|AK151081.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
236	dbj|AK152976.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
237	dbj|AK148891.1| Mus musculus 2 days neonate sympathetic ganglion...	48	0.007
238	dbj|AK159444.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	48	0.007
239	dbj|AK152788.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
240	dbj|AK152730.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
241	dbj|AK151600.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
242	dbj|AK150599.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
243	dbj|AK145684.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	48	0.007
244	dbj|AK160199.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	48	0.007
245	dbj|AK167764.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	48	0.007
246	dbj|AK167728.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu...	48	0.007
247	dbj|AK164383.1| Mus musculus 12 days embryo spinal ganglion cDNA...	48	0.007
248	dbj|AK168941.1| Mus musculus 17 days pregnant adult female amnio...	48	0.007
249	dbj|AK153099.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	48	0.007
250	dbj|AK159978.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	48	0.007
251	dbj|AK168692.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f...	48	0.007
252	dbj|AK166603.1| Mus musculus 4 days embryo whole body cDNA, RIKE...	48	0.007
253	dbj|AK166525.1| Mus musculus 5 days embryo whole body cDNA, RIKE...	48	0.007
254	dbj|AK159737.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	48	0.007
255	dbj|AK160608.1| Mus musculus 10 days embryo whole body cDNA, RIK...	48	0.007
256	dbj|AK167160.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	48	0.007
257	dbj|AK167119.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	48	0.007
258	dbj|AK166979.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	48	0.007
259	dbj|AK169184.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu...	48	0.007
260	dbj|AK003460.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	48	0.007
261	gb|M27132.1|HUMATPSYB Homo sapiens ATP synthase beta subunit pre...	48	0.007
262	dbj|AK010314.1| Mus musculus ES cells cDNA, RIKEN full-length en...	48	0.007
263	dbj|AK084009.1| Mus musculus 12 days embryo spinal ganglion cDNA...	48	0.007
264	dbj|AK002621.1| Mus musculus adult male kidney cDNA, RIKEN full-...	48	0.007
265	dbj|AK083276.1| Mus musculus adult male hippocampus cDNA, RIKEN ...	48	0.007
266	dbj|AK011035.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	48	0.007
267	dbj|AK220050.1| Mus musculus cDNA, clone:Y2G0150J23, strand:minu...	48	0.007
268	dbj|AK220031.1| Mus musculus cDNA, clone:Y2G0150I22, strand:minu...	48	0.007
269	dbj|AK217971.1| Mus musculus cDNA, clone:Y2G0143J16, strand:minu...	48	0.007
270	dbj|AK216817.1| Mus musculus cDNA, clone:Y2G0139K08, strand:minu...	48	0.007
271	dbj|AK212560.1| Mus musculus cDNA, clone:Y2G0125F24, strand:minu...	48	0.007
272	dbj|AK201737.1| Mus musculus cDNA, clone:Y1G0139D09, strand:minu...	48	0.007
273	dbj|AK193315.1| Mus musculus cDNA, clone:Y1G0111M24, strand:minu...	48	0.007
274	gb|AF030559.1|AF030559 Mus musculus ATP synthase beta-subunit (b...	48	0.007
275	dbj|AK130793.1| Homo sapiens cDNA FLJ27283 fis, clone TMS01431, ...	48	0.007
276	ref|NM_208470.1| Eremothecium gossypii ABR169Wp (ABR169W), mRNA	48	0.007
277	ref|NM_001686.3| Homo sapiens ATP synthase, H+ transporting, mit...	48	0.007
278	ref|NM_016774.2| Mus musculus ATP synthase, H+ transporting mito...	48	0.007
279	emb|AL139074.2|CJ11168X1 Campylobacter jejuni subsp. jejuni NCTC...	48	0.007
280	gb|AC131120.4| Mus musculus BAC clone RP24-547N4 from 10, comple...	48	0.007
281	gb|BC046616.1| Mus musculus ATP synthase, H+ transporting mitoch...	48	0.007
282	gb|M19044.1|RATMTATPSA Rat mitochondrial ATP synthase beta subun...	48	0.007
283	gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	48	0.007
284	gb|M81087.1|TFEUNCAH Thiobacillus ferrooxidans F1F0-ATPase c sub...	48	0.007
285	gb|M57634.1|RATATPASEF Rat F1-ATPase beta subunit mRNA, 3' end	48	0.007
286	dbj|D00022.1|HUMF1B Homo sapiens mRNA for F1 beta subunit, compl...	48	0.007
287	gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete...	46	0.029
288	ref|XM_641310.1| Dictyostelium discoideum hypothetical protein (...	46	0.029
289	gb|AF106591.3| Caenorhabditis elegans cosmid T01A4, complete seq...	46	0.029
290	gb|AE017197.1| Rickettsia typhi str. Wilmington complete genome	46	0.029
291	gb|AY580306.1| Monosiga brevicollis ATP synthase beta subunit mR...	46	0.029
292	gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome	46	0.029
293	emb|Z99122.2|BSUB0019 Bacillus subtilis complete genome (section...	46	0.029
294	emb|Z28592.1|BSATPASE B.subtilis (168) atpase genes for ATP synt...	46	0.029
295	gb|AC010066.9| Drosophila melanogaster 3L BAC RPCI98-25O1 (Roswe...	46	0.029
296	ref|NM_140579.1| Drosophila melanogaster CG5389-RA (CG5389), mRNA	46	0.029
297	gb|AY089257.1| Drosophila melanogaster AT04467 full insert cDNA	46	0.029
298	gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete ...	46	0.029
299	ref|NM_058976.2| Caenorhabditis elegans T01A4.3 (T01A4.3) mRNA, ...	46	0.029
300	gb|AE003528.3| Drosophila melanogaster chromosome 3L, section 57...	46	0.029
301	gb|AY296242.1| Bisgaard Taxon 14 ATP synthase beta subunit gene,...	44	0.11
302	gb|AY296230.1| Mannheimia haemolytica ATP synthase beta subunit ...	44	0.11
303	gb|AY296229.1| Mannheimia sp. P373 ATP synthase beta subunit gen...	44	0.11
304	gb|AY580237.1| Obelia sp. KJP-2004 ATP synthase beta subunit mRN...	44	0.11
305	ref|XM_760823.1| Theileria parva strain Muguga chromosome 1 ATP ...	44	0.11
306	gb|DQ087459.1| Sycon lingua ATP synthase beta subunit mRNA, part...	44	0.11
307	dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, comple...	44	0.11
308	emb|BX537347.12| Zebrafish DNA sequence from clone RP71-78P1 in ...	44	0.11
309	gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome	42	0.45
310	gb|AF059739.1| Lactococcus lactis subsp. cremoris lipase (lip) g...	42	0.45
311	gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr...	42	0.45
312	gb|AY296237.1| Bisgaard Taxon 17 ATP synthase beta subunit gene,...	42	0.45
313	gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph...	42	0.45
314	gb|AE017308.1| Mycoplasma mobile 163K complete genome	42	0.45
315	ref|XM_958160.1| Neurospora crassa OR74A ATP SYNTHASE BETA CHAIN...	42	0.45
316	ref|XM_460631.1| Debaryomyces hansenii CBS767 hypothetical prote...	42	0.45
317	ref|XM_325284.1| Neurospora crassa OR74A ATP SYNTHASE BETA CHAIN...	42	0.45
318	gb|BC116099.1| Bos taurus ATP synthase, H+ transporting, mitocho...	42	0.45
319	gb|CP000114.1| Streptococcus agalactiae A909, complete genome	42	0.45
320	gb|AY580244.1| Metridium senile ATP synthase beta subunit mRNA, ...	42	0.45
321	ref|XM_571472.1| Cryptococcus neoformans var. neoformans JEC21 h...	42	0.45
322	gb|AY223301.1| Schistosoma japonicum clone ZZD560 mRNA sequence	42	0.45
323	emb|BX039693.1|CNS092SH Single read from an extremity of a full-...	42	0.45
324	gb|AE014231.1| Streptococcus agalactiae 2603V/R section 41 of 10...	42	0.45
325	emb|BX014259.1|CNS08J5Z Single read from an extremity of a full-...	42	0.45
326	emb|X53720.1|NCF1ATPB Neurospora crassa mRNA for mitochondrial F...	42	0.45
327	emb|CR628336.1| Legionella pneumophila str. Paris complete genome	42	0.45
328	emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS...	42	0.45
329	emb|AL766847.1|SAG766847 Streptococcus agalactiae NEM316 complet...	42	0.45
330	emb|AL355933.1|NCB8B20 Neurospora crassa DNA linkage group II BA...	42	0.45
331	emb|AL132798.2|SPAC222 S.pombe chromosome I cosmid c222	42	0.45
332	emb|AL645788.6| Zebrafish DNA sequence from clone BUSM1-17K08 Co...	42	0.45
333	gb|DQ416018.1| Acyrthosiphon pisum putative ATP synthase beta su...	42	0.45
334	ref|NM_001018548.1| Schizosaccharomyces pombe 972h- hypothetical...	42	0.45
335	gb|AE010300.1| Leptospira interrogans serovar lai str. 56601 chr...	42	0.45
336	emb|AL116755.1|CNS01DFF Botrytis cinerea strain T4 cDNA library	42	0.45
337	emb|AL116140.1|CNS01CYC Botrytis cinerea strain T4 cDNA library	42	0.45
338	emb|AL112566.1|CNS01A72 Botrytis cinerea strain T4 cDNA library	42	0.45
339	emb|AL112367.1|CNS01A1J Botrytis cinerea strain T4 cDNA library	42	0.45
340	ref|NM_175796.2| Bos taurus ATP synthase, H+ transporting, mitoc...	42	0.45
341	gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F...	42	0.45
342	emb|CR394550.5| Zebrafish DNA sequence from clone CH211-231O11 i...	42	0.45
343	gb|CP000030.1| Anaplasma marginale str. St. Maries, complete genome	42	0.45
344	emb|X05605.1|BTATPB Bovine mRNA fragment for ATP synthetase beta...	42	0.45
345	gb|M19483.1|HUMATPSY2 Human ATP synthase beta subunit gene, exon...	42	0.45
346	gb|M84192.1|NEUATPB N.crassa mitochondrial ATPase beta-subunit (...	42	0.45
347	gb|M20929.1|BOVATPF1A Bovine F-1-ATPase beta-subunit mRNA, compl...	42	0.45
348	gb|M86384.1|PCLATPBE Prochloron didemni ATP synthase beta and ep...	42	0.45
349	dbj|AB072443.1| Lactococcus lactis subsp. lactis lip gene and H+...	42	0.45
350	gb|AY440820.1| Armigeres subalbatus ASAP ID: 40489 ATP synthase ...	40	1.8
351	gb|AY296244.1| Pasteurella caballi ATP synthase beta subunit gen...	40	1.8
352	gb|DQ440233.1| Aedes aegypti clone AET-272 F0F1-type ATP synthas...	40	1.8
353	gb|AY580182.1| Chaetopterus sp. KJP-2000 ATP synthase beta subun...	40	1.8
354	gb|AY580168.1| Antedon mediterranea ATP synthase beta subunit mR...	40	1.8
355	gb|AC166990.3| Mus musculus BAC clone RP24-173K24 from chromosom...	40	1.8
356	ref|XM_852839.1| PREDICTED: Canis familiaris ATP synthase, H+ tr...	40	1.8
357	ref|XM_852798.1| PREDICTED: Canis familiaris ATP synthase, H+ tr...	40	1.8
358	ref|XM_531639.2| PREDICTED: Canis familiaris ATP synthase, H+ tr...	40	1.8
359	ref|XM_852723.1| PREDICTED: Canis familiaris ATP synthase, H+ tr...	40	1.8
360	emb|AJ235273.1|RPXX04 Rickettsia prowazekii strain Madrid E, com...	40	1.8
361	gb|AF025802.1|AF025802 Drosophila subobscura ATP synthase beta s...	40	1.8
362	gb|AF025801.1|AF025801 Drosophila pseudoobscura ATP synthase bet...	40	1.8
363	dbj|AK217965.1| Mus musculus cDNA, clone:Y2G0143J06, strand:plus...	40	1.8
364	dbj|AK213511.1| Mus musculus cDNA, clone:Y2G0128I22, strand:minu...	40	1.8
365	emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E ...	40	1.8
366	gb|AC158523.2| Mus musculus BAC clone RP23-371I11 from chromosom...	40	1.8
367	gb|AY838453.1| Theromyzon tessulatum mitochondrial ATP synthase ...	38	7.0
368	gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet...	38	7.0
369	gb|CP000082.1| Psychrobacter arcticus 273-4, complete genome	38	7.0
370	emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome	38	7.0
371	ref|XM_812741.1| Trypanosoma cruzi strain CL Brener ATPase beta ...	38	7.0
372	ref|XM_799305.1| Trypanosoma cruzi strain CL Brener ATPase beta ...	38	7.0
373	ref|XM_763529.1| Giardia lamblia ATCC 50803 hypothetical protein...	38	7.0
374	gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome	38	7.0
375	emb|AL592483.6| Human DNA sequence from clone RP11-815M8 on chro...	38	7.0
376	emb|BX063641.1|CNS09L9P Single read from an extremity of a full-...	38	7.0
377	emb|BX055309.1|CNS09EU9 Single read from an extremity of a full-...	38	7.0
378	emb|BX051804.1|CNS09C4W Single read from an extremity of a full-...	38	7.0
379	emb|BX045272.1|CNS0973G Single read from an extremity of a full-...	38	7.0
380	emb|BX045233.1|CNS0972D Single read from an extremity of a full-...	38	7.0
381	emb|BX042290.1|CNS094SM Single read from an extremity of a full-...	38	7.0
382	emb|BX028512.1|CNS08U5W Single read from an extremity of a full-...	38	7.0
383	emb|X76878.1|PN20487 P.niger (DSM 20475) ATPase beta-subunit gene	38	7.0
384	gb|DQ087486.1| Haliotis rufenscens ATP synthase beta subunit mRN...	38	7.0
385	emb|BX248584.1| Blochmannia floridanus complete genome; segment 1/3	38	7.0
386	emb|AL935258.1| Lactobacillus plantarum strain WCFS1 complete ge...	38	7.0
387	gb|AC132216.7| Homo sapiens chromosome 11, clone RP13-786C16, co...	38	7.0
388	gb|AC145418.5| Dasypus novemcinctus clone VMRC5-458M22, complete...	38	7.0
389	dbj|AB015477.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	38	7.0
390	emb|AL591983.1| Listeria monocytogenes strain EGD, complete geno...	38	7.0
391	dbj|AB006151.1| Ruminococcus albus proton-translocating ATPase, ...	38	7.0

---

>emb|X74545.1|TAATP2 T.aestivum atp-2 mRNA for ATP synthase beta subunit
          Length = 1891

 Score =  232 bits (117), Expect = 2e-58
 Identities = 126/129 (97%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Sbjct: 1472 ctggatcttccttgcacgagcaaccgtcatcttatcatcttcactgagctcatccatacc 1413

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1412 caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctggacaccacg 1353

                     
Query: 122  ggcagtgtt 130
            |||||||||
Sbjct: 1352 ggcagtgtt 1344

---

>gb|BT018722.1| Zea mays clone EL01N0518D08.d mRNA sequence
          Length = 1977

 Score =  172 bits (87), Expect = 2e-40
 Identities = 117/127 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 1489 gctgaatctttcttgcacgagcgaccgtcaacttgtcatcctcactgagctcatccatac 1430

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            |||| || ||||| |||||||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 1429 ccaagatagcaataatatcctgaagatttttgtagttctgaagaaccttctgaacaccac 1370

                   
Query: 121  gggcagt 127
            | |||||
Sbjct: 1369 gagcagt 1363

---

>gb|AY103634.1| Zea mays PCO073309 mRNA sequence
          Length = 1799

 Score =  172 bits (87), Expect = 2e-40
 Identities = 117/127 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 1284 gctgaatctttcttgcacgagcgaccgtcaacttgtcatcctcactgagctcatccatac 1225

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            |||| || ||||| |||||||||||||| ||||||||||||||||||||||| |||||||
Sbjct: 1224 ccaagatagcaataatatcctgaagatttttgtagttctgaagaaccttctgaacaccac 1165

                   
Query: 121  gggcagt 127
            | |||||
Sbjct: 1164 gagcagt 1158

---

>ref|XM_475868.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1659

 Score =  170 bits (86), Expect = 7e-40
 Identities = 119/130 (91%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||||||||||||||| ||||| || |||||||| ||||| ||||||||||| |||||||
Sbjct: 1453 gctggatcttccttgcgcgagcgacggtcaacttgtcatcttcactgagctcgtccatac 1394

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||||||| ||||| ||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 1393 ccaaaattgcaataatatcctgaagattcttgtagttctgaagaaccttttggacaccac 1334

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1333 gagcagtgtt 1324

---

>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23,
              complete sequence
          Length = 191765

 Score =  170 bits (86), Expect = 7e-40
 Identities = 119/130 (91%)
 Strand = Plus / Plus

                                                                          
Query: 1      gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
              |||||||||||||||| ||||| || |||||||| ||||| ||||||||||| |||||||
Sbjct: 165219 gctggatcttccttgcgcgagcgacggtcaacttgtcatcttcactgagctcgtccatac 165278

                                                                          
Query: 61     ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
              ||||||| ||||| ||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 165279 ccaaaattgcaataatatcctgaagattcttgtagttctgaagaaccttttggacaccac 165338

                        
Query: 121    gggcagtgtt 130
              | ||||||||
Sbjct: 165339 gagcagtgtt 165348

---

>gb|AC093956.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1263_E10,
            complete sequence
          Length = 116469

 Score =  170 bits (86), Expect = 7e-40
 Identities = 119/130 (91%)
 Strand = Plus / Plus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||||||||||||||| ||||| || |||||||| ||||| ||||||||||| |||||||
Sbjct: 2708 gctggatcttccttgcgcgagcgacggtcaacttgtcatcttcactgagctcgtccatac 2767

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||||||| ||||| ||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 2768 ccaaaattgcaataatatcctgaagattcttgtagttctgaagaaccttttggacaccac 2827

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 2828 gagcagtgtt 2837

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  170 bits (86), Expect = 7e-40
 Identities = 119/130 (91%)
 Strand = Plus / Plus

                                                                            
Query: 1        gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
                |||||||||||||||| ||||| || |||||||| ||||| ||||||||||| |||||||
Sbjct: 27290251 gctggatcttccttgcgcgagcgacggtcaacttgtcatcttcactgagctcgtccatac 27290310

                                                                            
Query: 61       ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
                ||||||| ||||| ||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 27290311 ccaaaattgcaataatatcctgaagattcttgtagttctgaagaaccttttggacaccac 27290370

                          
Query: 121      gggcagtgtt 130
                | ||||||||
Sbjct: 27290371 gagcagtgtt 27290380

---

>dbj|AK061681.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A03, full
            insert sequence
          Length = 1973

 Score =  170 bits (86), Expect = 7e-40
 Identities = 119/130 (91%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||||||||||||||| ||||| || |||||||| ||||| ||||||||||| |||||||
Sbjct: 1503 gctggatcttccttgcgcgagcgacggtcaacttgtcatcttcactgagctcgtccatac 1444

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||||||| ||||| ||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 1443 ccaaaattgcaataatatcctgaagattcttgtagttctgaagaaccttttggacaccac 1384

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1383 gagcagtgtt 1374

---

>gb|BT016806.1| Zea mays clone Contig639 mRNA sequence
          Length = 2139

 Score =  163 bits (82), Expect = 2e-37
 Identities = 118/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| ||||| |||||||| || || |||| ||| |||||||||||||||||||||||||
Sbjct: 1508 gctgaatctttcttgcacgggcgactgtcagcttgtcatcctcactgagctcatccatac 1449

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            |||| || ||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1448 ccaagatagcaataatatcctgaagatttttgtagttctgaagaaccttctgcacaccac 1389

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1388 gagcagtgtt 1379

---

>emb|X54233.1|ZMATP2MT Maize ATP2 mRNA for mitochondrial ATP synthase beta subunit
          Length = 2029

 Score =  163 bits (82), Expect = 2e-37
 Identities = 118/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| ||||| |||||||| || || |||| ||| |||||||||||||||||||||||||
Sbjct: 1509 gctgaatctttcttgcacgggcgactgtcagcttgtcatcctcactgagctcatccatac 1450

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            |||| || ||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1449 ccaagatagcaataatatcctgaagatttttgtagttctgaagaaccttctgcacaccac 1390

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1389 gagcagtgtt 1380

---

>gb|M36087.1|MZEMT2BATP Zea mays mitochondrial F-1-ATPase subunit 2 mRNA, complete cds;
            nuclear gene for mitochondrial product
          Length = 2054

 Score =  163 bits (82), Expect = 2e-37
 Identities = 118/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| ||||| |||||||| || || |||| ||| |||||||||||||||||||||||||
Sbjct: 1461 gctgaatctttcttgcacgggcgactgtcagcttgtcatcctcactgagctcatccatac 1402

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            |||| || ||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1401 ccaagatagcaataatatcctgaagatttttgtagttctgaagaaccttctgcacaccac 1342

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1341 gagcagtgtt 1332

---

>ref|NM_192090.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1668

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| |||||||| |||||||| || |||||||||||||||||||||||||| ||||| |
Sbjct: 1462 gctgaatcttcctagcacgagcgactgtcaacttatcatcctcactgagctcgtccattc 1403

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||| ||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||
Sbjct: 1402 ccagaatggcaataatatcttgaagattcttgtaattctgaagaaccttctgaacaccac 1343

                      
Query: 121  gggcagtgtt 130
            | || |||||
Sbjct: 1342 gagctgtgtt 1333

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                            
Query: 1        gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
                |||| |||||||| |||||||| || |||||||||||||||||||||||||| ||||| |
Sbjct: 28274052 gctgaatcttcctagcacgagcgactgtcaacttatcatcctcactgagctcgtccattc 28273993

                                                                            
Query: 61       ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
                ||| ||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||
Sbjct: 28273992 ccagaatggcaataatatcttgaagattcttgtaattctgaagaaccttctgaacaccac 28273933

                          
Query: 121      gggcagtgtt 130
                | || |||||
Sbjct: 28273932 gagctgtgtt 28273923

---

>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0478H03
          Length = 167560

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                          
Query: 1      gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
              |||| |||||||| |||||||| || |||||||||||||||||||||||||| ||||| |
Sbjct: 108559 gctgaatcttcctagcacgagcgactgtcaacttatcatcctcactgagctcgtccattc 108500

                                                                          
Query: 61     ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
              ||| ||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||
Sbjct: 108499 ccagaatggcaataatatcttgaagattcttgtaattctgaagaaccttctgaacaccac 108440

                        
Query: 121    gggcagtgtt 130
              | || |||||
Sbjct: 108439 gagctgtgtt 108430

---

>emb|Y15178.1|SBY15178 Sorghum bicolor F1-ATP synthase, cultivar 2077A, partial
          Length = 1361

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| |||||||| |||||||| ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 1213 gctgaatcttcctagcacgagcgaccgtcaacttgtcatcttcactgagctcatccattc 1154

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||| ||||||||| ||||| || ||||||||||| ||||||||||||||||| |||||||
Sbjct: 1153 ccagaatggcaataatatcttggagattcttgtaattctgaagaaccttctgaacaccac 1094

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1093 gagcagtgtt 1084

---

>dbj|AK071414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093I16, full
            insert sequence
          Length = 1688

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| |||||||| |||||||| || |||||||||||||||||||||||||| ||||| |
Sbjct: 1284 gctgaatcttcctagcacgagcgactgtcaacttatcatcctcactgagctcgtccattc 1225

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||| ||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||
Sbjct: 1224 ccagaatggcaataatatcttgaagattcttgtaattctgaagaaccttctgaacaccac 1165

                      
Query: 121  gggcagtgtt 130
            | || |||||
Sbjct: 1164 gagctgtgtt 1155

---

>dbj|AK064953.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001A02, full
            insert sequence
          Length = 2050

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| |||||||| |||||||| || |||||||||||||||||||||||||| ||||| |
Sbjct: 1579 gctgaatcttcctagcacgagcgactgtcaacttatcatcctcactgagctcgtccattc 1520

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||| ||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||
Sbjct: 1519 ccagaatggcaataatatcttgaagattcttgtaattctgaagaaccttctgaacaccac 1460

                      
Query: 121  gggcagtgtt 130
            | || |||||
Sbjct: 1459 gagctgtgtt 1450

---

>gb|AY108796.1| Zea mays PCO073308 mRNA sequence
          Length = 1147

 Score =  155 bits (78), Expect = 4e-35
 Identities = 117/130 (90%)
 Strand = Plus / Minus

                                                                       
Query: 1   gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
           |||| |||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| |
Sbjct: 678 gctgaatcttcctagcacgagcaactgtcaacttgtcatcttcactgagctcatccattc 619

                                                                       
Query: 61  ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
           ||| ||||||||| ||||| || ||||||||||| ||||||||||||||||| |||||||
Sbjct: 618 ccagaatggcaataatatcttggagattcttgtaattctgaagaaccttctgaacaccac 559

                     
Query: 121 gggcagtgtt 130
           | ||||||||
Sbjct: 558 gagcagtgtt 549

---

>emb|Y15179.1|SBY15179 Sorghum bicolor F1-ATP synthase, cultivar CS3541, partial
          Length = 1361

 Score =  147 bits (74), Expect = 1e-32
 Identities = 116/130 (89%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||| |||||||| |||||||| || |||| ||| ||||| |||||||||||||||||||
Sbjct: 1213 gctgaatcttcctagcacgagcgactgtcagcttgtcatcttcactgagctcatccatac 1154

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            |||| || ||||| |||||||||||||| ||||| ||||||||||||||||| |||||||
Sbjct: 1153 ccaagatagcaataatatcctgaagatttttgtatttctgaagaaccttctgaacaccac 1094

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1093 gagcagtgtt 1084

---

>gb|BT012914.1| Lycopersicon esculentum clone 114032R, mRNA sequence
          Length = 2060

 Score =  139 bits (70), Expect = 3e-30
 Identities = 112/126 (88%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| | |||||| ||||| |||| ||||||||| ||||| ||||||||||||||
Sbjct: 1562 ctggatcttacgtgcacgggcaacagtcatcttatcatcttcactcagctcatccatacc 1503

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| ||||||||||||||||| |||||||| ||||| || |||||
Sbjct: 1502 caaaatggcaataatatcttgaagattcttgtagttttgaagaactttctgtaccccacg 1443

                  
Query: 122  ggcagt 127
             |||||
Sbjct: 1442 agcagt 1437

---

>gb|U96498.1|U96498 Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) gene, nuclear
            gene encoding mitochondrial protein, complete cds
          Length = 5101

 Score =  139 bits (70), Expect = 3e-30
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                        
Query: 14   tgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaat 73
            |||||| ||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 4261 tgcacgggcaacagtcatcttatcatcttcactaagctcatccatacccaaaatggcaat 4202

                                                                  
Query: 74   gatatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagt 127
             ||||| |||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 4201 aatatcttgaagattcttgtagttctgaagaactttctgtaccccacgagcagt 4148

---

>gb|U96497.1|NSU96497 Nicotiana sylvestris ATPase beta subunit (nsatp2.2.1) mRNA, nuclear
            gene encoding mitochondrial protein, complete cds
          Length = 1983

 Score =  139 bits (70), Expect = 3e-30
 Identities = 103/114 (90%)
 Strand = Plus / Minus

                                                                        
Query: 14   tgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaat 73
            |||||| ||||| |||| ||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 1454 tgcacgggcaacagtcatcttatcatcttcactaagctcatccatacccaaaatggcaat 1395

                                                                  
Query: 74   gatatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagt 127
             ||||| |||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 1394 aatatcttgaagattcttgtagttctgaagaactttctgtaccccacgagcagt 1341

---

>dbj|D10491.1|RICATPB Oryza sativa (japonica cultivar-group) mRNA for mitochondrial
            F1-ATPase
          Length = 1929

 Score =  139 bits (70), Expect = 3e-30
 Identities = 115/130 (88%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            |||||||||||||||| |||   || |||||| | ||||| ||||||||||| |||||||
Sbjct: 1464 gctggatcttccttgcgcgacggacggtcaacctgtcatcttcactgagctcgtccatac 1405

                                                                        
Query: 61   ccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccac 120
            ||||||| ||||| ||||||||||||||||||||||||||||||||| | || |||||||
Sbjct: 1404 ccaaaattgcaataatatcctgaagattcttgtagttctgaagaaccctttggacaccac 1345

                      
Query: 121  gggcagtgtt 130
            | ||||||||
Sbjct: 1344 gagcagtgtt 1335

---

>emb|X58498.1|HBATPB H.brasiliensis mRNA for mitochondrial ATP synthase beta-subunit
          Length = 2021

 Score =  131 bits (66), Expect = 6e-28
 Identities = 111/126 (88%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            |||||| |||| ||| || ||||| |||||||| ||||| ||||| ||||||||||| ||
Sbjct: 1503 ctggattttccgtgctcgggcaactgtcaacttgtcatcttcactaagctcatccattcc 1444

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| || |||||||||||||||||||||||||| ||||| |||||
Sbjct: 1443 caaaatggcaataatatcttgcagattcttgtagttctgaagaaccttttgcactccacg 1384

                  
Query: 122  ggcagt 127
             |||||
Sbjct: 1383 agcagt 1378

---

>emb|X02868.1|NPATP21 Nicotiana plubaginifolia atp2-1 gene for mitochondrial ATP synthase
            beta subunit
          Length = 5351

 Score =  131 bits (66), Expect = 6e-28
 Identities = 102/114 (89%)
 Strand = Plus / Minus

                                                                        
Query: 14   tgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaat 73
            |||||| ||||| |||| ||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 3522 tgcacgcgcaactgtcatcttatcatcttcactgagctcatccatacccaaaatagcaat 3463

                                                                  
Query: 74   gatatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagt 127
             ||||| ||||||||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 3462 aatatcttgaagattcttgtagttttgaagaactttctgtaccccacgagcagt 3409

---

>gb|L27812.1|ACTPKIWC Actinidia deliciosa var. deliciosa (pKIWI505) mRNA, complete cds
          Length = 729

 Score =  129 bits (65), Expect = 2e-27
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                       
Query: 18  cgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaatgata 77
           |||||||| |||||||| || || || |||||||||||||| |||||||||||||| |||
Sbjct: 299 cgagcaacagtcaacttgtcgtcttcgctgagctcatccattcccaaaatggcaataata 240

                                                                
Query: 78  tcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagtgtt 130
           || |||||||||||||||||||||||||| ||||| || ||||| ||||||||
Sbjct: 239 tcttgaagattcttgtagttctgaagaactttctgaactccacgagcagtgtt 187

---

>gb|AC144731.15| Medicago truncatula clone mth2-5g18, complete sequence
          Length = 115175

 Score =  121 bits (61), Expect = 6e-25
 Identities = 100/113 (88%)
 Strand = Plus / Plus

                                                                          
Query: 15     gcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaatg 74
              ||||||||||| ||||| |||||||| ||||| ||||||||||| |||||||| ||||||
Sbjct: 113778 gcacgagcaacagtcaatttatcatcttcactaagctcatccattcccaaaatagcaatg 113837

                                                                   
Query: 75     atatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagt 127
              ||||| ||||||||||||||||| |||||||| |  || |||||||| |||||
Sbjct: 113838 atatcttgaagattcttgtagttttgaagaacttgttgtacaccacgagcagt 113890

---

>gb|U96496.1|NSU96496 Nicotiana sylvestris ATPase beta subunit (nsatp2.1.1) mRNA, nuclear
            gene encoding mitochondrial protein, complete cds
          Length = 1987

 Score =  115 bits (58), Expect = 4e-23
 Identities = 100/114 (87%)
 Strand = Plus / Minus

                                                                        
Query: 14   tgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaat 73
            |||||| ||||| |||| |||||| || ||||| |||||||||||||||||||| |||||
Sbjct: 1469 tgcacgggcaacagtcatcttatcgtcttcactaagctcatccatacccaaaatagcaat 1410

                                                                  
Query: 74   gatatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagt 127
             ||||| ||||||||||||||||| |||||||| ||||| || ||||| |||||
Sbjct: 1409 aatatcttgaagattcttgtagttttgaagaactttctgtaccccacgagcagt 1356

---

>dbj|AB003549.1| Pisum sativum mRNA for F1 ATPase, complete cds
          Length = 1978

 Score =  109 bits (55), Expect = 2e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                        
Query: 15   gcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaatg 74
            ||||| ||||| ||||| ||||| || ||||||||||||||||| |||||||| ||||||
Sbjct: 1476 gcacgggcaacagtcaatttatcgtcttcactgagctcatccattcccaaaattgcaatg 1417

                                                           
Query: 75   atatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            ||| | ||||||||||||||||| ||||| || ||||| ||||||||
Sbjct: 1416 ataccttgaagattcttgtagttttgaagtactttctgtacaccacg 1370

---

>ref|NM_120953.2| Arabidopsis thaliana ATP binding / hydrogen-exporting ATPase,
            phosphorylative mechanism / hydrogen-transporting ATP
            synthase, rotational mechanism /> AT5G08670 mRNA,
            complete cds
          Length = 1976

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1491 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1432

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1431 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1372

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1371 agccgtgtt 1363

---

>gb|BT000796.1| Arabidopsis thaliana unknown protein (At5g08670) mRNA, partial cds
          Length = 1596

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1134 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1075

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1074 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1015

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1014 agccgtgtt 1006

---

>gb|AY117269.1| Arabidopsis thaliana unknown protein (At5g08670) mRNA, complete cds
          Length = 1702

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1464 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1405

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1404 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1345

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1344 agccgtgtt 1336

---

>gb|AY080681.1| Arabidopsis thaliana unknown protein (At5g08670) mRNA, complete cds
          Length = 1968

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1480 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1421

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1420 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1361

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1360 agccgtgtt 1352

---

>emb|AL590346.1|ATT2K12 Arabidopsis thaliana DNA chromosome 5, BAC clone T2K12 (ESSA project)
          Length = 82896

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Plus

                                                                         
Query: 2     ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
             ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 20297 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 20356

                                                                         
Query: 62    caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
             |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 20357 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 20416

                      
Query: 122   ggcagtgtt 130
              || |||||
Sbjct: 20417 agccgtgtt 20425



 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                         
Query: 2     ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
             ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 29515 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 29456

                                                                         
Query: 62    caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
             |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 29455 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 29396

                      
Query: 122   ggcagtgtt 130
              ||||||||
Sbjct: 29395 agcagtgtt 29387



 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                         
Query: 2     ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
             ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 25670 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 25611

                                                                         
Query: 62    caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
             ||||||||| || ||||| || | ||||||||| ||||| |  || ||||||||||||||
Sbjct: 25610 caaaatggcgataatatcttgcaaattcttgtaattctgcaacactttctgcacaccacg 25551

                      
Query: 122   ggcagtgtt 130
              || |||||
Sbjct: 25550 agctgtgtt 25542

---

>emb|AJ271468.1|ATH271468 Arabidopsis thaliana mRNA for mitochondrial F1 ATP synthase beta
            subunit (p_beta gene)
          Length = 2533

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 2045 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1986

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1985 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1926

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1925 agccgtgtt 1917

---

>gb|AY113178.1| Arabidopsis thaliana At5g08670/At5g08670 mRNA, complete cds
          Length = 1671

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1464 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1405

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1404 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1345

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1344 agccgtgtt 1336

---

>gb|AY054222.1| Arabidopsis thaliana At5g08670 mRNA, complete cds
          Length = 1948

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1491 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1432

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1431 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1372

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1371 agccgtgtt 1363

---

>dbj|AK118538.1| Arabidopsis thaliana At5g08670 mRNA for putative H+-transporting ATP
            synthase beta chain (mitochondrial), complete cds, clone:
            RAFL19-76-L24
          Length = 1940

 Score =  105 bits (53), Expect = 4e-20
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 1490 ctggatcttacgggcacgggcaacagtcaacttgtcatcttcacttagctcatccatacc 1431

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||| ||||| ||||| || |  |||||||||||||| ||||| |||||||| |||||
Sbjct: 1430 caaaattgcaataatatcttgcaagttcttgtagttctgtagaactttctgcacgccacg 1371

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1370 agccgtgtt 1362

---

>emb|AJ843974.1| Plantago major partial mRNA for mitochondrial F0 ATP synthase beta
           chain (atp2 gene)
          Length = 888

 Score = 99.6 bits (50), Expect = 2e-18
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                       
Query: 15  gcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaatg 74
           ||||| ||||| ||||| || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 352 gcacgtgcaacagtcaatttgtcatcttcactgagctcatccatacccaagatagcaatg 293

                                                             
Query: 75  atatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggc 124
           ||||| |||||||||||||| || || || || || || |||||||||||
Sbjct: 292 atatcttgaagattcttgtaattttggagtactttttgtacaccacgggc 243

---

>emb|X61624.1|CRATP2 Chlamydomonas reinhardtii atp2 (atpB) mRNA
          Length = 2664

 Score = 99.6 bits (50), Expect = 2e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                        
Query: 39   tcctcactgagctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttc 98
            ||||| || |||||||||||||||| ||||||||| |||||||| || |||||||||| |
Sbjct: 1507 tcctcgctcagctcatccatacccagaatggcaataatatcctgcaggttcttgtagtcc 1448

                                      
Query: 99   tgaagaaccttctgcacaccacgggc 124
            || || ||||||||||||||||||||
Sbjct: 1447 tgcagcaccttctgcacaccacgggc 1422

---

>ref|NM_120954.2| Arabidopsis thaliana ATP binding / hydrogen-exporting ATPase,
            phosphorylative mechanism / hydrogen-transporting ATP
            synthase, rotational mechanism /> AT5G08690 mRNA,
            complete cds
          Length = 2007

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1490 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1431

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 1430 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 1371

                     
Query: 122  ggcagtgtt 130
             ||||||||
Sbjct: 1370 agcagtgtt 1362

---

>gb|AY113847.1| Arabidopsis thaliana unknown protein (At5g08690) mRNA, complete cds
          Length = 2023

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1490 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1431

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 1430 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 1371

                     
Query: 122  ggcagtgtt 130
             ||||||||
Sbjct: 1370 agcagtgtt 1362

---

>gb|AY079341.1| Arabidopsis thaliana unknown protein (At5g08690) mRNA, complete cds
          Length = 1702

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1464 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1405

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 1404 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 1345

                     
Query: 122  ggcagtgtt 130
             ||||||||
Sbjct: 1344 agcagtgtt 1336

---

>gb|AY050995.1| Arabidopsis thaliana unknown protein (At5g08690) mRNA, complete cds
          Length = 2001

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1490 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1431

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 1430 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 1371

                     
Query: 122  ggcagtgtt 130
             ||||||||
Sbjct: 1370 agcagtgtt 1362

---

>emb|BX833989.1|CNS09Z5M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL88ZG09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 678

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                       
Query: 2   ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
           ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 221 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 162

                                                                       
Query: 62  caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
           |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 161 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 102

                    
Query: 122 ggcagtgtt 130
            ||||||||
Sbjct: 101 agcagtgtt 93

---

>dbj|AK118582.1| Arabidopsis thaliana At5g08690 mRNA for putative H+-transporting ATP
            synthase beta chain (mitochondrial), complete cds, clone:
            RAFL19-82-J07
          Length = 1917

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 109/129 (84%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1490 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1431

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            |||||||||||| ||||| || | ||| ||||||||||| |  || ||||||||||||||
Sbjct: 1430 caaaatggcaataatatcttgcaaatttttgtagttctgcaacactttctgcacaccacg 1371

                     
Query: 122  ggcagtgtt 130
             ||||||||
Sbjct: 1370 agcagtgtt 1362

---

>ref|XM_694742.1| PREDICTED: Danio rerio similar to ATP synthase beta-subunit
            (LOC571176), mRNA
          Length = 2048

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| | ||||||||| || |||| |||||| ||||||   | ||||||||||||
Sbjct: 1626 ctggatcttacgtgcacgagccacagtcagcttatcctcctcagacaactcatccatacc 1567

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            || ||| |||||||||||||| ||   |||||||| ||| |||| |||||||||||||||
Sbjct: 1566 cagaatagcaatgatatcctgcagggacttgtagtcctggagaatcttctgcacaccacg 1507

               
Query: 122  ggc 124
            |||
Sbjct: 1506 ggc 1504

---

>gb|AY580223.1| Lestes congener ATP synthase beta subunit mRNA, partial cds
          Length = 1026

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 51  tcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttc 110
           ||||||||||||||||| ||||||||||| ||||||  |||||||| |||||||| ||||
Sbjct: 980 tcatccatacccaaaatagcaatgatatcttgaagagacttgtagtcctgaagaatcttc 921

                         
Query: 111 tgcacaccacgggc 124
           || ||||| |||||
Sbjct: 920 tggacacctcgggc 907

---

>ref|NM_147850.2| Arabidopsis thaliana ATP binding / hydrogen-exporting ATPase,
            phosphorylative mechanism / hydrogen-transporting ATP
            synthase, rotational mechanism /> AT5G08680 mRNA,
            complete cds
          Length = 2027

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1537 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1478

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            ||||||||| || ||||| || | ||||||||| ||||| |  || ||||||||||||||
Sbjct: 1477 caaaatggcgataatatcttgcaaattcttgtaattctgcaacactttctgcacaccacg 1418

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1417 agctgtgtt 1409

---

>gb|BT005920.1| Arabidopsis thaliana At5g08680 gene, complete cds
          Length = 1680

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1473 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1414

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            ||||||||| || ||||| || | ||||||||| ||||| |  || ||||||||||||||
Sbjct: 1413 caaaatggcgataatatcttgcaaattcttgtaattctgcaacactttctgcacaccacg 1354

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1353 agctgtgtt 1345

---

>dbj|AK117922.1| Arabidopsis thaliana At5g08680 mRNA for putative H+-transporting ATP
            synthase beta chain (mitochondrial), complete cds, clone:
            RAFL19-10-P09
          Length = 1960

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 107/129 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 1517 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 1458

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            ||||||||| || ||||| || | ||||||||| ||||| |  || ||||||||||||||
Sbjct: 1457 caaaatggcgataatatcttgcaaattcttgtaattctgcaacactttctgcacaccacg 1398

                     
Query: 122  ggcagtgtt 130
             || |||||
Sbjct: 1397 agctgtgtt 1389

---

>gb|U96499.1|U96499 Nicotiana sylvestris ATPase beta subunit (nsatp2.3.1) gene, nuclear
            gene encoding mitochondrial protein, complete cds
          Length = 4384

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 95/113 (84%)
 Strand = Plus / Minus

                                                                        
Query: 15   gcacgagcaaccgtcaacttatcatcctcactgagctcatccatacccaaaatggcaatg 74
            ||||||||||| || |  || ||||| ||||| || |||||||| |||| |||||| || 
Sbjct: 2956 gcacgagcaacagttagtttgtcatcttcactcagttcatccattcccagaatggcgata 2897

                                                                 
Query: 75   atatcctgaagattcttgtagttctgaagaaccttctgcacaccacgggcagt 127
            |||||||| ||||||||||||||||| |||||||| || ||||| || |||||
Sbjct: 2896 atatcctggagattcttgtagttctggagaaccttttgtacacctcgcgcagt 2844

---

>emb|CR734911.2|CNS0GTU6 Tetraodon nigroviridis full-length cDNA
          Length = 1680

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1320 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1261

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1260 ctgcacaccacgggca 1245

---

>emb|CR731188.2|CNS0GR4P Tetraodon nigroviridis full-length cDNA
          Length = 1676

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1317 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1258

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1257 ctgcacaccacgggca 1242

---

>emb|CR730449.2|CNS0GQK6 Tetraodon nigroviridis full-length cDNA
          Length = 1675

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1315 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1256

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1255 ctgcacaccacgggca 1240

---

>emb|CR729021.2|CNS0GPGJ Tetraodon nigroviridis full-length cDNA
          Length = 1685

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1325 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1266

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1265 ctgcacaccacgggca 1250

---

>emb|CR722562.2|CNS0GKH4 Tetraodon nigroviridis full-length cDNA
          Length = 624

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 264 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 205

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 204 ctgcacaccacgggca 189

---

>emb|CR703126.2|CNS0G5HE Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 861 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 802

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 801 ctgcacaccacgggca 786

---

>emb|CR698947.2|CNS0G29B Tetraodon nigroviridis full-length cDNA
          Length = 905

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 544 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 485

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 484 ctgcacaccacgggca 469

---

>emb|CR696789.2|CNS0G0LD Tetraodon nigroviridis full-length cDNA
          Length = 852

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 492 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 433

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 432 ctgcacaccacgggca 417

---

>emb|CR694503.2|CNS0FYTV Tetraodon nigroviridis full-length cDNA
          Length = 1682

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1322 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1263

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1262 ctgcacaccacgggca 1247

---

>emb|CR690119.2|CNS0FVG3 Tetraodon nigroviridis full-length cDNA
          Length = 1338

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1002 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 943

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 942  ctgcacaccacgggca 927

---

>emb|CR689132.2|CNS0FUOO Tetraodon nigroviridis full-length cDNA
          Length = 1350

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 990 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 931

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 930 ctgcacaccacgggca 915

---

>emb|CR680456.2|CNS0FNZO Tetraodon nigroviridis full-length cDNA
          Length = 1262

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 954 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 895

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 894 ctgcacaccacgggca 879

---

>emb|CR680138.2|CNS0FNQU Tetraodon nigroviridis full-length cDNA
          Length = 1672

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1312 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1253

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1252 ctgcacaccacgggca 1237

---

>emb|CR673940.2|CNS0FIZE Tetraodon nigroviridis full-length cDNA
          Length = 1199

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 839 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 780

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 779 ctgcacaccacgggca 764

---

>emb|CR670454.2|CNS0FGAK Tetraodon nigroviridis full-length cDNA
          Length = 1681

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1321 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1262

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1261 ctgcacaccacgggca 1246

---

>emb|CR666515.2|CNS0FD95 Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 861 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 802

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 801 ctgcacaccacgggca 786

---

>emb|CR659396.2|CNS0F7RE Tetraodon nigroviridis full-length cDNA
          Length = 1601

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1241 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1182

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1181 ctgcacaccacgggca 1166

---

>emb|CR658808.2|CNS0F7B2 Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 861 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 802

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 801 ctgcacaccacgggca 786

---

>emb|CR650139.2|CNS0F0M9 Tetraodon nigroviridis full-length cDNA
          Length = 1272

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 910 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 851

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 850 ctgcacaccacgggca 835

---

>emb|CR648745.2|CNS0EZJJ Tetraodon nigroviridis full-length cDNA
          Length = 1639

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1279 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1220

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1219 ctgcacaccacgggca 1204

---

>emb|CR645891.2|CNS0EXC9 Tetraodon nigroviridis full-length cDNA
          Length = 1623

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 1263 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 1204

                            
Query: 110  ctgcacaccacgggca 125
            ||||||||||||||||
Sbjct: 1203 ctgcacaccacgggca 1188

---

>emb|CR645267.2|CNS0EWUX Tetraodon nigroviridis full-length cDNA
          Length = 1236

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 874 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 815

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 814 ctgcacaccacgggca 799

---

>emb|CR641909.2|CNS0EU9N Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 684 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 625

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 624 ctgcacaccacgggca 609

---

>emb|CR639100.2|CNS0ES3M Tetraodon nigroviridis full-length cDNA
          Length = 1045

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||||||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 685 ctcatccatacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 626

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 625 ctgcacaccacgggca 610

---

>emb|X60303.1|DCATPSBS D.carota gene for ATP synthase b subunit
          Length = 3988

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 36   tcatcctcactgagctcatccatacccaaaatggcaatgatatcctgaagattcttgtag 95
            ||||| ||||| ||||| ||||| ||||| |||||||| ||||||||||||||||| || 
Sbjct: 2963 tcatcttcactaagctcgtccatccccaagatggcaataatatcctgaagattcttataa 2904

                                            
Query: 96   ttctgaagaaccttctgcacaccacgggcagt 127
            || || || ||||| || ||||||||||||||
Sbjct: 2903 ttttggaggaccttttgtacaccacgggcagt 2872

---

>gb|BC095620.1| Danio rerio zgc:111961, mRNA (cDNA clone MGC:111961 IMAGE:7256415),
            complete cds
          Length = 1755

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 102/123 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| | ||||||||| || |||| ||||||  |||||   | ||||||||||||
Sbjct: 1369 ctggatcttacgtgcacgagccacagtcagcttatccccctcagacaactcatccatacc 1310

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            || ||| |||||||||||||| ||   |||||||| ||| || | |||||||||||||||
Sbjct: 1309 cagaatagcaatgatatcctgcagggacttgtagtcctggaggatcttctgcacaccacg 1250

               
Query: 122  ggc 124
            |||
Sbjct: 1249 ggc 1247

---

>ref|NM_001024429.1| Danio rerio zgc:111961 (zgc:111961), mRNA
          Length = 1755

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 102/123 (82%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            ||||||||| | ||||||||| || |||| ||||||  |||||   | ||||||||||||
Sbjct: 1369 ctggatcttacgtgcacgagccacagtcagcttatccccctcagacaactcatccatacc 1310

                                                                        
Query: 62   caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
            || ||| |||||||||||||| ||   |||||||| ||| || | |||||||||||||||
Sbjct: 1309 cagaatagcaatgatatcctgcagggacttgtagtcctggaggatcttctgcacaccacg 1250

               
Query: 122  ggc 124
            |||
Sbjct: 1249 ggc 1247

---

>dbj|AK221961.1| Arabidopsis thaliana mRNA for H+-transporting ATP synthase beta
           chain -like protein, complete cds, clone: RAFL22-54-B08
          Length = 1206

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 106/129 (82%)
 Strand = Plus / Minus

                                                                       
Query: 2   ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
           ||||||||| |  ||||| ||||| |||| ||| ||||| ||||| ||||||||||| ||
Sbjct: 736 ctggatcttacgggcacgggcaacagtcagcttgtcatcttcacttagctcatccattcc 677

                                                                       
Query: 62  caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctgcacaccacg 121
           ||||||||| || ||||| || | ||||||||| | ||| |  || ||||||||||||||
Sbjct: 676 caaaatggcgataatatcttgcaaattcttgtaatcctgcaacactttctgcacaccacg 617

                    
Query: 122 ggcagtgtt 130
            || |||||
Sbjct: 616 agctgtgtt 608

---

>emb|CR691590.2|CNS0FWKY Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 71.9 bits (36), Expect = 5e-10
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 50  ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
           ||||||| ||||||||||||||||||| ||||| ||   |||||||| ||| ||||  ||
Sbjct: 871 ctcatccgtacccaaaatggcaatgatgtcctgcagggacttgtagtcctggagaatttt 812

                           
Query: 110 ctgcacaccacgggca 125
           ||||||||||||||||
Sbjct: 811 ctgcacaccacgggca 796

---

>gb|AY580264.1| Modiolus americanus ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 51   tcatccatacccaaaatggcaatgatatcctgaag 85
            |||||||||||||||||||||||||||||||||||
Sbjct: 1103 tcatccatacccaaaatggcaatgatatcctgaag 1069

---

>gb|AY580209.1| Enallagma aspersum ATP synthase beta subunit mRNA, partial cds
          Length = 1041

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 54  tccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctg 112
           ||||||||||| ||||||||||||||||| |||  |||||||| |||||||| ||||||
Sbjct: 977 tccatacccaagatggcaatgatatcctgcagagacttgtagtcctgaagaatcttctg 919

---

>emb|BX004890.11| Zebrafish DNA sequence from clone DKEY-9A6 in linkage group 11,
             complete sequence
          Length = 211406

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                         
Query: 2     ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
             ||||||||| | ||||||||| || |||| |||||| ||||||   | ||||||||||||
Sbjct: 21943 ctggatcttacgtgcacgagccacagtcagcttatcctcctcagacaactcatccatacc 21884

                                  
Query: 62    caaaatggcaatgatatcctg 82
             || ||| ||||||||||||||
Sbjct: 21883 cagaatagcaatgatatcctg 21863



 Score = 38.2 bits (19), Expect = 7.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 102   agaaccttctgcacaccacgggc 124
             |||| ||||||||||||||||||
Sbjct: 21762 agaatcttctgcacaccacgggc 21740

---

>emb|AL928821.6| Zebrafish DNA sequence from clone CH211-127N10, complete sequence
          Length = 153232

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                         
Query: 2     ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
             ||||||||| | ||||||||| || |||| |||||| ||||||   | ||||||||||||
Sbjct: 23940 ctggatcttacgtgcacgagccacagtcagcttatcctcctcagacaactcatccatacc 23881

                                  
Query: 62    caaaatggcaatgatatcctg 82
             || ||| ||||||||||||||
Sbjct: 23880 cagaatagcaatgatatcctg 23860

---

>gb|AY431217.1| Aedes aegypti ASAP ID: 37237 ATP synthase mRNA sequence
          Length = 911

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 51  tcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttc 110
           |||||||||||||  || |||||||||||||||||   |||||||| ||| || | ||||
Sbjct: 364 tcatccatacccaggatagcaatgatatcctgaagggacttgtagtcctggaggatcttc 305

                               
Query: 111 tgcacaccacgggcagtgtt 130
           || |||||||||||| ||||
Sbjct: 304 tggacaccacgggcaatgtt 285

---

>gb|DQ358698.1| Pinctada fucata ATP synthase beta subunit mRNA, complete cds
          Length = 1838

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 51   tcatccatacccaaaatggcaatgatatcctgaag 85
            ||||||||||||||||| |||||||||||||||||
Sbjct: 1338 tcatccatacccaaaatagcaatgatatcctgaag 1304

---

>dbj|AB023582.1| Cyprinus carpio mRNA for ATP synthase beta-subunit, complete cds
          Length = 1777

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                        
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacctt 109
            |||||||||||||| ||| |||||||||||||| ||   |||||||| ||| || | |||
Sbjct: 1314 ctcatccatacccagaatagcaatgatatcctgcagggacttgtagtcctggaggatctt 1255

                           
Query: 110  ctgcacaccacgggc 124
            ||| |||||||||||
Sbjct: 1254 ctggacaccacgggc 1240

---

>ref|XM_967388.1| PREDICTED: Tribolium castaneum similar to CG11154-PA, isoform A
            (LOC661213), mRNA
          Length = 1746

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 1    gctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatac 60
            ||||||||||||| ||||| || ||||||||||| || || |||   ||||| ||||| |
Sbjct: 1365 gctggatcttcctggcacgtgccaccgtcaacttgtcgtcttcagacagctcgtccatgc 1306

                                  
Query: 61   ccaaaatggcaatgatatcctg 82
            |||| |||||||| ||||||||
Sbjct: 1305 ccaagatggcaataatatcctg 1284

---

>gb|BC067388.1| Xenopus tropicalis hypothetical protein MGC76033, mRNA (cDNA clone
            MGC:76033 IMAGE:5384921), complete cds
          Length = 1763

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 50   ctcatccatacccaaaatggcaatgatatcctg 82
            ||||||||||||||| |||||||||||||||||
Sbjct: 1333 ctcatccatacccaagatggcaatgatatcctg 1301

---

>ref|XM_453538.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D10703g predicted mRNA
          Length = 1518

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            |||||||||||||||||||||||||||||
Sbjct: 1265 tcatccatacccaaaatggcaatgatatc 1237

---

>gb|AY580269.1| Mytilus edulis ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            |||||||||||||||||||||||||||||
Sbjct: 1103 tcatccatacccaaaatggcaatgatatc 1075

---

>ref|XM_748496.1| Aspergillus fumigatus Af293 ATP synthase F1, subunit beta
            (Afu5g10550) partial mRNA
          Length = 1560

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 54   tccatacccaaaatggcaatgatatcctg 82
            |||||||||||||||||||||||||||||
Sbjct: 1295 tccatacccaaaatggcaatgatatcctg 1267

---

>ref|XM_384488.1| Gibberella zeae PH-1 chromosome 2 ATPB_NEUCR ATP synthase beta chain,
            mitochondrial precursor (FG04312.1) partial mRNA; nuclear
            gene for mitochondrial product
          Length = 1542

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 50   ctcatccatacccaaaatggcaatgatatcctgaaga 86
            |||||||||||||| ||| ||||||||||||||||||
Sbjct: 1284 ctcatccatacccagaatagcaatgatatcctgaaga 1248

---

>gb|BC046741.1| Xenopus laevis ATP synthase, H+ transporting mitochondrial F1
            complex, beta subunit, mRNA (cDNA clone MGC:53838
            IMAGE:5542544), complete cds
          Length = 1753

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 50   ctcatccatacccaaaatggcaatgatatcctg 82
            ||||||||||||||| |||||||||||||||||
Sbjct: 1354 ctcatccatacccaagatggcaatgatatcctg 1322

---

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1715506

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                           
Query: 51     tcatccatacccaaaatggcaatgatatc 79
              |||||||||||||||||||||||||||||
Sbjct: 913609 tcatccatacccaaaatggcaatgatatc 913637

---

>gb|DQ087473.1| Microciona prolifera ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 2    ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
            |||||||||||| ||||| || || |||| ||| || ||||||  |||||||||||||||
Sbjct: 1152 ctggatcttcctggcacgtgccactgtcagcttgtcgtcctcagagagctcatccatacc 1093

                                 
Query: 62   caaaatggcaatgatatcctg 82
            ||  || |||||||| |||||
Sbjct: 1092 caggatagcaatgatgtcctg 1072

---

>ref|NM_001001256.1| Xenopus tropicalis hypothetical protein MGC76033 (MGC76033), mRNA
          Length = 1763

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 50   ctcatccatacccaaaatggcaatgatatcctg 82
            ||||||||||||||| |||||||||||||||||
Sbjct: 1333 ctcatccatacccaagatggcaatgatatcctg 1301

---

>emb|CR762341.2| Xenopus tropicalis finished cDNA, clone TGas077c21
          Length = 1801

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 50   ctcatccatacccaaaatggcaatgatatcctg 82
            ||||||||||||||| |||||||||||||||||
Sbjct: 1385 ctcatccatacccaagatggcaatgatatcctg 1353

---

>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                           
Query: 54     tccatacccaaaatggcaatgatatcctg 82
              |||||||||||||||||||||||||||||
Sbjct: 236114 tccatacccaaaatggcaatgatatcctg 236086

---

>gb|U37764.1|KLU37764 Kluyveromyces lactis F1 ATPase beta subunit (KlATP2) gene, complete
            cds
          Length = 1518

 Score = 58.0 bits (29), Expect = 8e-06
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            |||||||||||||||||||||||||||||
Sbjct: 1265 tcatccatacccaaaatggcaatgatatc 1237

---

>ref|XM_509149.1| PREDICTED: Pan troglodytes ATP synthase, H+ transporting,
            mitochondrial F1 complex, beta subunit (LOC451999), mRNA
          Length = 1407

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 27   gtcaacttatcatcctcactgagctcatccatacccaaaatggcaatgatatcctg 82
            ||||||||||| ||||||   || |||||||||||||  |||||||||||||||||
Sbjct: 1175 gtcaacttatcttcctcagaaagttcatccatacccaggatggcaatgatatcctg 1120

---

>emb|BX321856.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 1/10
          Length = 302050

 Score = 56.0 bits (28), Expect = 3e-05
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                              
Query: 48     agctcatccatacccaaaatggcaatgatatc 79
              |||||||||||||||||||| |||||||||||
Sbjct: 241717 agctcatccatacccaaaatagcaatgatatc 241686

---

>gb|AY580230.1| Nucula proxima ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 51   tcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttc 110
            |||||||||||||| || ||||| ||||||||||||   ||||| | |||||| | ||||
Sbjct: 1103 tcatccatacccaagatagcaataatatcctgaagagatttgtaatcctgaaggatcttc 1044

                       
Query: 111  tgcacaccacg 121
            || ||||||||
Sbjct: 1043 tgtacaccacg 1033

---

>ref|XM_500475.1| Yarrowia lipolytica CLIB122, YALI0B03982g predicted mRNA
          Length = 1671

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 48   agctcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| | ||||||||||||||||||
Sbjct: 1421 agctcatccataccaagaatggcaatgatatcctg 1387

---

>gb|DQ087492.1| Nereis vexillosa ATP synthase beta subunit mRNA, partial cds
          Length = 1164

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                        
Query: 51   tcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttc 110
            ||||||||||| || |||||||||||||| || |||   ||||||| |||||| | ||||
Sbjct: 1103 tcatccatacctaagatggcaatgatatcttgcagagatttgtagtcctgaaggatcttc 1044

                       
Query: 111  tgcacaccacg 121
            || ||||||||
Sbjct: 1043 tgtacaccacg 1033

---

>gb|DQ417168.1| Ictalurus punctatus clone SAAF04R ATP synthase beta-subunit-like
           mRNA, partial cds
          Length = 414

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 2   ctggatcttccttgcacgagcaaccgtcaacttatcatcctcactgagctcatccatacc 61
           ||||||||| |  |||||||| || |||| |||||| ||||||   | ||||||||||||
Sbjct: 111 ctggatcttacgggcacgagctacagtcagcttatcctcctcagacaactcatccatacc 52

                                                              
Query: 62  caaaatggcaatgatatcctgaagattcttgtagttctgaagaaccttctg 112
           ||  || ||||| |||||||| |||  |||||||| |||||| | ||||||
Sbjct: 51  caggatagcaataatatcctgcagagacttgtagtcctgaaggatcttctg 1

---

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 48     agctcatccatacccaaaatggcaatgatatcctg 82
              |||||||||||||| | ||||||||||||||||||
Sbjct: 534865 agctcatccataccaagaatggcaatgatatcctg 534831

---

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                    
Query: 47     gagctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctg 100
              ||||||||||||||| | ||| ||||| |||||||||||||  ||||| |||||
Sbjct: 940053 gagctcatccataccaagaatagcaataatatcctgaagatctttgtacttctg 940000

---

>gb|DQ087452.1| Lineus viridis ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 50   ctcatccatacccaaaatggcaatgatatc 79
            ||||||||||||||| ||||||||||||||
Sbjct: 1104 ctcatccatacccaagatggcaatgatatc 1075

---

>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 48      agctcatccatacccaaaatggcaatgatatcctgaag 85
               |||||||||||||| | |||||| ||||||||||||||
Sbjct: 5585284 agctcatccataccgagaatggcgatgatatcctgaag 5585321

---

>dbj|AB104883.1| Zygosaccharomyces rouxii ZrATP2 gene for mitochondrial ATPase
            beta-subunit, complete cds
          Length = 1950

 Score = 52.0 bits (26), Expect = 5e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 54   tccatacccaaaatggcaatgatatc 79
            ||||||||||||||||||||||||||
Sbjct: 1606 tccatacccaaaatggcaatgatatc 1581

---

>ref|NM_001031391.1| Gallus gallus ATP synthase, H+ transporting, mitochondrial F1
            complex, beta polypeptide (ATP5B), mRNA
          Length = 1735

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                        
Query: 48   agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
            ||||||||||| ||||  ||||| ||||| ||||| ||   |||||||| |||||| | |
Sbjct: 1383 agctcatccatgcccaggatggcgatgatgtcctgcagggacttgtagtcctgaaggatc 1324

                             
Query: 108  ttctgcacaccacgggc 124
            ||||||||||| |||||
Sbjct: 1323 ttctgcacacctcgggc 1307

---

>ref|XM_708288.1| Candida albicans SC5314 mitochondrial F1F0-ATPase subunit beta
            (CaO19.13098), mRNA
          Length = 1539

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            ||||||||||||||||| |||||||||||
Sbjct: 1286 tcatccatacccaaaatagcaatgatatc 1258

---

>ref|XM_708241.1| Candida albicans SC5314 mitochondrial F1F0-ATPase subunit beta
            (CaO19.5653), mRNA
          Length = 1539

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            ||||||||||||||||| |||||||||||
Sbjct: 1286 tcatccatacccaaaatagcaatgatatc 1258

---

>gb|AY580258.1| Mytilus californianus ATP synthase beta subunit mRNA, partial cds
          Length = 1044

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 51  tcatccatacccaaaatggcaatgatatc 79
           ||||||||||||||||||||||| |||||
Sbjct: 980 tcatccatacccaaaatggcaataatatc 952

---

>ref|XM_446820.1| Candida glabrata CBS138, CAGL0H00506g partial mRNA
          Length = 1524

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            |||||||||||||||||||| ||||||||
Sbjct: 1271 tcatccatacccaaaatggcgatgatatc 1243

---

>emb|BX054584.1|CNS09EA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 801 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 860

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 861 ttctgcacgccacgggc 877

---

>emb|BX052275.1|CNS09CHZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 664 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 605

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 604 ttctgcacgccacgggc 588

---

>emb|BX050670.1|CNS09B9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 664 agctcatccatacccaggatggccatgatgtcctggagcgacttgtagtcctgcaggatc 723

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 724 ttctgcacgccacgggc 740

---

>emb|BX043854.1|CNS09602 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 619 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 678

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 679 ttctgcacgccacgggc 695

---

>emb|BX036739.1|CNS090IF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 632 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 691

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 692 ttctgcacgccacgggc 708

---

>emb|BX035307.1|CNS08ZEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 786

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 636 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 695

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 696 ttctgcacgccacgggc 712

---

>emb|BX018705.1|CNS08MLH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 483

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 164 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 105

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 104 ttctgcacgccacgggc 88

---

>emb|BX015733.1|CNS08KAX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 629 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 688

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 689 ttctgcacgccacgggc 705

---

>emb|BX009326.1|CNS08FCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 48  agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
           ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 565 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 624

                            
Query: 108 ttctgcacaccacgggc 124
           |||||||| ||||||||
Sbjct: 625 ttctgcacgccacgggc 641

---

>emb|Z49621.1|SCYJR121W S.cerevisiae chromosome X reading frame ORF YJR121w
          Length = 2299

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            ||||||||||||||||| |||||||||||
Sbjct: 1413 tcatccatacccaaaatagcaatgatatc 1385

---

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 51      tcatccatacccaaaatggcaatgatatc 79
               ||||||||||||||||| |||||||||||
Sbjct: 3322959 tcatccatacccaaaattgcaatgatatc 3322987

---

>emb|CR380954.1| Candida glabrata strain CBS138 chromosome H complete sequence
          Length = 1050361

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 51    tcatccatacccaaaatggcaatgatatc 79
             |||||||||||||||||||| ||||||||
Sbjct: 50348 tcatccatacccaaaatggcgatgatatc 50376

---

>gb|DQ087466.1| Leucosolenia sp. KP-2005 ATP synthase beta subunit mRNA, partial cds
          Length = 1212

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 50   ctcatccatacccaaaatggcaatgatatcctg 82
            ||||||||||||||| || ||||||||||||||
Sbjct: 1101 ctcatccatacccaagatagcaatgatatcctg 1069

---

>emb|AJ719809.1| Gallus gallus mRNA for hypothetical protein, clone 6l18
          Length = 1735

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                        
Query: 48   agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
            ||||||||||| ||||  ||||| ||||| ||||| ||   |||||||| |||||| | |
Sbjct: 1383 agctcatccatgcccaggatggcgatgatgtcctgcagggacttgtagtcctgaaggatc 1324

                             
Query: 108  ttctgcacaccacgggc 124
            ||||||||||| |||||
Sbjct: 1323 ttctgcacacctcgggc 1307

---

>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome
          Length = 5057531

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 51      tcatccatacccaaaatggcaatgatatc 79
               ||||||||||||||||||||||| |||||
Sbjct: 4998287 tcatccatacccaaaatggcaataatatc 4998315

---

>dbj|AB226303.1| Aspergillus oryzae cDNA, contig sequence: AoEST3165
          Length = 1991

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 54   tccatacccaaaatggcaatgatatcctg 82
            |||||||||| ||||||||||||||||||
Sbjct: 1396 tccatacccagaatggcaatgatatcctg 1368

---

>dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010
          Length = 2039961

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 54      tccatacccaaaatggcaatgatatcctg 82
               |||||||||| ||||||||||||||||||
Sbjct: 1292564 tccatacccagaatggcaatgatatcctg 1292536

---

>ref|XM_320445.2| Anopheles gambiae str. PEST ENSANGP00000016863 (ENSANGG00000023978),
            partial mRNA
          Length = 1251

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                        
Query: 48   agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
            ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 1001 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 942

                             
Query: 108  ttctgcacaccacgggc 124
            |||||||| ||||||||
Sbjct: 941  ttctgcacgccacgggc 925

---

>ref|XM_320446.1| Anopheles gambiae str. PEST ENSANGP00000024137 (ENSANGG00000014374),
            partial mRNA
          Length = 1440

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                        
Query: 48   agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
            ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 1211 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 1152

                             
Query: 108  ttctgcacaccacgggc 124
            |||||||| ||||||||
Sbjct: 1151 ttctgcacgccacgggc 1135

---

>ref|XM_320423.2| Anopheles gambiae str. PEST ENSANGP00000016868 (ENSANGG00000014379),
            partial mRNA
          Length = 1461

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                        
Query: 48   agctcatccatacccaaaatggcaatgatatcctgaagattcttgtagttctgaagaacc 107
            ||||||||||||||||  ||||| ||||| ||||| ||   |||||||| ||| || | |
Sbjct: 1211 agctcatccatacccaggatggcgatgatgtcctggagcgacttgtagtcctgcaggatc 1152

                             
Query: 108  ttctgcacaccacgggc 124
            |||||||| ||||||||
Sbjct: 1151 ttctgcacgccacgggc 1135

---

>dbj|AK108995.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-G05, full
            insert sequence
          Length = 1772

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 54   tccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||||||
Sbjct: 1328 tccatacccaaaatagcaatgatatcctg 1300

---

>gb|U46215.1|SCU46215 Saccharomyces cerevisiae D273-10B F1-ATPase beta-subunit (ATP2) gene,
            nuclear gene encoding a mitochondrial protein, complete
            cds
          Length = 1560

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            ||||||||||||||||| |||||||||||
Sbjct: 1293 tcatccatacccaaaatagcaatgatatc 1265

---

>gb|M12082.1|YSCATP21 Yeast (S.cerevisiae) nuclear ATP2 gene encoding mitochondrial
            F-1-ATPase beta-subunit, complete cds
          Length = 1932

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 51   tcatccatacccaaaatggcaatgatatc 79
            ||||||||||||||||| |||||||||||
Sbjct: 1386 tcatccatacccaaaatagcaatgatatc 1358

---

>gb|K00560.1|YSCATP2 yeast (s.cerevisiae) mitochondrial atpase beta subunit (atp2) gene,
           3' terminal region
          Length = 1109

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 51  tcatccatacccaaaatggcaatgatatc 79
           ||||||||||||||||| |||||||||||
Sbjct: 698 tcatccatacccaaaatagcaatgatatc 670

---

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 48     agctcatccatacccaaaatggcaatgatatc 79
              |||||||||||||| |||||||| ||||||||
Sbjct: 114075 agctcatccatacctaaaatggcgatgatatc 114044

---

>gb|BC087041.1| Rattus norvegicus cDNA clone IMAGE:7106871, containing frame-shift
            errors
          Length = 1783

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1346 tcatccatacccaagatggcaatgatgtcctg 1315

---

>gb|DQ228960.1| Toxoplasma gondii mitochondrial F1-ATP synthase beta subunit
            precursor (ATPsynth-beta) mRNA, complete cds; nuclear
            gene for mitochondrial product
          Length = 1683

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 39   tcctcactgagctcatccatacccaaaatggcaatgatatcctg 82
            |||||||| ||||| ||||| |||| |||||| |||||||||||
Sbjct: 1433 tcctcactcagctcgtccattcccagaatggcgatgatatcctg 1390

---

>gb|AC166817.3| Mus musculus BAC clone RP24-530C16 from chromosome 10, complete
             sequence
          Length = 155876

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 51    tcatccatacccaaaatggcaatgatatcctg 82
             |||||||||||||| ||||||||||| |||||
Sbjct: 76652 tcatccatacccaagatggcaatgatgtcctg 76621

---

>gb|BC016512.1| Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex,
            beta polypeptide, mRNA (cDNA clone MGC:5231
            IMAGE:2900336), complete cds
          Length = 1762

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>ref|NM_134364.1| Rattus norvegicus ATP synthase, H+ transporting, mitochondrial F1
            complex, beta polypeptide (Atp5b), nuclear gene encoding
            mitochondrial protein, mRNA
          Length = 1759

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>ref|XM_654827.1| Aspergillus nidulans FGSC A4 ATP synthase subunit beta (AN2315.2),
            mRNA
          Length = 1542

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 54   tccatacccaaaatggcaatgatatcctgaag 85
            |||||||| | |||||||||||||||||||||
Sbjct: 1280 tccataccaagaatggcaatgatatcctgaag 1249

---

>gb|AY580293.1| Ptychodera flava ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 54   tccatacccaaaatggcaatgatatcctgaag 85
            |||||||||| |||||| ||||||||||||||
Sbjct: 1100 tccatacccagaatggcgatgatatcctgaag 1069

---

>gb|AY580175.1| Asterina miniata ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 54   tccatacccaaaatggcaatgatatcctgaag 85
            |||||||||| |||||| ||||||||||||||
Sbjct: 1100 tccatacccagaatggcgatgatatcctgaag 1069

---

>gb|BC013253.1| Mus musculus ATP synthase, H+ transporting mitochondrial F1 complex,
            beta subunit, mRNA (cDNA clone IMAGE:3153509)
          Length = 1812

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1330 tcatccatacccaagatggcaatgatgtcctg 1299

---

>gb|AC090681.13| Homo sapiens 12 BAC RP11-369C14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 93582

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 51    tcatccatacccaaaatggcaatgatatcctg 82
             |||||||||||||  |||||||||||||||||
Sbjct: 69677 tcatccatacccaggatggcaatgatatcctg 69708

---

>gb|BC037127.1| Mus musculus ATP synthase, H+ transporting mitochondrial F1 complex,
            beta subunit, mRNA (cDNA clone IMAGE:4920887), partial
            cds
          Length = 1808

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1347 tcatccatacccaagatggcaatgatgtcctg 1316

---

>gb|BC099743.1| Rattus norvegicus ATP synthase, H+ transporting, mitochondrial F1
            complex, beta polypeptide, mRNA (cDNA clone MGC:124522
            IMAGE:7937989), complete cds
          Length = 1785

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1339 tcatccatacccaagatggcaatgatgtcctg 1308

---

>emb|X05606.1|HSATPB Human mRNA fragment for ATP synthetase beta-subunit
          Length = 942

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 51  tcatccatacccaaaatggcaatgatatcctg 82
           |||||||||||||  |||||||||||||||||
Sbjct: 683 tcatccatacccaggatggcaatgatatcctg 652

---

>emb|X03559.1|HSATPFIB Human mRNA for F1-ATPase beta subunit (F-1 beta)
          Length = 1807

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1409 tcatccatacccaggatggcaatgatatcctg 1378

---

>gb|DQ087446.1| Cerebratulus lacteus ATP synthase beta subunit mRNA, partial cds
          Length = 1281

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 51   tcatccatacccaaaatggcaatgatatcctgaaga 86
            |||||||||||||  || ||||||||||||||||||
Sbjct: 1103 tcatccatacccaggatagcaatgatatcctgaaga 1068

---

>emb|CR615964.1| full-length cDNA clone CS0DA007YB22 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1721

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1343 tcatccatacccaggatggcaatgatatcctg 1312

---

>emb|CR615631.1| full-length cDNA clone CS0DG004YI11 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1730

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR626774.1| full-length cDNA clone CS0DA007YG13 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1693

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR626584.1| full-length cDNA clone CL0BB028ZB11 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1745

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR626365.1| full-length cDNA clone CS0DF038YK02 of Fetal brain of Homo sapiens
            (human)
          Length = 1698

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR624633.1| full-length cDNA clone CS0DA009YB03 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1718

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR625698.1| full-length cDNA clone CS0DE006YI17 of Placenta of Homo sapiens
            (human)
          Length = 1704

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR625161.1| full-length cDNA clone CS0DN004YJ22 of Adult brain of Homo sapiens
            (human)
          Length = 1713

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>emb|CR625069.1| full-length cDNA clone CS0DJ010YG06 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 1731

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>emb|CR624993.1| full-length cDNA clone CL0BB016ZB02 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1751

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR624825.1| full-length cDNA clone CS0CAP003YB05 of Thymus of Homo sapiens
          (human)
          Length = 453

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                          
Query: 51 tcatccatacccaaaatggcaatgatatcctg 82
          |||||||||||||  |||||||||||||||||
Sbjct: 49 tcatccatacccaggatggcaatgatatcctg 18

---

>emb|CR624581.1| full-length cDNA clone CS0DA007YF24 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1717

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1343 tcatccatacccaggatggcaatgatatcctg 1312

---

>emb|CR624353.1| full-length cDNA clone CS0DA001YE22 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1723

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR623794.1| full-length cDNA clone CS0DG006YE01 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1744

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1346 tcatccatacccaggatggcaatgatatcctg 1315

---

>emb|CR623765.1| full-length cDNA clone CS0DH002YL16 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1723

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1346 tcatccatacccaggatggcaatgatatcctg 1315

---

>emb|CR623584.1| full-length cDNA clone CS0DA007YC17 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1693

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR622605.1| full-length cDNA clone CS0DH003YM11 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1624

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR621900.1| full-length cDNA clone CS0DF028YA05 of Fetal brain of Homo sapiens
            (human)
          Length = 1743

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR621538.1| full-length cDNA clone CS0DF008YB01 of Fetal brain of Homo sapiens
            (human)
          Length = 1711

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>dbj|AK127078.1| Homo sapiens cDNA FLJ45135 fis, clone BRAWH3038252, highly  similar
            to Formin 1 isoform IV
          Length = 3814

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 3411 tcatccatacccaggatggcaatgatatcctg 3380

---

>emb|CR621144.1| full-length cDNA clone CS0DN003YE18 of Adult brain of Homo sapiens
            (human)
          Length = 1733

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR621061.1| full-length cDNA clone CS0DI066YH08 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1682

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR620227.1| full-length cDNA clone CS0DI001YB20 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1694

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR619791.1| full-length cDNA clone CS0DM003YB20 of Fetal liver of Homo sapiens
            (human)
          Length = 1725

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1346 tcatccatacccaggatggcaatgatatcctg 1315

---

>emb|CR619766.1| full-length cDNA clone CS0DA012YH03 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1733

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR619267.1| full-length cDNA clone CS0DI054YI24 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1596

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1233 tcatccatacccaggatggcaatgatatcctg 1202

---

>emb|CR617438.1| full-length cDNA clone CS0DA012YG12 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1718

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR617726.1| full-length cDNA clone CS0DI066YL08 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1708

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR615488.1| full-length cDNA clone CS0DF030YP14 of Fetal brain of Homo sapiens
            (human)
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR616381.1| full-length cDNA clone CL0BB023ZD05 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1747

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1343 tcatccatacccaggatggcaatgatatcctg 1312

---

>emb|CR615169.1| full-length cDNA clone CS0DI009YF23 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1717

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR614784.1| full-length cDNA clone CS0DI012YB03 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1696

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR614182.1| full-length cDNA clone CS0DF002YI09 of Fetal brain of Homo sapiens
            (human)
          Length = 1721

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR613578.1| full-length cDNA clone CS0DI073YA21 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1719

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR609559.1| full-length cDNA clone CS0DG006YC05 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1721

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR613316.1| full-length cDNA clone CS0DF015YF22 of Fetal brain of Homo sapiens
            (human)
          Length = 1682

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR612947.1| full-length cDNA clone CS0DE010YJ12 of Placenta of Homo sapiens
            (human)
          Length = 1686

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1311 tcatccatacccaggatggcaatgatatcctg 1280

---

>emb|CR612886.1| full-length cDNA clone CS0DA008YH19 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1718

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR611938.1| full-length cDNA clone CS0DI060YI05 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1720

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR611417.1| full-length cDNA clone CS0DA003YG11 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1719

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1338 tcatccatacccaggatggcaatgatatcctg 1307

---

>emb|CR611415.1| full-length cDNA clone CS0DF037YC19 of Fetal brain of Homo sapiens
            (human)
          Length = 1707

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR611259.1| full-length cDNA clone CS0DG002YL07 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1723

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR609220.1| full-length cDNA clone CS0DG002YG10 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1725

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1346 tcatccatacccaggatggcaatgatatcctg 1315

---

>emb|CR609212.1| full-length cDNA clone CS0DE007YC20 of Placenta of Homo sapiens
            (human)
          Length = 1716

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>emb|CR609186.1| full-length cDNA clone CS0DI037YM20 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1707

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR607778.1| full-length cDNA clone CS0DA002YL04 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1746

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1365 tcatccatacccaggatggcaatgatatcctg 1334

---

>emb|CR608193.1| full-length cDNA clone CS0DE002YH17 of Placenta of Homo sapiens
            (human)
          Length = 1712

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR608124.1| full-length cDNA clone CS0DN004YF13 of Adult brain of Homo sapiens
            (human)
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR607664.1| full-length cDNA clone CS0DA001YJ16 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1737

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR604659.1| full-length cDNA clone CS0DG006YJ02 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1712

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR605146.1| full-length cDNA clone CS0DA005YB21 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1723

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1337 tcatccatacccaggatggcaatgatatcctg 1306

---

>emb|CR605104.1| full-length cDNA clone CS0DJ003YI03 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 1719

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR605483.1| full-length cDNA clone CS0DA004YB01 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1724

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR605460.1| full-length cDNA clone CS0DA012YF09 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1706

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1328 tcatccatacccaggatggcaatgatatcctg 1297

---

>emb|CR605250.1| full-length cDNA clone CS0DA005YJ03 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1733

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR603704.1| full-length cDNA clone CS0DG001YA04 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1696

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR602930.1| full-length cDNA clone CS0DH005YN05 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1721

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR603074.1| full-length cDNA clone CS0DM003YL13 of Fetal liver of Homo sapiens
            (human)
          Length = 1709

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR602257.1| full-length cDNA clone CS0DF038YF18 of Fetal brain of Homo sapiens
            (human)
          Length = 1710

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR601166.1| full-length cDNA clone CS0DI053YF24 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1720

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR600999.1| full-length cDNA clone CS0DF034YI21 of Fetal brain of Homo sapiens
            (human)
          Length = 1700

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR600712.1| full-length cDNA clone CS0DA011YD08 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1685

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1346 tcatccatacccaggatggcaatgatatcctg 1315

---

>emb|CR600201.1| full-length cDNA clone CS0DI035YL24 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1758

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1385 tcatccatacccaggatggcaatgatatcctg 1354

---

>emb|CR597668.1| full-length cDNA clone CS0DI033YL08 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1695

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR597508.1| full-length cDNA clone CS0DF014YA14 of Fetal brain of Homo sapiens
            (human)
          Length = 1720

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR596952.1| full-length cDNA clone CS0DF030YJ06 of Fetal brain of Homo sapiens
            (human)
          Length = 1720

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>emb|CR596818.1| full-length cDNA clone CS0DK004YL09 of HeLa cells Cot 25-normalized
            of Homo sapiens (human)
          Length = 1719

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR595794.1| full-length cDNA clone CS0DF025YF17 of Fetal brain of Homo sapiens
            (human)
          Length = 1731

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR595373.1| full-length cDNA clone CS0DE001YF20 of Placenta of Homo sapiens
            (human)
          Length = 1718

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR595274.1| full-length cDNA clone CL0BB003ZC04 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1751

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR594107.1| full-length cDNA clone CS0DA004YM04 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1735

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1347 tcatccatacccaggatggcaatgatatcctg 1316

---

>emb|CR594490.1| full-length cDNA clone CS0DG002YJ20 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1688

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1302 tcatccatacccaggatggcaatgatatcctg 1271

---

>emb|CR593868.1| full-length cDNA clone CS0DA005YK09 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1722

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>emb|CR591449.1| full-length cDNA clone CS0DF036YN07 of Fetal brain of Homo sapiens
            (human)
          Length = 1563

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1174 tcatccatacccaggatggcaatgatatcctg 1143

---

>emb|CR590902.1| full-length cDNA clone CS0DF036YA16 of Fetal brain of Homo sapiens
            (human)
          Length = 1734

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1345 tcatccatacccaggatggcaatgatatcctg 1314

---

>emb|CR590194.1| full-length cDNA clone CS0DA011YI09 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1725

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||  |||||||||||||||||
Sbjct: 1344 tcatccatacccaggatggcaatgatatcctg 1313

---

>dbj|AB206839.1| Acidithiobacillus ferrooxidans atpI, atpB, atpE, atpF, atpH, atpA,
            atpG, atpD, atpC genes for hypothetical protein, a
            subunit of F1F0-ATP synthase, c subunit of F1F0-ATP
            synthase, b subunit of F1F0-ATP synthase, delta subunit
            of F1F0-ATP synthase, alpha subunit of F1F0-ATP synthase,
            gamma subunit of F1F0-ATP synthase, beta subunit of
            F1F0-ATP synthase, epsilon subunit of F1F0-ATP synthase,
            complete cds
          Length = 8663

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||| |||| ||||||||||||||||||
Sbjct: 7089 tcatccatgcccagaatggcaatgatatcctg 7058

---

>dbj|AK151081.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830022K22 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK152976.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830097C05 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK148891.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
            full-length enriched library, clone:7120460C03
            product:ATP synthase, H+ transporting mitochondrial F1
            complex, beta subunit, full insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK159444.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
            library, clone:I420020D07 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK152788.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830086B13 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK152730.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830083E16 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1768

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1359 tcatccatacccaagatggcaatgatgtcctg 1328

---

>dbj|AK151600.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830032B08 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1762

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1353 tcatccatacccaagatggcaatgatgtcctg 1322

---

>dbj|AK150599.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830012J11 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK145684.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
            library, clone:I1C0029F07 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1764

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1355 tcatccatacccaagatggcaatgatgtcctg 1324

---

>dbj|AK160199.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
            library, clone:2510038G15 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1757

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1348 tcatccatacccaagatggcaatgatgtcctg 1317

---

>dbj|AK167764.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
            clone:I730010C20 product:ATP synthase, H+ transporting
            mitochondrial F1 complex, beta subunit, full insert
            sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK167728.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
            library, clone:I530030E03 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1762

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1353 tcatccatacccaagatggcaatgatgtcctg 1322

---

>dbj|AK164383.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130083N01 product:ATP synthase,
            H+ transporting mitochondrial F1 complex, beta subunit,
            full insert sequence
          Length = 1776

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1344 tcatccatacccaagatggcaatgatgtcctg 1313

---

>dbj|AK168941.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
            full-length enriched library, clone:I920066H16
            product:ATP synthase, H+ transporting mitochondrial F1
            complex, beta subunit, full insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325

---

>dbj|AK153099.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830122N06 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1754

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1345 tcatccatacccaagatggcaatgatgtcctg 1314

---

>dbj|AK159978.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
            library, clone:I420041M06 product:ATP synthase, H+
            transporting mitochondrial F1 complex, beta subunit, full
            insert sequence
          Length = 1765

 Score = 48.1 bits (24), Expect = 0.007
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 51   tcatccatacccaaaatggcaatgatatcctg 82
            |||||||||||||| ||||||||||| |||||
Sbjct: 1356 tcatccatacccaagatggcaatgatgtcctg 1325


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,132,662
Number of Sequences: 3902068
Number of extensions: 1132662
Number of successful extensions: 85489
Number of sequences better than 10.0: 391
Number of HSP's better than 10.0 without gapping: 386
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 84662
Number of HSP's gapped (non-prelim): 831
length of query: 147
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 126
effective length of database: 17,151,101,840
effective search space: 2161038831840
effective search space used: 2161038831840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

---