ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4k08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,... 482 e-133
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 283 2e-73
3dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 283 2e-73
4dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
5dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
6dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 5e-71
7gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps... 212 6e-52
8gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds 204 2e-49
9emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 200 2e-48
10gb|BT016261.1| Zea mays clone Contig94 mRNA sequence 198 9e-48
11gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA,... 198 9e-48
12gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence 196 4e-47
13ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predic... 159 8e-36
14dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 159 8e-36
15dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic D... 159 8e-36
16dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
17gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4... 125 1e-25
18gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete s... 113 4e-22
19ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predic... 109 7e-21
20gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome... 109 7e-21
21dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-21
22dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-21
23gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, comple... 80 6e-12
24emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
25emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal pro... 70 6e-09
26ref|NM_125228.3| Arabidopsis thaliana structural constituent of ... 68 2e-08
27gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, comp... 68 2e-08
28gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, comp... 68 2e-08
29gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mR... 68 2e-08
30emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
31emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
32emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
33emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
34emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
35emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
36gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete s... 68 2e-08
37dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 68 2e-08
38gb|AY110862.1| Zea mays CL1882_8 mRNA sequence 68 2e-08
39gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal prot... 68 2e-08
40dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, com... 66 9e-08
41ref|NM_001036769.1| Arabidopsis thaliana structural constituent ... 62 1e-06
42ref|NM_120791.2| Arabidopsis thaliana structural constituent of ... 62 1e-06
43gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal prote... 62 1e-06
44gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal prote... 62 1e-06
45emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B... 62 1e-06
46gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 62 1e-06
47gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 62 1e-06
48emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
49emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
50emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
51emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
52gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete s... 62 1e-06
53dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 62 1e-06
54emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal prote... 58 2e-05
55dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 3e-04
56ref|NM_127291.2| Arabidopsis thaliana structural constituent of ... 52 0.001
57gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S... 52 0.001
58gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S... 52 0.001
59gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, comple... 52 0.001
60gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA... 52 0.001
61emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Co... 52 0.001
62emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Co... 52 0.001
63emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Co... 52 0.001
64emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Co... 52 0.001
65gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete s... 52 0.001
66gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II sectio... 52 0.001
67ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 50 0.005
68ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 50 0.005
69gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-lik... 50 0.005
70gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence 46 0.084
71gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA 44 0.33
72emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 44 0.33
73ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predi... 44 0.33
74gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306, secti... 44 0.33
75ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG... 44 0.33
76ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG... 44 0.33
77gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell ... 44 0.33
78gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46... 44 0.33
79gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 ... 44 0.33
80emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 44 0.33
81dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribos... 44 0.33
82gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom... 42 1.3
83ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.3
84gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putat... 42 1.3
85gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete s... 42 1.3
86ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1... 40 5.2
87gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com... 40 5.2
88gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence 40 5.2
89gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 5.2
90gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome... 40 5.2
91gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRN... 40 5.2
92emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227... 40 5.2
93emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chrom... 40 5.2
94ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predi... 40 5.2
95ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 5.2
96emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.2
97emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 i... 40 5.2
98gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, com... 40 5.2
99dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,... 40 5.2
100emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1... 40 5.2
101gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein ... 40 5.2
102gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosom... 40 5.2
103dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.2
104gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple... 40 5.2
105gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, com... 40 5.2
106emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 5.2
107emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 40 5.2
108emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-6... 40 5.2
109dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 5.2
110dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, co... 40 5.2
111dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 5.2
112dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related... 40 5.2

>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score =  482 bits (243), Expect = e-133
 Identities = 345/381 (90%), Gaps = 2/381 (0%)
 Strand = Plus / Minus

                                                                       
Query: 3   ttaaaaaagatggttccaggaacatagttctatatccttgcagataactggctntagcaa 62
           ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 972 ttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctatagcaa 914

                                                                       
Query: 63  aacgactcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccctcttc 122
           ||||| |||| |||||||||||||||||||||||| ||||| || |||||||||||||||
Sbjct: 913 aacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccctcttc 854

                                                                       
Query: 123 ctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggc 182
           |||||||||||||||||||| |||| |||||| ||||||||||||||| ||||||| |||
Sbjct: 853 ctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcacccacggc 794

                                                                       
Query: 183 ttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgg 242
           |||| ||||||||| ||||||||||| ||||| |||||| |||| |||||||||||||| 
Sbjct: 793 ttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgaccctga 734

                                                                       
Query: 243 gcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcaca 302
           |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 733 gcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgatcaca 674

                                                                       
Query: 303 ccaacacgcncagngntgcgcccaccantcaccatgacnacnttgccngacntcaaactt 362
           ||||||||  ||| | | ||||||||| | |||||||| || |||||  || ||||||||
Sbjct: 673 ccaacacggccagtgttacgcccaccagtaaccatgacaacattgcca-acatcaaactt 615

                                
Query: 363 gatgaagncaacaatcttgtt 383
           ||||||| |||||||||||||
Sbjct: 614 gatgaagtcaacaatcttgtt 594



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  283 bits (143), Expect = 2e-73
 Identities = 254/294 (86%), Gaps = 1/294 (0%)
 Strand = Plus / Plus

                                                                          
Query: 90     ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
              |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| |
Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026

                                                                          
Query: 150    atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
              || |||||||||||||| ||||||||||||||||||  ||||||||||||||||||||| 
Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086

                                                                          
Query: 210    ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
              |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| |||
Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146

                                                                          
Query: 270    gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
               | || |||||||||||||||||||||||||||||||||||  | | | | |  || |||
Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206

                                                                    
Query: 330    ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
               |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 317207 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 317259



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 26     atagttctatatccttgcagataactggctntagcaaaac 65
              ||||||||||||||||||| | |||| ||| |||||||||
Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935



to top

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score =  283 bits (143), Expect = 2e-73
 Identities = 254/294 (86%), Gaps = 1/294 (0%)
 Strand = Plus / Plus

                                                                         
Query: 90    ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
             |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| |
Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810

                                                                         
Query: 150   atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
             || |||||||||||||| ||||||||||||||||||  ||||||||||||||||||||| 
Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870

                                                                         
Query: 210   ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
             |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| |||
Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930

                                                                         
Query: 270   gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
              | || |||||||||||||||||||||||||||||||||||  | | | | |  || |||
Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990

                                                                   
Query: 330   ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
              |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 45991 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 46043



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 26    atagttctatatccttgcagataactggctntagcaaaac 65
             ||||||||||||||||||| | |||| ||| |||||||||
Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719



to top

>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full
           insert sequence
          Length = 1016

 Score =  283 bits (143), Expect = 2e-73
 Identities = 254/294 (86%), Gaps = 1/294 (0%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| |
Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827

                                                                       
Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
           || |||||||||||||| ||||||||||||||||||  ||||||||||||||||||||| 
Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767

                                                                       
Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
           |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| |||
Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707

                                                                       
Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
            | || |||||||||||||||||||||||||||||||||||  | | | | |  || |||
Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647

                                                                 
Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
            |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 646 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 594



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 26  atagttctatatccttgcagataactggctntagcaaaac 65
           ||||||||||||||||||| | |||| ||| |||||||||
Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918



to top

>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full
           insert sequence
          Length = 1157

 Score =  283 bits (143), Expect = 2e-73
 Identities = 254/294 (86%), Gaps = 1/294 (0%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| |
Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831

                                                                       
Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
           || |||||||||||||| ||||||||||||||||||  ||||||||||||||||||||| 
Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771

                                                                       
Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
           |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| |||
Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711

                                                                       
Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
            | || |||||||||||||||||||||||||||||||||||  | | | | |  || |||
Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651

                                                                 
Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
            |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 650 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 598



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 26  atagttctatatccttgcagataactggctntagcaaaac 65
           ||||||||||||||||||| | |||| ||| |||||||||
Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922



to top

>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full
           insert sequence
          Length = 1079

 Score =  276 bits (139), Expect = 5e-71
 Identities = 253/294 (86%), Gaps = 1/294 (0%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||| |
Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823

                                                                       
Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
           || |||||||||||||| ||||||||||||||||||  ||||||||||||||||||||  
Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763

                                                                       
Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
           |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| |||
Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703

                                                                       
Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
            | || |||||||||||||||||||||||||||||||||||  | | | | |  || |||
Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643

                                                                 
Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
            |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 642 gtcaccatgacaacattgcca-acatcaaacttgatgaagtcgacaatcttgtt 590



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 26  atagttctatatccttgcagataactggctntagcaaaac 65
           ||||||||||||||||||| | |||| ||| |||||||||
Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914



to top

>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds
          Length = 1013

 Score =  212 bits (107), Expect = 6e-52
 Identities = 245/294 (83%), Gaps = 1/294 (0%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||| |
Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805

                                                                       
Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
           || |||||||||||||| ||||||||||| |||||    |||||||| ||||||||||||
Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745

                                                                       
Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
           ||||||| |||| |||| |||||||| ||| |||  | ||| ||||| ||||||||||||
Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685

                                                                       
Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
            | ||||| |||||||||||||||||||| ||||| || ||  ||| | | |  || |||
Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625

                                                                 
Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
            |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 624 gtcaccatgacgacgttgcca-acatcaaacttgatgaagtccacaatcttgtt 572



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 22  gaacatagttctatatccttgcaga 46
           |||||| ||||||||||||||||||
Sbjct: 936 gaacattgttctatatccttgcaga 912



to top

>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds
          Length = 1037

 Score =  204 bits (103), Expect = 2e-49
 Identities = 244/294 (82%), Gaps = 1/294 (0%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||| |
Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803

                                                                       
Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
           || |||||||||||||| ||||||||||| |||||    |||||||| ||||||||||||
Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743

                                                                       
Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
           ||||||| |||| |||| |||||||| ||| |||  | ||| ||||| |||||||||| |
Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683

                                                                       
Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
            | ||||| |||||||||||||||||||| ||||| |||||  ||| | | |  || |||
Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623

                                                                 
Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
            |||||||||| || |||||  || ||||||||||||||| | ||||| |||||
Sbjct: 622 gtcaccatgacaacgttgcca-acatcaaacttgatgaagtccacaattttgtt 570



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 22  gaacatagttctatatccttgcaga 46
           |||||| ||||||||||||||||||
Sbjct: 934 gaacattgttctatatccttgcaga 910



to top

>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4
          Length = 1148

 Score =  200 bits (101), Expect = 2e-48
 Identities = 190/217 (87%), Gaps = 3/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctn 148
           |||||||||||||| || || || |||| |||||| ||||||| | |||||| |||||| 
Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807

                                                                       
Query: 149 gatacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacac 208
           ||| |||||||||||||| ||||||||||||||||||  |||||||||||||||||||||
Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747

                                                                       
Query: 209 gttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaa 268
            |||||||||||| |||| || ||||| ||| |||||| |||||||||||||||||| ||
Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687

                                                
Query: 269 ggttcccttatgcttctccctgttcttgatcacacca 305
            | | |||| |||||||||||||| ||||||||||||
Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651



to top

>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence
          Length = 1116

 Score =  198 bits (100), Expect = 9e-48
 Identities = 210/249 (84%), Gaps = 1/249 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 tcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaag 180
           ||||||||||||| |||||| |||||| |||||||||||||||||| ||||||||||| |
Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806

                                                                       
Query: 181 gcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccct 240
           |||||  ||||||||| |||||||||||||||||||  ||| |||| |||||||| ||| 
Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746

                                                                       
Query: 241 gggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 300
            ||  | ||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686

                                                                       
Query: 301 caccaacacgcncagngntgcgcccaccantcaccatgacnacnttgccngacntcaaac 360
           |||| |||||| | | | | | ||| ||  |||||||||| || ||||| ||| ||||||
Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgcc-gacgtcaaac 627

                    
Query: 361 ttgatgaag 369
           |||||||||
Sbjct: 626 ttgatgaag 618



to top

>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds
          Length = 1090

 Score =  198 bits (100), Expect = 9e-48
 Identities = 210/249 (84%), Gaps = 1/249 (0%)
 Strand = Plus / Minus

                                                                       
Query: 121 tcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaag 180
           ||||||||||||| |||||| |||||| |||||||||||||||||| ||||||||||| |
Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785

                                                                       
Query: 181 gcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccct 240
           |||||  ||||||||| |||||||||||||||||||  ||| |||| |||||||| ||| 
Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725

                                                                       
Query: 241 gggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 300
            ||  | ||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665

                                                                       
Query: 301 caccaacacgcncagngntgcgcccaccantcaccatgacnacnttgccngacntcaaac 360
           |||| |||||| | | | | | ||| ||  |||||||||| || ||||| ||| ||||||
Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgcc-gacgtcaaac 606

                    
Query: 361 ttgatgaag 369
           |||||||||
Sbjct: 605 ttgatgaag 597



to top

>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score =  196 bits (99), Expect = 4e-47
 Identities = 243/294 (82%), Gaps = 1/294 (0%)
 Strand = Plus / Plus

                                                                       
Query: 90  ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctng 149
           |||||||||||||| || || ||||||| |||||| ||||| || |||||| | |||| |
Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237

                                                                       
Query: 150 atacccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacg 209
           || ||||| |||||||| ||||||||||| |||||    |||||||| ||||||||||||
Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297

                                                                       
Query: 210 ttgcccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaag 269
           ||||||| |||| |||| |||||||| ||| |||  | ||| ||||| || |||||||||
Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357

                                                                       
Query: 270 gttcccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccacca 329
            | ||||| |||||||||||||||||||| ||||| |||||  ||| | | |  || |||
Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417

                                                                 
Query: 330 ntcaccatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
            |||||||||| || |||||  || ||||||||||||||| | |||||||||||
Sbjct: 418 gtcaccatgacgacgttgcca-acatcaaacttgatgaagtccacaatcttgtt 470



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 21  ggaacatagttctatatccttgcaga 46
           ||||||| ||||||||||||||||||
Sbjct: 105 ggaacattgttctatatccttgcaga 130



to top

>ref|NM_193994.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 768

 Score =  159 bits (80), Expect = 8e-36
 Identities = 236/291 (81%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                       
Query: 93  gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| ||||
Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699

                                                                       
Query: 153 cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212
           ||||||||||| |||||   |||||| ||||||  ||||||||| ||||||||||| |||
Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639

                                                                       
Query: 213 cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272
           ||||||||| |||| ||    || |||   || | ||| || ||||||||||||||  | 
Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579

                                                                       
Query: 273 cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332
           ||||| ||||||||||||||||| || || ||||||||  ||| | | | ||| ||  | 
Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 519

                                                              
Query: 333 accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
           ||||| || || |||||  || ||||||||||||||| |||||||||||||
Sbjct: 518 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 469



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  159 bits (80), Expect = 8e-36
 Identities = 236/291 (81%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                            
Query: 93       gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152
                |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| ||||
Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910

                                                                            
Query: 153      cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212
                ||||||||||| |||||   |||||| ||||||  ||||||||| ||||||||||| |||
Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850

                                                                            
Query: 213      cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272
                ||||||||| |||| ||    || |||   || | ||| || ||||||||||||||  | 
Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790

                                                                            
Query: 273      cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332
                ||||| ||||||||||||||||| || || ||||||||  ||| | | | ||| ||  | 
Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 14497730

                                                                   
Query: 333      accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
                ||||| || || |||||  || ||||||||||||||| |||||||||||||
Sbjct: 14497729 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 14497680



to top

>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0514H03
          Length = 167230

 Score =  159 bits (80), Expect = 8e-36
 Identities = 236/291 (81%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                         
Query: 93    gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152
             |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| ||||
Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223

                                                                         
Query: 153   cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212
             ||||||||||| |||||   |||||| ||||||  ||||||||| ||||||||||| |||
Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163

                                                                         
Query: 213   cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272
             ||||||||| |||| ||    || |||   || | ||| || ||||||||||||||  | 
Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103

                                                                         
Query: 273   cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332
             ||||| ||||||||||||||||| || || ||||||||  ||| | | | ||| ||  | 
Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 57043

                                                                
Query: 333   accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
             ||||| || || |||||  || ||||||||||||||| |||||||||||||
Sbjct: 57042 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 56993



to top

>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full
           insert sequence
          Length = 1035

 Score =  159 bits (80), Expect = 8e-36
 Identities = 236/291 (81%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                       
Query: 93  gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagctngata 152
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||| ||||
Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816

                                                                       
Query: 153 cccttgcccttggggaggctcacccaaggcttggngcccttgccaatggtgaacacgttg 212
           ||||||||||| |||||   |||||| ||||||  ||||||||| ||||||||||| |||
Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756

                                                                       
Query: 213 cccagacggntggcaaactggtgaccctgggcatnctcaacgtggatggtctcaaaggtt 272
           ||||||||| |||| ||    || |||   || | ||| || ||||||||||||||  | 
Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696

                                                                       
Query: 273 cccttatgcttctccctgttcttgatcacaccaacacgcncagngntgcgcccaccantc 332
           ||||| ||||||||||||||||| || || ||||||||  ||| | | | ||| ||  | 
Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 636

                                                              
Query: 333 accatgacnacnttgccngacntcaaacttgatgaagncaacaatcttgtt 383
           ||||| || || |||||  || ||||||||||||||| |||||||||||||
Sbjct: 635 accataacgacattgccc-acatcaaacttgatgaagtcaacaatcttgtt 586



to top

>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds
          Length = 1086

 Score =  125 bits (63), Expect = 1e-25
 Identities = 149/179 (83%)
 Strand = Plus / Minus

                                                                       
Query: 132 tcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggngccc 191
           |||| |||||| |||| |||||| || |||||||| ||   ||||||||| || |  |||
Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724

                                                                       
Query: 192 ttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgggcatnctca 251
           ||||||||||||||||| || || || ||  | ||||||| ||||||   ||||| || |
Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664

                                                                      
Query: 252 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacg 310
           |||||||||||||||||| ||||||||||||||||||||||||| || || ||||||||
Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaacacg 605



to top

>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence
          Length = 128856

 Score =  113 bits (57), Expect = 4e-22
 Identities = 106/123 (86%)
 Strand = Plus / Minus

                                                                         
Query: 189   cccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgggcatnc 248
             ||||||||||| |||||||| ||| |||||||  | |||||||  |||||   ||||| |
Sbjct: 83637 cccttgccaatagtgaacacattgaccagacgagttgcaaactcatgaccagtggcatcc 83578

                                                                         
Query: 249   tcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaaca 308
             | ||||||||| ||||||||||||||||||||||| || |||||||||||||| ||||||
Sbjct: 83577 tgaacgtggattgtctcaaaggttcccttatgcttttctctgttcttgatcactccaaca 83518

                
Query: 309   cgc 311
             |||
Sbjct: 83517 cgc 83515



to top

>ref|XM_475130.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 738

 Score =  109 bits (55), Expect = 7e-21
 Identities = 150/183 (81%)
 Strand = Plus / Minus

                                                                       
Query: 119 cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178
           |||||||  ||||||||||||| |||||| ||| |||||||||||||||||    |||||
Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649

                                                                       
Query: 179 aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238
            |||||     ||||||| |||||||| ||||||||||  ||  | || |||||||| ||
Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589

                                                                       
Query: 239 ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298
             |||||| ||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529

              
Query: 299 cac 301
           |||
Sbjct: 528 cac 526



to top

>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07,
             complete sequence
          Length = 159932

 Score =  109 bits (55), Expect = 7e-21
 Identities = 150/183 (81%)
 Strand = Plus / Minus

                                                                         
Query: 119   cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178
             |||||||  ||||||||||||| |||||| ||| |||||||||||||||||    |||||
Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974

                                                                         
Query: 179   aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238
              |||||     ||||||| |||||||| ||||||||||  ||  | || |||||||| ||
Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914

                                                                         
Query: 239   ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298
               |||||| ||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854

                
Query: 299   cac 301
             |||
Sbjct: 80853 cac 80851



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  109 bits (55), Expect = 7e-21
 Identities = 150/183 (81%)
 Strand = Plus / Minus

                                                                            
Query: 119      cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178
                |||||||  ||||||||||||| |||||| ||| |||||||||||||||||    |||||
Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169

                                                                            
Query: 179      aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238
                 |||||     ||||||| |||||||| ||||||||||  ||  | || |||||||| ||
Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109

                                                                            
Query: 239      ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298
                  |||||| ||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049

                   
Query: 299      cac 301
                |||
Sbjct: 17551048 cac 17551046



to top

>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full
           insert sequence
          Length = 1162

 Score =  109 bits (55), Expect = 7e-21
 Identities = 150/183 (81%)
 Strand = Plus / Minus

                                                                       
Query: 119 cttcctctgctcctcaatgatggtgagctngatacccttgcccttggggaggctcaccca 178
           |||||||  ||||||||||||| |||||| ||| |||||||||||||||||    |||||
Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801

                                                                       
Query: 179 aggcttggngcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgacc 238
            |||||     ||||||| |||||||| ||||||||||  ||  | || |||||||| ||
Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741

                                                                       
Query: 239 ctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 298
             |||||| ||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681

              
Query: 299 cac 301
           |||
Sbjct: 680 cac 678



to top

>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds
          Length = 1054

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||| || ||||||||| | ||||||||||||||||||||||||||||| |||||||||
Sbjct: 726 acgtgaattgtctcaaagctacccttatgcttctccctgttcttgatcactccaacacgc 667



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 180 ggcttggngcccttgccaatggtgaacacgttgccca 216
           ||||| | |||||||||||| |||||||| |||||||
Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgccca 762



to top

>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 105/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||||||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 507

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 506 caatcttgtt 497



to top

>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4
          Length = 966

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 234 tgaccctgggcatnctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 293
           |||||||| | || || || ||||| |||||||||| | |||||||||||||||||||||
Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637

                         
Query: 294 ttgatcacaccaac 307
           || || ||||||||
Sbjct: 636 ttaataacaccaac 623



to top

>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420
           mRNA, complete cds
          Length = 1080

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 663



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 787

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 786 tcctttgccaatggtgtacac 766



to top

>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds
          Length = 789

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 570



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 694

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 693 tcctttgccaatggtgtacac 673



to top

>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 995

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 643



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746



to top

>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 1005

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 654



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 778

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 777 tcctttgccaatggtgtacac 757



to top

>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 978

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 664



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 788

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 787 tcctttgccaatggtgtacac 767



to top

>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 537

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 183



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 307

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 306 tcctttgccaatggtgtacac 286



to top

>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 634



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 758

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 757 tcctttgccaatggtgtacac 737



to top

>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 383



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 507

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 506 tcctttgccaatggtgtacac 486



to top

>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 566

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 212



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 336

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 335 tcctttgccaatggtgtacac 315



to top

>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 643



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746



to top

>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence
          Length = 1010

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 658



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 782

                                
Query: 188 gcccttgccaatggtgaacac 208
            || |||||||||||| ||||
Sbjct: 781 tcctttgccaatggtgtacac 761



to top

>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 254  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
            |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||
Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgc 6715



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 66/81 (81%)
 Strand = Plus / Minus

                                                                        
Query: 128  ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
            |||||| ||||| || |||| |||||| ||||||||||| ||   |||||| ||||| | 
Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 6839

                                 
Query: 188  gcccttgccaatggtgaacac 208
             || |||||||||||| ||||
Sbjct: 6838 tcctttgccaatggtgtacac 6818



to top

>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence
          Length = 728

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 252 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 301
           |||||||||||||| ||| | ||||| |||||||||||||||||||||||
Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 281 cttctccctgttcttgatcacaccaacacgc 311
           ||||||||||||||||||||| || ||||||
Sbjct: 429 cttctccctgttcttgatcactcctacacgc 399



to top

>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like
           protein mRNA, complete cds
          Length = 1052

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 307
           ||||| |||||||||| | ||||||||||||||||||||||| || ||||||||
Sbjct: 659 gtggagggtctcaaagctacccttatgcttctccctgttcttaataacaccaac 606



to top

>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds
          Length = 1105

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 148/188 (78%)
 Strand = Plus / Minus

                                                                       
Query: 128 ctcctcaatgatggtgagctngatacccttgcccttggggaggctcacccaaggcttggn 187
           ||||||||||||||| |  | |||||||||||||||||| ||   |||||| ||||| | 
Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781

                                                                       
Query: 188 gcccttgccaatggtgaacacgttgcccagacggntggcaaactggtgaccctgggcatn 247
            || || || ||||| || || ||||| |||||  | ||||||| ||||||  ||| || 
Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721

                                                                       
Query: 248 ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 307
           || || ||| |  ||||| ||| | |||||||| ||||||||||||||||| || |||||
Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661

                   
Query: 308 acgcncag 315
            ||| |||
Sbjct: 660 tcgcccag 653



to top

>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.2 mRNA, complete cds
          Length = 1174

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 679 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 621

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 620 caatcttgtt 611



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830



to top

>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.1 mRNA, complete cds
          Length = 1088

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 536

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 535 caatcttgtt 526



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745



to top

>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 820

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 509

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 508 caatcttgtt 499



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718



to top

>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 1059

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 533

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 532 caatcttgtt 523



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742



to top

>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA
            project)
          Length = 104607

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                        
Query: 254  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
            |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837

                                                                        
Query: 314  agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
               | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 7836 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 7778

                      
Query: 374  caatcttgtt 383
            ||||||||||
Sbjct: 7777 caatcttgtt 7768



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                               
Query: 129  tcctcaatgatggtgagctngatacccttgccctt 163
            |||||||||||||| ||||  ||||| ||||||||
Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987



to top

>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 789

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 509

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 508 caatcttgtt 499



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718



to top

>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 1008

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 533

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 532 caatcttgtt 523



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742



to top

>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1168

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Plus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 414 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 472

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 473 caatcttgtt 482



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263



to top

>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 976

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 561 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 503

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 502 caatcttgtt 493



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712



to top

>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 942

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 507

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 506 caatcttgtt 497



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716



to top

>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 554 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 496

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 495 caatcttgtt 486



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705



to top

>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence
          Length = 1011

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595

                                                                       
Query: 314 agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
              | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 536

                     
Query: 374 caatcttgtt 383
           ||||||||||
Sbjct: 535 caatcttgtt 526



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 129 tcctcaatgatggtgagctngatacccttgccctt 163
           |||||||||||||| ||||  ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745



to top

>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
          Length = 86380

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 104/130 (80%), Gaps = 1/130 (0%)
 Strand = Plus / Minus

                                                                         
Query: 254   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcnc 313
             |||||| ||||||||| ||||||||||||| || | |||||| |||||||| |||||| |
Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560

                                                                         
Query: 314   agngntgcgcccaccantcaccatgacnacnttgccngacntcaaacttgatgaagncaa 373
                | | |  || ||| ||||||| || || || ||  || ||||||||||||||  |||
Sbjct: 82559 tctgtttctgcctccagtcaccatcacaacgttaccc-acgtcaaacttgatgaactcaa 82501

                       
Query: 374   caatcttgtt 383
             ||||||||||
Sbjct: 82500 caatcttgtt 82491



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                                
Query: 129   tcctcaatgatggtgagctngatacccttgccctt 163
             |||||||||||||| ||||  ||||| ||||||||
Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710



to top

>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e
          Length = 1090

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 258 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacg 310
           |||||||||||| | |||||||||||||||||||| || || || ||||||||
Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacg 626



to top

>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                        
Query: 254   gtggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgc 311
             |||||||||||||||| ||||||| || || | | | ||||||||||||||||||||||
Sbjct: 15623 gtggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgc 15681



to top

>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360
           mRNA, complete cds
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 683



to top

>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 817

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 570



to top

>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 1032

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 699 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 642



to top

>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 813

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 570



to top

>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 700 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 643



to top

>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1000

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 685 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 628



to top

>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZB04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1007

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 692 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 635



to top

>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 984

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||| | ||||||||||||| || | |||||| |||||||| ||||||
Sbjct: 625 gtggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgc 568



to top

>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           |||||| ||||||| | |||||||||||||||| | |||||  |||||||| ||||||
Sbjct: 625 gtggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgc 568



to top

>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence
          Length = 1023

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 254 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 683



to top

>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
             sequence. Sequence from clones T23A1, F5J6, MJB20
          Length = 76170

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 311
             ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||
Sbjct: 48796 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgc 48739



to top

>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02747.4) partial mRNA
          Length = 735

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 127 gctcctcaatgatggtgagctngatacccttgcccttggg 166
           ||||||||  ||||||||||| || |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658



to top

>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG08714.1) partial mRNA
          Length = 732

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 127 gctcctcaatgatggtgagctngatacccttgcccttggg 166
           ||||||||  ||||||||||| || |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658



to top

>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA,
           complete cds
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 127 gctcctcaatgatggtgagctngatacccttgcccttggg 166
           ||||||||  ||||||||||| || |||||||||||||||
Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727



to top

>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence
          Length = 1292

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 261 gtctcaaaggttcccttatgcttctccctgttctt 295
           ||||||||| | ||||| |||||||||||||||||
Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttctt 666



 Score = 46.1 bits (23), Expect = 0.084
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 355 tcaaacttgatgaagncaacaatctt 380
           ||||||||||||||| ||||||||||
Sbjct: 607 tcaaacttgatgaagtcaacaatctt 582



to top

>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA
          Length = 992

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212
           ||||||  ||||||||||||| |||||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttg 781



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 232     ggtgaccctgggcatnctcaacgtg 256
               ||||||||||||||| |||||||||
Sbjct: 4589196 ggtgaccctgggcatgctcaacgtg 4589172



to top

>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA
          Length = 783

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 138 atggtgagctngatacccttgcccttggg 166
           |||| ||||| ||||||||||||||||||
Sbjct: 743 atggagagcttgatacccttgcccttggg 715



to top

>gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306,  section 415 of 469 of the
            complete genome
          Length = 10848

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 232  ggtgaccctgggcatnctcaacgtg 256
            ||||||||||||||| |||||||||
Sbjct: 8128 ggtgaccctgggcatgctcaacgtg 8104



to top

>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript
           variant A (RpS4), mRNA
          Length = 983

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212
           ||||||  ||||||||||||| |||||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttg 781



to top

>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript
           variant B (RpS4), mRNA
          Length = 969

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212
           ||||||  ||||||||||||| |||||||||||
Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttg 767



to top

>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 207761

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 180    ggcttggngcccttgccaatggtgaacacgttg 212
              ||||||  ||||||||||||| |||||||||||
Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttg 141900



to top

>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete
              sequence
          Length = 272016

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 180    ggcttggngcccttgccaatggtgaacacgttg 212
              ||||||  ||||||||||||| |||||||||||
Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttg 169834



to top

>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds
          Length = 852

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 138 atggtgagctngatacccttgcccttggg 166
           |||| ||||| ||||||||||||||||||
Sbjct: 745 atggagagcttgatacccttgcccttggg 717



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 138     atggtgagctngatacccttgcccttggg 166
               |||| ||||| ||||||||||||||||||
Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919



to top

>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4,
           complete cds
          Length = 870

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 180 ggcttggngcccttgccaatggtgaacacgttg 212
           ||||||  ||||||||||||| |||||||||||
Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttg 681



to top

>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence
          Length = 149455

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    ccttggggaggctcacccaag 180
              |||||||||||||||||||||
Sbjct: 134897 ccttggggaggctcacccaag 134877



to top

>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA,
           isoform A (LOC583495), partial mRNA
          Length = 285

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 204 aacacgttgcccagacggntggca 227
           |||||||||||||||||| |||||
Sbjct: 179 aacacgttgcccagacgggtggca 156



to top

>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal
           protein S4e mRNA, complete cds
          Length = 792

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 180 ggcttggngcccttgccaatggtgaacacgtt 211
           ||||||| ||||||||||||| |||| |||||
Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670



to top

>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence
          Length = 124792

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 282    ttctccctgttcttgatcaca 302
              |||||||||||||||||||||
Sbjct: 120862 ttctccctgttcttgatcaca 120842



to top

>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA
          Length = 2945

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 194  gccaatggtgaacacgttgc 213
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789



to top

>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence
          Length = 197827

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   cttcctctgctcctcaatga 138
             ||||||||||||||||||||
Sbjct: 23788 cttcctctgctcctcaatga 23769



to top

>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence
          Length = 160031

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   tccctcttcctctgctcctc 133
             ||||||||||||||||||||
Sbjct: 75373 tccctcttcctctgctcctc 75392



to top

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     ggttccaggaacatagttct 33
              ||||||||||||||||||||
Sbjct: 192051 ggttccaggaacatagttct 192032



to top

>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence
          Length = 156239

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   ctcttcctctgctcctcaat 136
             ||||||||||||||||||||
Sbjct: 47354 ctcttcctctgctcctcaat 47335



to top

>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone
           MGC:34152 IMAGE:5198480), complete cds
          Length = 1554

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 80  gaatcaggccttggcagcagcctg 103
           |||||||||||||||||| |||||
Sbjct: 421 gaatcaggccttggcagccgcctg 398



to top

>emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227D1 on chromosome X Contains
             part of the IL1RAPL2 gene for interleukin 1 receptor
             accessory protein-like 2, complete sequence
          Length = 33667

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 266   aaaggttcccttatgcttct 285
             ||||||||||||||||||||
Sbjct: 13597 aaaggttcccttatgcttct 13578



to top

>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the
             ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene,
             the 3' end of a gene for cellular modulator of immune
             recognition (c-MIR) and five CpG islands, complete
             sequence
          Length = 129266

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 30    ttctatatccttgcagataactgg 53
             |||||||||||| |||||||||||
Sbjct: 81474 ttctatatccttacagataactgg 81451



to top

>ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predicted mRNA
          Length = 1485

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  cttcctctgctcctcaatga 138
            ||||||||||||||||||||
Sbjct: 1026 cttcctctgctcctcaatga 1007



to top

>ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC581083 (LOC581083), mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 114 tccctcttcctctgctcctc 133
           ||||||||||||||||||||
Sbjct: 764 tccctcttcctctgctcctc 745



to top

>emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clone 1a13
          Length = 2945

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 194  gccaatggtgaacacgttgc 213
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789



to top

>emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 in linkage group 10,
             complete sequence
          Length = 210640

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   tcttcctctgctcctcaatg 137
             ||||||||||||||||||||
Sbjct: 25208 tcttcctctgctcctcaatg 25189



to top

>gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, complete sequence
          Length = 175223

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      cttaaaaaagatggttccag 21
              ||||||||||||||||||||
Sbjct: 158366 cttaaaaaagatggttccag 158385



to top

>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete
              sequences
          Length = 203521

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     tagttctatatccttgcaga 46
              ||||||||||||||||||||
Sbjct: 130844 tagttctatatccttgcaga 130825



to top

>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 228097

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   ctcttcctctgctcctcaat 136
             ||||||||||||||||||||
Sbjct: 63018 ctcttcctctgctcctcaat 62999



to top

>gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II,
              Alzheimer disease) (APP) gene, complete cds
          Length = 293960

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     tagttctatatccttgcaga 46
              ||||||||||||||||||||
Sbjct: 254416 tagttctatatccttgcaga 254435



to top

>gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosome 18, complete
             sequence
          Length = 205253

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   ctcttcctctgctcctcaat 136
             ||||||||||||||||||||
Sbjct: 62232 ctcttcctctgctcctcaat 62251



to top

>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     tagttctatatccttgcaga 46
              ||||||||||||||||||||
Sbjct: 325187 tagttctatatccttgcaga 325168



to top

>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence
          Length = 113482

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    ggttccaggaacatagttct 33
             ||||||||||||||||||||
Sbjct: 64196 ggttccaggaacatagttct 64177



to top

>gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, complete sequence
          Length = 150428

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    cttcctctgctcctcaatga 138
              ||||||||||||||||||||
Sbjct: 147440 cttcctctgctcctcaatga 147421



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 119     cttcctctgctcctcaatga 138
               ||||||||||||||||||||
Sbjct: 2525910 cttcctctgctcctcaatga 2525929



to top

>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete
              sequence
          Length = 215366

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    tgcccttggggaggctcacc 176
              ||||||||||||||||||||
Sbjct: 213316 tgcccttggggaggctcacc 213297



to top

>emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-661G16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 162691

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   ctcttcctctgctcctcaat 136
             ||||||||||||||||||||
Sbjct: 27574 ctcttcctctgctcctcaat 27593



to top

>dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone
             B2291C14-R44F3, segment 6/10, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    tagttctatatccttgcaga 46
             ||||||||||||||||||||
Sbjct: 24483 tagttctatatccttgcaga 24464



to top

>dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, complete cds
          Length = 301692

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     tagttctatatccttgcaga 46
              ||||||||||||||||||||
Sbjct: 258129 tagttctatatccttgcaga 258148



to top

>dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:T1715,
            LL56-APP region, complete sequence
          Length = 68001

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 27   tagttctatatccttgcaga 46
            ||||||||||||||||||||
Sbjct: 7611 tagttctatatccttgcaga 7592



to top

>dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related, B2291C14-T1533 region,
              segment 5/7
          Length = 161014

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     tagttctatatccttgcaga 46
              ||||||||||||||||||||
Sbjct: 124483 tagttctatatccttgcaga 124464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,575,558
Number of Sequences: 3902068
Number of extensions: 2575558
Number of successful extensions: 51338
Number of sequences better than 10.0: 112
Number of HSP's better than 10.0 without gapping: 112
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51028
Number of HSP's gapped (non-prelim): 299
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top