| Clone Name | rbags4k08 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds Length = 1053 Score = 482 bits (243), Expect = e-133 Identities = 345/381 (90%), Gaps = 2/381 (0%) Strand = Plus / Minus Query: 3 ttaaaaaagatggttccaggaacatagttctatatccttgcagataactggctntagcaa 62 ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||| |||||| Sbjct: 972 ttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctatagcaa 914 Query: 63 aacgactcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccctcttc 122 ||||| |||| |||||||||||||||||||||||| ||||| || ||||||||||||||| Sbjct: 913 aacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccctcttc 854 Query: 123 ctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggc 182 |||||||||||||||||||| |||| |||||| ||||||||||||||| ||||||| ||| Sbjct: 853 ctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcacccacggc 794 Query: 183 ttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgg 242 |||| ||||||||| ||||||||||| ||||| |||||| |||| |||||||||||||| Sbjct: 793 ttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgaccctga 734 Query: 243 gcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcaca 302 |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 733 gcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgatcaca 674 Query: 303 ccaacacgcncagngntgcgcccaccantcaccatgacnacnttgccngacntcaaactt 362 |||||||| ||| | | ||||||||| | |||||||| || ||||| || |||||||| Sbjct: 673 ccaacacggccagtgttacgcccaccagtaaccatgacaacattgcca-acatcaaactt 615 Query: 363 gatgaagncaacaatcttgtt 383 ||||||| ||||||||||||| Sbjct: 614 gatgaagtcaacaatcttgtt 594
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 283 bits (143), Expect = 2e-73 Identities = 254/294 (86%), Gaps = 1/294 (0%) Strand = Plus / Plus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| | Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| ||| Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | || ||||||||||||||||||||||||||||||||||| | | | | | || ||| Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 317207 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 317259 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Plus Query: 26 atagttctatatccttgcagataactggctntagcaaaac 65 ||||||||||||||||||| | |||| ||| ||||||||| Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1359_D06 Length = 146805 Score = 283 bits (143), Expect = 2e-73 Identities = 254/294 (86%), Gaps = 1/294 (0%) Strand = Plus / Plus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| | Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| ||| Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | || ||||||||||||||||||||||||||||||||||| | | | | | || ||| Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 45991 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 46043 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Plus Query: 26 atagttctatatccttgcagataactggctntagcaaaac 65 ||||||||||||||||||| | |||| ||| ||||||||| Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719
>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full insert sequence Length = 1016 Score = 283 bits (143), Expect = 2e-73 Identities = 254/294 (86%), Gaps = 1/294 (0%) Strand = Plus / Minus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| | Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| ||| Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | || ||||||||||||||||||||||||||||||||||| | | | | | || ||| Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 646 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 594 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Minus Query: 26 atagttctatatccttgcagataactggctntagcaaaac 65 ||||||||||||||||||| | |||| ||| ||||||||| Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918
>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full insert sequence Length = 1157 Score = 283 bits (143), Expect = 2e-73 Identities = 254/294 (86%), Gaps = 1/294 (0%) Strand = Plus / Minus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| | Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| ||| Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | || ||||||||||||||||||||||||||||||||||| | | | | | || ||| Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 650 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 598 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Minus Query: 26 atagttctatatccttgcagataactggctntagcaaaac 65 ||||||||||||||||||| | |||| ||| ||||||||| Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922
>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full insert sequence Length = 1079 Score = 276 bits (139), Expect = 5e-71 Identities = 253/294 (86%), Gaps = 1/294 (0%) Strand = Plus / Minus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| | Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||| Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| ||| Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | || ||||||||||||||||||||||||||||||||||| | | | | | || ||| Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 642 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 590 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Minus Query: 26 atagttctatatccttgcagataactggctntagcaaaac 65 ||||||||||||||||||| | |||| ||| ||||||||| Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914
>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds Length = 1013 Score = 212 bits (107), Expect = 6e-52 Identities = 245/294 (83%), Gaps = 1/294 (0%) Strand = Plus / Minus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||| | Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 ||||||| |||| |||| |||||||| ||| ||| | ||| ||||| |||||||||||| Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | ||||| |||||||||||||||||||| ||||| || || ||| | | | || ||| Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 624 gtcaccatgacgacgttgcca-acatcaaacttgatgaagtccacaatcttgtt 572 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 22 gaacatagttctatatccttgcaga 46 |||||| |||||||||||||||||| Sbjct: 936 gaacattgttctatatccttgcaga 912
>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds Length = 1037 Score = 204 bits (103), Expect = 2e-49 Identities = 244/294 (82%), Gaps = 1/294 (0%) Strand = Plus / Minus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||| | Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || |||||||||||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 ||||||| |||| |||| |||||||| ||| ||| | ||| ||||| |||||||||| | Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | ||||| |||||||||||||||||||| ||||| ||||| ||| | | | || ||| Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||| ||||| Sbjct: 622 gtcaccatgacaacgttgcca-acatcaaacttgatgaagtccacaattttgtt 570 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 22 gaacatagttctatatccttgcaga 46 |||||| |||||||||||||||||| Sbjct: 934 gaacattgttctatatccttgcaga 910
>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 Length = 1148 Score = 200 bits (101), Expect = 2e-48 Identities = 190/217 (87%), Gaps = 3/217 (1%) Strand = Plus / Minus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctn 148 |||||||||||||| || || || |||| |||||| ||||||| | |||||| |||||| Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807 Query: 149 gatacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacac 208 ||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747 Query: 209 gttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaa 268 |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| || Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687 Query: 269 ggttcccttatgcttctccctgttcttgatcacacca 305 | | |||| |||||||||||||| |||||||||||| Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651
>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence Length = 1116 Score = 198 bits (100), Expect = 9e-48 Identities = 210/249 (84%), Gaps = 1/249 (0%) Strand = Plus / Minus Query: 121 tcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaag 180 ||||||||||||| |||||| |||||| |||||||||||||||||| ||||||||||| | Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806 Query: 181 gcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccct 240 ||||| ||||||||| ||||||||||||||||||| ||| |||| |||||||| ||| Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746 Query: 241 gggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 300 || | ||| ||||||||||| || ||| ||||| |||||||||||||||||||||| Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686 Query: 301 caccaacacgcncagngntgcgcccaccantcaccatgacnacnttgccngacntcaaac 360 |||| |||||| | | | | | ||| || |||||||||| || ||||| ||| |||||| Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgcc-gacgtcaaac 627 Query: 361 ttgatgaag 369 ||||||||| Sbjct: 626 ttgatgaag 618
>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds Length = 1090 Score = 198 bits (100), Expect = 9e-48 Identities = 210/249 (84%), Gaps = 1/249 (0%) Strand = Plus / Minus Query: 121 tcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaag 180 ||||||||||||| |||||| |||||| |||||||||||||||||| ||||||||||| | Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785 Query: 181 gcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccct 240 ||||| ||||||||| ||||||||||||||||||| ||| |||| |||||||| ||| Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725 Query: 241 gggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 300 || | ||| ||||||||||| || ||| ||||| |||||||||||||||||||||| Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665 Query: 301 caccaacacgcncagngntgcgcccaccantcaccatgacnacnttgccngacntcaaac 360 |||| |||||| | | | | | ||| || |||||||||| || ||||| ||| |||||| Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgcc-gacgtcaaac 606 Query: 361 ttgatgaag 369 ||||||||| Sbjct: 605 ttgatgaag 597
>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence Length = 1145 Score = 196 bits (99), Expect = 4e-47 Identities = 243/294 (82%), Gaps = 1/294 (0%) Strand = Plus / Plus Query: 90 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149 |||||||||||||| || || ||||||| |||||| ||||| || |||||| | |||| | Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237 Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209 || ||||| |||||||| ||||||||||| ||||| |||||||| |||||||||||| Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297 Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269 ||||||| |||| |||| |||||||| ||| ||| | ||| ||||| || ||||||||| Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357 Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329 | ||||| |||||||||||||||||||| ||||| ||||| ||| | | | || ||| Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417 Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 |||||||||| || ||||| || ||||||||||||||| | ||||||||||| Sbjct: 418 gtcaccatgacgacgttgcca-acatcaaacttgatgaagtccacaatcttgtt 470 Score = 44.1 bits (22), Expect = 0.33 Identities = 25/26 (96%) Strand = Plus / Plus Query: 21 ggaacatagttctatatccttgcaga 46 ||||||| |||||||||||||||||| Sbjct: 105 ggaacattgttctatatccttgcaga 130
>ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 768 Score = 159 bits (80), Expect = 8e-36 Identities = 236/291 (81%), Gaps = 1/291 (0%) Strand = Plus / Minus Query: 93 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152 |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| |||| Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699 Query: 153 cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212 ||||||||||| ||||| |||||| |||||| ||||||||| ||||||||||| ||| Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639 Query: 213 cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272 ||||||||| |||| || || ||| || | ||| || |||||||||||||| | Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579 Query: 273 cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332 ||||| ||||||||||||||||| || || |||||||| ||| | | | ||| || | Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 519 Query: 333 accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 ||||| || || ||||| || ||||||||||||||| ||||||||||||| Sbjct: 518 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 469
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 159 bits (80), Expect = 8e-36 Identities = 236/291 (81%), Gaps = 1/291 (0%) Strand = Plus / Minus Query: 93 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152 |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| |||| Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910 Query: 153 cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212 ||||||||||| ||||| |||||| |||||| ||||||||| ||||||||||| ||| Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850 Query: 213 cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272 ||||||||| |||| || || ||| || | ||| || |||||||||||||| | Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790 Query: 273 cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332 ||||| ||||||||||||||||| || || |||||||| ||| | | | ||| || | Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 14497730 Query: 333 accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 ||||| || || ||||| || ||||||||||||||| ||||||||||||| Sbjct: 14497729 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 14497680
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0514H03 Length = 167230 Score = 159 bits (80), Expect = 8e-36 Identities = 236/291 (81%), Gaps = 1/291 (0%) Strand = Plus / Minus Query: 93 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152 |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| |||| Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223 Query: 153 cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212 ||||||||||| ||||| |||||| |||||| ||||||||| ||||||||||| ||| Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163 Query: 213 cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272 ||||||||| |||| || || ||| || | ||| || |||||||||||||| | Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103 Query: 273 cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332 ||||| ||||||||||||||||| || || |||||||| ||| | | | ||| || | Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 57043 Query: 333 accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 ||||| || || ||||| || ||||||||||||||| ||||||||||||| Sbjct: 57042 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 56993
>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full insert sequence Length = 1035 Score = 159 bits (80), Expect = 8e-36 Identities = 236/291 (81%), Gaps = 1/291 (0%) Strand = Plus / Minus Query: 93 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152 |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| |||| Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816 Query: 153 cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212 ||||||||||| ||||| |||||| |||||| ||||||||| ||||||||||| ||| Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756 Query: 213 cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272 ||||||||| |||| || || ||| || | ||| || |||||||||||||| | Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696 Query: 273 cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332 ||||| ||||||||||||||||| || || |||||||| ||| | | | ||| || | Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 636 Query: 333 accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383 ||||| || || ||||| || ||||||||||||||| ||||||||||||| Sbjct: 635 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 586
>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds Length = 1086 Score = 125 bits (63), Expect = 1e-25 Identities = 149/179 (83%) Strand = Plus / Minus Query: 132 tcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggngccc 191 |||| |||||| |||| |||||| || |||||||| || ||||||||| || | ||| Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724 Query: 192 ttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgggcatnctca 251 ||||||||||||||||| || || || || | ||||||| |||||| ||||| || | Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664 Query: 252 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacg 310 |||||||||||||||||| ||||||||||||||||||||||||| || || |||||||| Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaacacg 605
>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence Length = 128856 Score = 113 bits (57), Expect = 4e-22 Identities = 106/123 (86%) Strand = Plus / Minus Query: 189 cccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgggcatnc 248 ||||||||||| |||||||| ||| ||||||| | ||||||| ||||| ||||| | Sbjct: 83637 cccttgccaatagtgaacacattgaccagacgagttgcaaactcatgaccagtggcatcc 83578 Query: 249 tcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaaca 308 | ||||||||| ||||||||||||||||||||||| || |||||||||||||| |||||| Sbjct: 83577 tgaacgtggattgtctcaaaggttcccttatgcttttctctgttcttgatcactccaaca 83518 Query: 309 cgc 311 ||| Sbjct: 83517 cgc 83515
>ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 738 Score = 109 bits (55), Expect = 7e-21 Identities = 150/183 (81%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178 ||||||| ||||||||||||| |||||| ||| ||||||||||||||||| ||||| Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649 Query: 179 aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238 ||||| ||||||| |||||||| |||||||||| || | || |||||||| || Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589 Query: 239 ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298 |||||| ||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529 Query: 299 cac 301 ||| Sbjct: 528 cac 526
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 109 bits (55), Expect = 7e-21 Identities = 150/183 (81%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178 ||||||| ||||||||||||| |||||| ||| ||||||||||||||||| ||||| Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974 Query: 179 aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238 ||||| ||||||| |||||||| |||||||||| || | || |||||||| || Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914 Query: 239 ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298 |||||| ||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854 Query: 299 cac 301 ||| Sbjct: 80853 cac 80851
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 109 bits (55), Expect = 7e-21 Identities = 150/183 (81%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178 ||||||| ||||||||||||| |||||| ||| ||||||||||||||||| ||||| Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169 Query: 179 aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238 ||||| ||||||| |||||||| |||||||||| || | || |||||||| || Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109 Query: 239 ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298 |||||| ||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049 Query: 299 cac 301 ||| Sbjct: 17551048 cac 17551046
>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full insert sequence Length = 1162 Score = 109 bits (55), Expect = 7e-21 Identities = 150/183 (81%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178 ||||||| ||||||||||||| |||||| ||| ||||||||||||||||| ||||| Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801 Query: 179 aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238 ||||| ||||||| |||||||| |||||||||| || | || |||||||| || Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741 Query: 239 ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298 |||||| ||| || ||||||||||||||| | ||||| |||||||||||| ||||||| Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681 Query: 299 cac 301 ||| Sbjct: 680 cac 678
>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds Length = 1054 Score = 79.8 bits (40), Expect = 6e-12 Identities = 55/60 (91%) Strand = Plus / Minus Query: 252 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||| || ||||||||| | ||||||||||||||||||||||||||||| ||||||||| Sbjct: 726 acgtgaattgtctcaaagctacccttatgcttctccctgttcttgatcactccaacacgc 667 Score = 44.1 bits (22), Expect = 0.33 Identities = 33/37 (89%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttgccca 216 ||||| | |||||||||||| |||||||| ||||||| Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgccca 762
>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 69.9 bits (35), Expect = 6e-09 Identities = 105/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||||||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 507 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 506 caatcttgtt 497
>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4 Length = 966 Score = 69.9 bits (35), Expect = 6e-09 Identities = 64/74 (86%) Strand = Plus / Minus Query: 234 tgaccctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 293 |||||||| | || || || ||||| |||||||||| | ||||||||||||||||||||| Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637 Query: 294 ttgatcacaccaac 307 || || |||||||| Sbjct: 636 ttaataacaccaac 623
>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420 mRNA, complete cds Length = 1080 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 663 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 787 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 786 tcctttgccaatggtgtacac 766
>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds Length = 789 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 570 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 694 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 693 tcctttgccaatggtgtacac 673
>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 995 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 643 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 766 tcctttgccaatggtgtacac 746
>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 1005 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 654 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 778 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 777 tcctttgccaatggtgtacac 757
>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 978 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 664 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 788 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 787 tcctttgccaatggtgtacac 767
>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 537 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 183 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 307 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 306 tcctttgccaatggtgtacac 286
>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 988 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 634 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 758 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 757 tcctttgccaatggtgtacac 737
>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB61ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 737 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 383 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 507 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 506 tcctttgccaatggtgtacac 486
>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB12ZD07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 566 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 212 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 336 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 335 tcctttgccaatggtgtacac 315
>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 997 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 643 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 766 tcctttgccaatggtgtacac 746
>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence Length = 1010 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 658 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 782 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 781 tcctttgccaatggtgtacac 761
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2 Length = 51440 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||||| |||||||||||||||| | ||| || ||||||||||||||| Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 6715 Score = 46.1 bits (23), Expect = 0.084 Identities = 66/81 (81%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 |||||| ||||| || |||| |||||| ||||||||||| || |||||| ||||| | Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 6839 Query: 188 gcccttgccaatggtgaacac 208 || |||||||||||| |||| Sbjct: 6838 tcctttgccaatggtgtacac 6818
>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence Length = 728 Score = 67.9 bits (34), Expect = 2e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 252 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 301 |||||||||||||| ||| | ||||| ||||||||||||||||||||||| Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442 Score = 46.1 bits (23), Expect = 0.084 Identities = 29/31 (93%) Strand = Plus / Minus Query: 281 cttctccctgttcttgatcacaccaacacgc 311 ||||||||||||||||||||| || |||||| Sbjct: 429 cttctccctgttcttgatcactcctacacgc 399
>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like protein mRNA, complete cds Length = 1052 Score = 67.9 bits (34), Expect = 2e-08 Identities = 49/54 (90%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 307 ||||| |||||||||| | ||||||||||||||||||||||| || |||||||| Sbjct: 659 gtggagggtctcaaagctacccttatgcttctccctgttcttaataacaccaac 606
>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds Length = 1105 Score = 65.9 bits (33), Expect = 9e-08 Identities = 148/188 (78%) Strand = Plus / Minus Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187 ||||||||||||||| | | |||||||||||||||||| || |||||| ||||| | Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781 Query: 188 gcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgggcatn 247 || || || ||||| || || ||||| ||||| | ||||||| |||||| ||| || Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721 Query: 248 ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 307 || || ||| | ||||| ||| | |||||||| ||||||||||||||||| || ||||| Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661 Query: 308 acgcncag 315 ||| ||| Sbjct: 660 tcgcccag 653
>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.2 mRNA, complete cds Length = 1174 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 679 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 621 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 620 caatcttgtt 611 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830
>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.1 mRNA, complete cds Length = 1088 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 536 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 535 caatcttgtt 526 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 820 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 509 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 508 caatcttgtt 499 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 1059 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 533 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 532 caatcttgtt 523 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA project) Length = 104607 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 7836 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 7778 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 7777 caatcttgtt 7768 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987
>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 789 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 509 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 508 caatcttgtt 499 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 1008 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 533 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 532 caatcttgtt 523 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1168 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Plus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 414 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 472 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 473 caatcttgtt 482 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Plus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263
>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 976 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 561 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 503 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 502 caatcttgtt 493 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712
>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 942 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 507 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 506 caatcttgtt 497 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716
>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 952 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 554 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 496 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 495 caatcttgtt 486 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705
>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence Length = 1011 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 536 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 535 caatcttgtt 526 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9 Length = 86380 Score = 61.9 bits (31), Expect = 1e-06 Identities = 104/130 (80%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313 |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| | Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560 Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373 | | | || ||| ||||||| || || || || || |||||||||||||| ||| Sbjct: 82559 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 82501 Query: 374 caatcttgtt 383 |||||||||| Sbjct: 82500 caatcttgtt 82491 Score = 40.1 bits (20), Expect = 5.2 Identities = 31/35 (88%) Strand = Plus / Minus Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163 |||||||||||||| |||| ||||| |||||||| Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710
>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e Length = 1090 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 258 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacg 310 |||||||||||| | |||||||||||||||||||| || || || |||||||| Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacg 626
>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14 Length = 86121 Score = 54.0 bits (27), Expect = 3e-04 Identities = 52/59 (88%), Gaps = 1/59 (1%) Strand = Plus / Plus Query: 254 gtggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgc 311 |||||||||||||||| ||||||| || || | | | |||||||||||||||||||||| Sbjct: 15623 gtggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgc 15681
>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360 mRNA, complete cds Length = 1074 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 683
>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360) mRNA, complete cds Length = 817 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 570
>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360) mRNA, complete cds Length = 1032 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 699 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 642
>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 813 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 570
>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1034 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 700 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 643
>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1000 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 685 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 628
>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB21ZB04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1007 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 692 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 635
>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 984 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||| | ||||||||||||| || | |||||| |||||||| |||||| Sbjct: 625 gtggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgc 568
>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 934 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 |||||| ||||||| | |||||||||||||||| | ||||| |||||||| |||||| Sbjct: 625 gtggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgc 568
>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence Length = 1023 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 683
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete sequence. Sequence from clones T23A1, F5J6, MJB20 Length = 76170 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311 ||||||||| |||||| | ||||| || ||||| | |||||| ||||||||||||||| Sbjct: 48796 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 48739
>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein (MG02747.4) partial mRNA Length = 735 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Minus Query: 127 gctcctcaatgatggtgagctngatacccttgcccttggg 166 |||||||| ||||||||||| || ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein (FG08714.1) partial mRNA Length = 732 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Minus Query: 127 gctcctcaatgatggtgagctngatacccttgcccttggg 166 |||||||| ||||||||||| || ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA, complete cds Length = 1024 Score = 50.1 bits (25), Expect = 0.005 Identities = 36/40 (90%) Strand = Plus / Minus Query: 127 gctcctcaatgatggtgagctngatacccttgcccttggg 166 |||||||| ||||||||||| || ||||||||||||||| Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727
>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence Length = 1292 Score = 46.1 bits (23), Expect = 0.084 Identities = 32/35 (91%) Strand = Plus / Minus Query: 261 gtctcaaaggttcccttatgcttctccctgttctt 295 ||||||||| | ||||| ||||||||||||||||| Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttctt 666 Score = 46.1 bits (23), Expect = 0.084 Identities = 25/26 (96%) Strand = Plus / Minus Query: 355 tcaaacttgatgaagncaacaatctt 380 ||||||||||||||| |||||||||| Sbjct: 607 tcaaacttgatgaagtcaacaatctt 582
>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA Length = 992 Score = 44.1 bits (22), Expect = 0.33 Identities = 30/33 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212 |||||| ||||||||||||| ||||||||||| Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttg 781
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 44.1 bits (22), Expect = 0.33 Identities = 24/25 (96%) Strand = Plus / Minus Query: 232 ggtgaccctgggcatnctcaacgtg 256 ||||||||||||||| ||||||||| Sbjct: 4589196 ggtgaccctgggcatgctcaacgtg 4589172
>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA Length = 783 Score = 44.1 bits (22), Expect = 0.33 Identities = 27/29 (93%) Strand = Plus / Minus Query: 138 atggtgagctngatacccttgcccttggg 166 |||| ||||| |||||||||||||||||| Sbjct: 743 atggagagcttgatacccttgcccttggg 715
>gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306, section 415 of 469 of the complete genome Length = 10848 Score = 44.1 bits (22), Expect = 0.33 Identities = 24/25 (96%) Strand = Plus / Minus Query: 232 ggtgaccctgggcatnctcaacgtg 256 ||||||||||||||| ||||||||| Sbjct: 8128 ggtgaccctgggcatgctcaacgtg 8104
>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript variant A (RpS4), mRNA Length = 983 Score = 44.1 bits (22), Expect = 0.33 Identities = 30/33 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212 |||||| ||||||||||||| ||||||||||| Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttg 781
>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript variant B (RpS4), mRNA Length = 969 Score = 44.1 bits (22), Expect = 0.33 Identities = 30/33 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212 |||||| ||||||||||||| ||||||||||| Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttg 767
>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 207761 Score = 44.1 bits (22), Expect = 0.33 Identities = 30/33 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212 |||||| ||||||||||||| ||||||||||| Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttg 141900
>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete sequence Length = 272016 Score = 44.1 bits (22), Expect = 0.33 Identities = 30/33 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212 |||||| ||||||||||||| ||||||||||| Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttg 169834
>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds Length = 852 Score = 44.1 bits (22), Expect = 0.33 Identities = 27/29 (93%) Strand = Plus / Minus Query: 138 atggtgagctngatacccttgcccttggg 166 |||| ||||| |||||||||||||||||| Sbjct: 745 atggagagcttgatacccttgcccttggg 717
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 44.1 bits (22), Expect = 0.33 Identities = 27/29 (93%) Strand = Plus / Plus Query: 138 atggtgagctngatacccttgcccttggg 166 |||| ||||| |||||||||||||||||| Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919
>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4, complete cds Length = 870 Score = 44.1 bits (22), Expect = 0.33 Identities = 30/33 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212 |||||| ||||||||||||| ||||||||||| Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttg 681
>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence Length = 149455 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 160 ccttggggaggctcacccaag 180 ||||||||||||||||||||| Sbjct: 134897 ccttggggaggctcacccaag 134877
>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA, isoform A (LOC583495), partial mRNA Length = 285 Score = 42.1 bits (21), Expect = 1.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 204 aacacgttgcccagacggntggca 227 |||||||||||||||||| ||||| Sbjct: 179 aacacgttgcccagacgggtggca 156
>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal protein S4e mRNA, complete cds Length = 792 Score = 42.1 bits (21), Expect = 1.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 180 ggcttggngcccttgccaatggtgaacacgtt 211 ||||||| ||||||||||||| |||| ||||| Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670
>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence Length = 124792 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 282 ttctccctgttcttgatcaca 302 ||||||||||||||||||||| Sbjct: 120862 ttctccctgttcttgatcaca 120842
>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA Length = 2945 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 gccaatggtgaacacgttgc 213 |||||||||||||||||||| Sbjct: 1770 gccaatggtgaacacgttgc 1789
>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence Length = 197827 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatga 138 |||||||||||||||||||| Sbjct: 23788 cttcctctgctcctcaatga 23769
>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence Length = 160031 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 tccctcttcctctgctcctc 133 |||||||||||||||||||| Sbjct: 75373 tccctcttcctctgctcctc 75392
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence Length = 243671 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 ggttccaggaacatagttct 33 |||||||||||||||||||| Sbjct: 192051 ggttccaggaacatagttct 192032
>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence Length = 156239 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ctcttcctctgctcctcaat 136 |||||||||||||||||||| Sbjct: 47354 ctcttcctctgctcctcaat 47335
>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone MGC:34152 IMAGE:5198480), complete cds Length = 1554 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 80 gaatcaggccttggcagcagcctg 103 |||||||||||||||||| ||||| Sbjct: 421 gaatcaggccttggcagccgcctg 398
>emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227D1 on chromosome X Contains part of the IL1RAPL2 gene for interleukin 1 receptor accessory protein-like 2, complete sequence Length = 33667 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 aaaggttcccttatgcttct 285 |||||||||||||||||||| Sbjct: 13597 aaaggttcccttatgcttct 13578
>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene, the 3' end of a gene for cellular modulator of immune recognition (c-MIR) and five CpG islands, complete sequence Length = 129266 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 ttctatatccttgcagataactgg 53 |||||||||||| ||||||||||| Sbjct: 81474 ttctatatccttacagataactgg 81451
>ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predicted mRNA Length = 1485 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatga 138 |||||||||||||||||||| Sbjct: 1026 cttcctctgctcctcaatga 1007
>ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC581083 (LOC581083), mRNA Length = 1197 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 tccctcttcctctgctcctc 133 |||||||||||||||||||| Sbjct: 764 tccctcttcctctgctcctc 745
>emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clone 1a13 Length = 2945 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 gccaatggtgaacacgttgc 213 |||||||||||||||||||| Sbjct: 1770 gccaatggtgaacacgttgc 1789
>emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 in linkage group 10, complete sequence Length = 210640 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 tcttcctctgctcctcaatg 137 |||||||||||||||||||| Sbjct: 25208 tcttcctctgctcctcaatg 25189
>gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, complete sequence Length = 175223 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 2 cttaaaaaagatggttccag 21 |||||||||||||||||||| Sbjct: 158366 cttaaaaaagatggttccag 158385
>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete sequences Length = 203521 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 130844 tagttctatatccttgcaga 130825
>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 228097 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ctcttcctctgctcctcaat 136 |||||||||||||||||||| Sbjct: 63018 ctcttcctctgctcctcaat 62999
>gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II, Alzheimer disease) (APP) gene, complete cds Length = 293960 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 254416 tagttctatatccttgcaga 254435
>gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosome 18, complete sequence Length = 205253 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 ctcttcctctgctcctcaat 136 |||||||||||||||||||| Sbjct: 62232 ctcttcctctgctcctcaat 62251
>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105 Length = 340000 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 325187 tagttctatatccttgcaga 325168
>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence Length = 113482 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 ggttccaggaacatagttct 33 |||||||||||||||||||| Sbjct: 64196 ggttccaggaacatagttct 64177
>gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, complete sequence Length = 150428 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 cttcctctgctcctcaatga 138 |||||||||||||||||||| Sbjct: 147440 cttcctctgctcctcaatga 147421
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 119 cttcctctgctcctcaatga 138 |||||||||||||||||||| Sbjct: 2525910 cttcctctgctcctcaatga 2525929
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete sequence Length = 215366 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 tgcccttggggaggctcacc 176 |||||||||||||||||||| Sbjct: 213316 tgcccttggggaggctcacc 213297
>emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-661G16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 162691 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 ctcttcctctgctcctcaat 136 |||||||||||||||||||| Sbjct: 27574 ctcttcctctgctcctcaat 27593
>dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone B2291C14-R44F3, segment 6/10, complete sequence Length = 100000 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 24483 tagttctatatccttgcaga 24464
>dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, complete cds Length = 301692 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 258129 tagttctatatccttgcaga 258148
>dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:T1715, LL56-APP region, complete sequence Length = 68001 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 7611 tagttctatatccttgcaga 7592
>dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related, B2291C14-T1533 region, segment 5/7 Length = 161014 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tagttctatatccttgcaga 46 |||||||||||||||||||| Sbjct: 124483 tagttctatatccttgcaga 124464 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,575,558 Number of Sequences: 3902068 Number of extensions: 2575558 Number of successful extensions: 51338 Number of sequences better than 10.0: 112 Number of HSP's better than 10.0 without gapping: 112 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 51028 Number of HSP's gapped (non-prelim): 299 length of query: 386 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 364 effective length of database: 17,147,199,772 effective search space: 6241580717008 effective search space used: 6241580717008 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)