ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4j17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_197775.1| Oryza sativa (japonica cultivar-group) putative... 521 e-145
2gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno... 521 e-145
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 521 e-145
4dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clon... 521 e-145
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 521 e-145
6ref|XM_464969.1| Oryza sativa (japonica cultivar-group), mRNA 509 e-141
7dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 509 e-141
8dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic D... 509 e-141
9dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D... 509 e-141
10dbj|AK121593.1| Oryza sativa (japonica cultivar-group) cDNA clon... 509 e-141
11gb|BT016577.1| Zea mays clone Contig410 mRNA sequence 468 e-128
12gb|AY104535.1| Zea mays PCO094675 mRNA sequence 379 e-102
13gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA sequence 357 3e-95
14emb|X68202.1|CSL27 C.stellata mRNA for ribosomal protein L27 96 2e-16
15ref|NM_117587.2| Arabidopsis thaliana structural constituent of ... 72 2e-09
16gb|DQ226702.1| Boechera divaricarpa isolate SLW-A-H01 mRNA sequence 72 2e-09
17emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA ... 72 2e-09
18gb|AY096731.1| Arabidopsis thaliana putative ribosomal protein (... 72 2e-09
19gb|AY063987.1| Arabidopsis thaliana putative ribosomal protein (... 72 2e-09
20emb|BX827228.1|CNS0A2SV Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
21emb|BX827216.1|CNS0A2RL Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
22gb|AY085487.1| Arabidopsis thaliana clone 15384 mRNA, complete s... 72 2e-09
23emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, ... 72 2e-09
24ref|NM_113120.2| Arabidopsis thaliana structural constituent of ... 70 1e-08
25gb|AY091218.1| Arabidopsis thaliana putative ribosomal protein L... 70 1e-08
26gb|AY063860.1| Arabidopsis thaliana putative ribosomal protein L... 70 1e-08
27gb|AY136321.1| Arabidopsis thaliana putative ribosomal protein L... 70 1e-08
28gb|AY093389.1| Arabidopsis thaliana 60S ribosomal protein L27 (M... 70 1e-08
29gb|AY062617.1| Arabidopsis thaliana 60S ribosomal protein L27 (M... 70 1e-08
30emb|BX822979.1|CNS0A73W Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
31gb|AY086536.1| Arabidopsis thaliana clone 25631 mRNA, complete s... 70 1e-08
32dbj|AP001306.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 70 1e-08
33gb|BT014180.1| Lycopersicon esculentum clone 133344F, mRNA sequence 68 4e-08
34dbj|AB043975.1| Panax ginseng mRNA for ribosomal protein L27, co... 68 4e-08
35gb|AF401581.1| Ictalurus punctatus ribosomal protein L27 mRNA, c... 66 2e-07
36ref|NM_128781.2| Arabidopsis thaliana structural constituent of ... 64 6e-07
37gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 ma... 64 6e-07
38gb|BT021972.1| Arabidopsis thaliana At2g32220 mRNA, complete cds 64 6e-07
39gb|BT000418.1| Arabidopsis thaliana putative ribosomal protein L... 62 2e-06
40emb|BX823175.1|CNS0A74P Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
41ref|XM_370196.1| Magnaporthe grisea 70-15 chromosome II hypothet... 60 9e-06
42ref|XM_850644.1| PREDICTED: Canis familiaris similar to ribosoma... 60 9e-06
43ref|XM_543309.2| PREDICTED: Canis familiaris similar to ribosoma... 60 9e-06
44emb|CR733949.2|CNS0GT3G Tetraodon nigroviridis full-length cDNA 60 9e-06
45gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete s... 60 9e-06
46gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete s... 60 9e-06
47gb|AF266223.1|AF266223 Gillichthys mirabilis ribosomal protein L... 60 9e-06
48gb|AY610378.1| Sus scrofa clone relu1310b_k10.y1.abd, mRNA sequence 60 9e-06
49gb|AF548324.1| Branchiostoma belcheri ribosomal protein L27 mRNA... 58 4e-05
50gb|AF003143.2| Caenorhabditis elegans cosmid C53H9, complete seq... 58 4e-05
51ref|NM_058504.4| Caenorhabditis elegans Ribosomal Protein, Large... 58 4e-05
52gb|U89308.1|CEU89308 Caenorhabditis elegans ribosomal protein L2... 58 4e-05
53gb|AY682471.1| Chara globularis 60S ribosomal protein L27 mRNA, ... 56 1e-04
54gb|U10046.1|PSU10046 Pisum sativum ribosomal protein L27 homolog... 56 1e-04
55gb|AY508978.1| Pectinaria gouldii ribosomal protein L27 mRNA, co... 54 6e-04
56ref|XM_500549.1| Yarrowia lipolytica CLIB122, YALI0B05896g predi... 54 6e-04
57emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 54 6e-04
58ref|XM_951518.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
59ref|XM_328265.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
60gb|AY292611.1| Oikopleura dioica 60S ribosomal protein RL27 (RL2... 52 0.002
61ref|XM_656734.1| Aspergillus nidulans FGSC A4 hypothetical prote... 52 0.002
62emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-... 52 0.002
63emb|BX006453.1|CNS08D55 Single read from an extremity of a full-... 52 0.002
64emb|BX006452.1|CNS08D54 Single read from an extremity of a full-... 52 0.002
65emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BA... 52 0.002
66emb|BX072103.1|CNS09RSR Single read from an extremity of a full-... 50 0.009
67emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-... 50 0.009
68emb|BX072101.1|CNS09RSP Single read from an extremity of a full-... 50 0.009
69emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-... 50 0.009
70emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-... 50 0.009
71emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-... 50 0.009
72emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-... 50 0.009
73emb|BX071773.1|CNS09RJL Single read from an extremity of a full-... 50 0.009
74emb|BX071772.1|CNS09RJK Single read from an extremity of a full-... 50 0.009
75emb|BX071703.1|CNS09RHN Single read from an extremity of a full-... 50 0.009
76emb|BX071702.1|CNS09RHM Single read from an extremity of a full-... 50 0.009
77emb|BX071484.1|CNS09RBK Single read from an extremity of a full-... 50 0.009
78emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-... 50 0.009
79emb|BX071109.1|CNS09R15 Single read from an extremity of a full-... 50 0.009
80emb|BX071108.1|CNS09R14 Single read from an extremity of a full-... 50 0.009
81emb|BX071294.1|CNS09R6A Single read from an extremity of a full-... 50 0.009
82emb|BX070984.1|CNS09QXO Single read from an extremity of a full-... 50 0.009
83emb|BX070983.1|CNS09QXN Single read from an extremity of a full-... 50 0.009
84emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-... 50 0.009
85emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-... 50 0.009
86emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-... 50 0.009
87emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-... 50 0.009
88emb|BX070589.1|CNS09QMP Single read from an extremity of a full-... 50 0.009
89emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-... 50 0.009
90emb|BX070293.1|CNS09QEH Single read from an extremity of a full-... 50 0.009
91emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-... 50 0.009
92emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-... 50 0.009
93emb|BX070199.1|CNS09QBV Single read from an extremity of a full-... 50 0.009
94emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-... 50 0.009
95emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-... 50 0.009
96emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-... 50 0.009
97emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-... 50 0.009
98emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-... 50 0.009
99emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-... 50 0.009
100emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-... 50 0.009
101emb|BX061094.1|CNS09JAY Single read from an extremity of a full-... 50 0.009
102emb|BX060930.1|CNS09J6E Single read from an extremity of a full-... 50 0.009
103emb|BX060929.1|CNS09J6D Single read from an extremity of a full-... 50 0.009
104emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-... 50 0.009
105emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-... 50 0.009
106emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-... 50 0.009
107emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-... 50 0.009
108emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-... 50 0.009
109emb|BX069144.1|CNS09PIK Single read from an extremity of a full-... 50 0.009
110emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-... 50 0.009
111emb|BX069070.1|CNS09PGI Single read from an extremity of a full-... 50 0.009
112emb|BX069043.1|CNS09PFR Single read from an extremity of a full-... 50 0.009
113emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-... 50 0.009
114emb|BX069033.1|CNS09PFH Single read from an extremity of a full-... 50 0.009
115emb|BX069032.1|CNS09PFG Single read from an extremity of a full-... 50 0.009
116emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-... 50 0.009
117emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-... 50 0.009
118emb|BX068777.1|CNS09P8D Single read from an extremity of a full-... 50 0.009
119emb|BX068776.1|CNS09P8C Single read from an extremity of a full-... 50 0.009
120emb|BX068480.1|CNS09P04 Single read from an extremity of a full-... 50 0.009
121emb|BX068479.1|CNS09P03 Single read from an extremity of a full-... 50 0.009
122emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-... 50 0.009
123emb|BX067898.1|CNS09OJY Single read from an extremity of a full-... 50 0.009
124emb|BX067672.1|CNS09ODO Single read from an extremity of a full-... 50 0.009
125emb|BX067447.1|CNS09O7F Single read from an extremity of a full-... 50 0.009
126emb|BX067015.1|CNS09NVF Single read from an extremity of a full-... 50 0.009
127emb|BX067014.1|CNS09NVE Single read from an extremity of a full-... 50 0.009
128emb|BX067249.1|CNS09O1X Single read from an extremity of a full-... 50 0.009
129emb|BX067248.1|CNS09O1W Single read from an extremity of a full-... 50 0.009
130emb|BX067222.1|CNS09O16 Single read from an extremity of a full-... 50 0.009
131emb|BX067221.1|CNS09O15 Single read from an extremity of a full-... 50 0.009
132emb|BX067182.1|CNS09O02 Single read from an extremity of a full-... 50 0.009
133emb|BX067181.1|CNS09O01 Single read from an extremity of a full-... 50 0.009
134emb|BX067173.1|CNS09NZT Single read from an extremity of a full-... 50 0.009
135emb|BX066730.1|CNS09NNI Single read from an extremity of a full-... 50 0.009
136emb|BX066729.1|CNS09NNH Single read from an extremity of a full-... 50 0.009
137emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-... 50 0.009
138emb|BX066542.1|CNS09NIA Single read from an extremity of a full-... 50 0.009
139emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-... 50 0.009
140emb|BX066194.1|CNS09N8M Single read from an extremity of a full-... 50 0.009
141emb|BX066150.1|CNS09N7E Single read from an extremity of a full-... 50 0.009
142emb|BX066095.1|CNS09N5V Single read from an extremity of a full-... 50 0.009
143emb|BX065973.1|CNS09N2H Single read from an extremity of a full-... 50 0.009
144emb|BX065830.1|CNS09MYI Single read from an extremity of a full-... 50 0.009
145emb|BX065804.1|CNS09MXS Single read from an extremity of a full-... 50 0.009
146emb|BX065733.1|CNS09MVT Single read from an extremity of a full-... 50 0.009
147emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-... 50 0.009
148emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-... 50 0.009
149emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-... 50 0.009
150emb|BX065395.1|CNS09MMF Single read from an extremity of a full-... 50 0.009
151emb|BX065394.1|CNS09MME Single read from an extremity of a full-... 50 0.009
152emb|BX065267.1|CNS09MIV Single read from an extremity of a full-... 50 0.009
153emb|BX064786.1|CNS09M5I Single read from an extremity of a full-... 50 0.009
154emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-... 50 0.009
155emb|BX064318.1|CNS09LSI Single read from an extremity of a full-... 50 0.009
156emb|BX064317.1|CNS09LSH Single read from an extremity of a full-... 50 0.009
157emb|BX064256.1|CNS09LQS Single read from an extremity of a full-... 50 0.009
158emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-... 50 0.009
159emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-... 50 0.009
160emb|BX064097.1|CNS09LMD Single read from an extremity of a full-... 50 0.009
161emb|BX064096.1|CNS09LMC Single read from an extremity of a full-... 50 0.009
162emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-... 50 0.009
163emb|BX064001.1|CNS09LJP Single read from an extremity of a full-... 50 0.009
164emb|BX063528.1|CNS09L6K Single read from an extremity of a full-... 50 0.009
165emb|BX063517.1|CNS09L69 Single read from an extremity of a full-... 50 0.009
166emb|BX063516.1|CNS09L68 Single read from an extremity of a full-... 50 0.009
167emb|BX063197.1|CNS09KXD Single read from an extremity of a full-... 50 0.009
168emb|BX063196.1|CNS09KXC Single read from an extremity of a full-... 50 0.009
169emb|BX063195.1|CNS09KXB Single read from an extremity of a full-... 50 0.009
170emb|BX063194.1|CNS09KXA Single read from an extremity of a full-... 50 0.009
171emb|BX063139.1|CNS09KVR Single read from an extremity of a full-... 50 0.009
172emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-... 50 0.009
173emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-... 50 0.009
174emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-... 50 0.009
175emb|BX062248.1|CNS09K70 Single read from an extremity of a full-... 50 0.009
176emb|BX062217.1|CNS09K65 Single read from an extremity of a full-... 50 0.009
177emb|BX061945.1|CNS09JYL Single read from an extremity of a full-... 50 0.009
178emb|BX061917.1|CNS09JXT Single read from an extremity of a full-... 50 0.009
179emb|BX061916.1|CNS09JXS Single read from an extremity of a full-... 50 0.009
180emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-... 50 0.009
181emb|BX060671.1|CNS09IZ7 Single read from an extremity of a full-... 50 0.009
182emb|BX060630.1|CNS09IY2 Single read from an extremity of a full-... 50 0.009
183emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-... 50 0.009
184emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-... 50 0.009
185emb|BX060463.1|CNS09ITF Single read from an extremity of a full-... 50 0.009
186emb|BX060462.1|CNS09ITE Single read from an extremity of a full-... 50 0.009
187emb|BX060432.1|CNS09ISK Single read from an extremity of a full-... 50 0.009
188emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-... 50 0.009
189emb|BX060386.1|CNS09IRA Single read from an extremity of a full-... 50 0.009
190emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-... 50 0.009
191emb|BX060142.1|CNS09IKI Single read from an extremity of a full-... 50 0.009
192emb|BX060141.1|CNS09IKH Single read from an extremity of a full-... 50 0.009
193emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-... 50 0.009
194emb|BX059737.1|CNS09I99 Single read from an extremity of a full-... 50 0.009
195emb|BX059721.1|CNS09I8T Single read from an extremity of a full-... 50 0.009
196emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-... 50 0.009
197emb|BX059325.1|CNS09HXT Single read from an extremity of a full-... 50 0.009
198emb|BX059324.1|CNS09HXS Single read from an extremity of a full-... 50 0.009
199emb|BX059251.1|CNS09HVR Single read from an extremity of a full-... 50 0.009
200emb|BX059147.1|CNS09HSV Single read from an extremity of a full-... 50 0.009
201emb|BX059146.1|CNS09HSU Single read from an extremity of a full-... 50 0.009
202emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-... 50 0.009
203emb|BX059021.1|CNS09HPD Single read from an extremity of a full-... 50 0.009
204emb|BX059020.1|CNS09HPC Single read from an extremity of a full-... 50 0.009
205emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-... 50 0.009
206emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-... 50 0.009
207emb|BX058853.1|CNS09HKP Single read from an extremity of a full-... 50 0.009
208emb|BX058608.1|CNS09HDW Single read from an extremity of a full-... 50 0.009
209emb|BX058465.1|CNS09H9X Single read from an extremity of a full-... 50 0.009
210emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-... 50 0.009
211emb|BX057944.1|CNS09GVG Single read from an extremity of a full-... 50 0.009
212emb|BX057637.1|CNS09GMX Single read from an extremity of a full-... 50 0.009
213emb|BX057636.1|CNS09GMW Single read from an extremity of a full-... 50 0.009
214emb|BX057549.1|CNS09GKH Single read from an extremity of a full-... 50 0.009
215emb|BX057548.1|CNS09GKG Single read from an extremity of a full-... 50 0.009
216emb|BX057428.1|CNS09GH4 Single read from an extremity of a full-... 50 0.009
217emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-... 50 0.009
218emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-... 50 0.009
219emb|BX057111.1|CNS09G8B Single read from an extremity of a full-... 50 0.009
220emb|BX057064.1|CNS09G70 Single read from an extremity of a full-... 50 0.009
221emb|BX056980.1|CNS09G4O Single read from an extremity of a full-... 50 0.009
222emb|BX056911.1|CNS09G2R Single read from an extremity of a full-... 50 0.009
223emb|BX056910.1|CNS09G2Q Single read from an extremity of a full-... 50 0.009
224emb|BX056816.1|CNS09G04 Single read from an extremity of a full-... 50 0.009
225emb|BX056561.1|CNS09FT1 Single read from an extremity of a full-... 50 0.009
226emb|BX056560.1|CNS09FT0 Single read from an extremity of a full-... 50 0.009
227emb|BX056536.1|CNS09FSC Single read from an extremity of a full-... 50 0.009
228emb|BX056232.1|CNS09FJW Single read from an extremity of a full-... 50 0.009
229emb|BX056161.1|CNS09FHX Single read from an extremity of a full-... 50 0.009
230emb|BX056160.1|CNS09FHW Single read from an extremity of a full-... 50 0.009
231emb|BX055158.1|CNS09EQ2 Single read from an extremity of a full-... 50 0.009
232emb|BX053204.1|CNS09D7S Single read from an extremity of a full-... 50 0.009
233emb|BX054990.1|CNS09ELE Single read from an extremity of a full-... 50 0.009
234emb|BX054749.1|CNS09EEP Single read from an extremity of a full-... 50 0.009
235emb|BX053049.1|CNS09D3H Single read from an extremity of a full-... 50 0.009
236emb|BX053048.1|CNS09D3G Single read from an extremity of a full-... 50 0.009
237emb|BX054473.1|CNS09E71 Single read from an extremity of a full-... 50 0.009
238emb|BX054408.1|CNS09E58 Single read from an extremity of a full-... 50 0.009
239emb|BX054219.1|CNS09DZZ Single read from an extremity of a full-... 50 0.009
240emb|BX054218.1|CNS09DZY Single read from an extremity of a full-... 50 0.009
241emb|BX053917.1|CNS09DRL Single read from an extremity of a full-... 50 0.009
242emb|BX053763.1|CNS09DNB Single read from an extremity of a full-... 50 0.009
243emb|BX053650.1|CNS09DK6 Single read from an extremity of a full-... 50 0.009
244emb|BX053531.1|CNS09DGV Single read from an extremity of a full-... 50 0.009
245emb|BX053530.1|CNS09DGU Single read from an extremity of a full-... 50 0.009
246emb|BX052795.1|CNS09CWF Single read from an extremity of a full-... 50 0.009
247emb|BX052794.1|CNS09CWE Single read from an extremity of a full-... 50 0.009
248emb|BX052608.1|CNS09CR8 Single read from an extremity of a full-... 50 0.009
249emb|BX052607.1|CNS09CR7 Single read from an extremity of a full-... 50 0.009
250emb|BX052579.1|CNS09CQF Single read from an extremity of a full-... 50 0.009
251emb|BX052578.1|CNS09CQE Single read from an extremity of a full-... 50 0.009
252emb|BX052518.1|CNS09COQ Single read from an extremity of a full-... 50 0.009
253emb|BX052517.1|CNS09COP Single read from an extremity of a full-... 50 0.009
254emb|BX052512.1|CNS09COK Single read from an extremity of a full-... 50 0.009
255emb|BX052511.1|CNS09COJ Single read from an extremity of a full-... 50 0.009
256emb|BX052483.1|CNS09CNR Single read from an extremity of a full-... 50 0.009
257emb|BX052482.1|CNS09CNQ Single read from an extremity of a full-... 50 0.009
258emb|BX052424.1|CNS09CM4 Single read from an extremity of a full-... 50 0.009
259emb|BX052396.1|CNS09CLC Single read from an extremity of a full-... 50 0.009
260emb|BX052389.1|CNS09CL5 Single read from an extremity of a full-... 50 0.009
261emb|BX052388.1|CNS09CL4 Single read from an extremity of a full-... 50 0.009
262emb|BX052226.1|CNS09CGM Single read from an extremity of a full-... 50 0.009
263emb|BX052225.1|CNS09CGL Single read from an extremity of a full-... 50 0.009
264emb|BX051970.1|CNS09C9I Single read from an extremity of a full-... 50 0.009
265emb|BX051912.1|CNS09C7W Single read from an extremity of a full-... 50 0.009
266emb|BX051911.1|CNS09C7V Single read from an extremity of a full-... 50 0.009
267emb|BX050265.1|CNS09AY5 Single read from an extremity of a full-... 50 0.009
268emb|BX050184.1|CNS09AVW Single read from an extremity of a full-... 50 0.009
269emb|BX050183.1|CNS09AVV Single read from an extremity of a full-... 50 0.009
270emb|BX050112.1|CNS09ATW Single read from an extremity of a full-... 50 0.009
271emb|BX050111.1|CNS09ATV Single read from an extremity of a full-... 50 0.009
272emb|BX051261.1|CNS09BPT Single read from an extremity of a full-... 50 0.009
273emb|BX051260.1|CNS09BPS Single read from an extremity of a full-... 50 0.009
274emb|BX051015.1|CNS09BIZ Single read from an extremity of a full-... 50 0.009
275emb|BX050930.1|CNS09BGM Single read from an extremity of a full-... 50 0.009
276emb|BX050819.1|CNS09BDJ Single read from an extremity of a full-... 50 0.009
277emb|BX050476.1|CNS09B40 Single read from an extremity of a full-... 50 0.009
278emb|BX050475.1|CNS09B3Z Single read from an extremity of a full-... 50 0.009
279emb|BX050063.1|CNS09ASJ Single read from an extremity of a full-... 50 0.009
280emb|BX050062.1|CNS09ASI Single read from an extremity of a full-... 50 0.009
281emb|BX049956.1|CNS09APK Single read from an extremity of a full-... 50 0.009
282emb|BX049955.1|CNS09APJ Single read from an extremity of a full-... 50 0.009
283emb|BX049940.1|CNS09AP4 Single read from an extremity of a full-... 50 0.009
284emb|BX049705.1|CNS09AIL Single read from an extremity of a full-... 50 0.009
285emb|BX049704.1|CNS09AIK Single read from an extremity of a full-... 50 0.009
286emb|BX049693.1|CNS09AI9 Single read from an extremity of a full-... 50 0.009
287emb|BX049692.1|CNS09AI8 Single read from an extremity of a full-... 50 0.009
288emb|BX049619.1|CNS09AG7 Single read from an extremity of a full-... 50 0.009
289emb|BX049594.1|CNS09AFI Single read from an extremity of a full-... 50 0.009
290emb|BX049526.1|CNS09ADM Single read from an extremity of a full-... 50 0.009
291emb|BX049299.1|CNS09A7B Single read from an extremity of a full-... 50 0.009
292emb|BX049259.1|CNS09A67 Single read from an extremity of a full-... 50 0.009
293emb|BX049258.1|CNS09A66 Single read from an extremity of a full-... 50 0.009
294emb|BX049231.1|CNS09A5F Single read from an extremity of a full-... 50 0.009
295emb|BX049230.1|CNS09A5E Single read from an extremity of a full-... 50 0.009
296emb|BX049013.1|CNS099ZD Single read from an extremity of a full-... 50 0.009
297emb|BX049012.1|CNS099ZC Single read from an extremity of a full-... 50 0.009
298emb|BX048919.1|CNS099WR Single read from an extremity of a full-... 50 0.009
299emb|BX048918.1|CNS099WQ Single read from an extremity of a full-... 50 0.009
300emb|BX048913.1|CNS099WL Single read from an extremity of a full-... 50 0.009
301emb|BX048912.1|CNS099WK Single read from an extremity of a full-... 50 0.009
302emb|BX048854.1|CNS099UY Single read from an extremity of a full-... 50 0.009
303emb|BX048810.1|CNS099TQ Single read from an extremity of a full-... 50 0.009
304emb|BX048809.1|CNS099TP Single read from an extremity of a full-... 50 0.009
305emb|BX048748.1|CNS099S0 Single read from an extremity of a full-... 50 0.009
306emb|BX048677.1|CNS099Q1 Single read from an extremity of a full-... 50 0.009
307emb|BX046549.1|CNS0982X Single read from an extremity of a full-... 50 0.009
308emb|BX046430.1|CNS097ZM Single read from an extremity of a full-... 50 0.009
309emb|BX046429.1|CNS097ZL Single read from an extremity of a full-... 50 0.009
310emb|BX048342.1|CNS099GQ Single read from an extremity of a full-... 50 0.009
311emb|BX048271.1|CNS099ER Single read from an extremity of a full-... 50 0.009
312emb|BX048270.1|CNS099EQ Single read from an extremity of a full-... 50 0.009
313emb|BX048165.1|CNS099BT Single read from an extremity of a full-... 50 0.009
314emb|BX048164.1|CNS099BS Single read from an extremity of a full-... 50 0.009
315emb|BX047978.1|CNS0996M Single read from an extremity of a full-... 50 0.009
316emb|BX047977.1|CNS0996L Single read from an extremity of a full-... 50 0.009
317emb|BX047590.1|CNS098VU Single read from an extremity of a full-... 50 0.009
318emb|BX047515.1|CNS098TR Single read from an extremity of a full-... 50 0.009
319emb|BX047261.1|CNS098MP Single read from an extremity of a full-... 50 0.009
320emb|BX047134.1|CNS098J6 Single read from an extremity of a full-... 50 0.009
321emb|BX047133.1|CNS098J5 Single read from an extremity of a full-... 50 0.009
322emb|BX047120.1|CNS098IS Single read from an extremity of a full-... 50 0.009
323emb|BX047119.1|CNS098IR Single read from an extremity of a full-... 50 0.009
324emb|BX047061.1|CNS098H5 Single read from an extremity of a full-... 50 0.009
325emb|BX046817.1|CNS098AD Single read from an extremity of a full-... 50 0.009
326emb|BX046816.1|CNS098AC Single read from an extremity of a full-... 50 0.009
327emb|BX046784.1|CNS0989G Single read from an extremity of a full-... 50 0.009
328emb|BX046783.1|CNS0989F Single read from an extremity of a full-... 50 0.009
329emb|BX046260.1|CNS097UW Single read from an extremity of a full-... 50 0.009
330emb|BX046259.1|CNS097UV Single read from an extremity of a full-... 50 0.009
331emb|BX046221.1|CNS097TT Single read from an extremity of a full-... 50 0.009
332emb|BX046085.1|CNS097Q1 Single read from an extremity of a full-... 50 0.009
333emb|BX045716.1|CNS097FS Single read from an extremity of a full-... 50 0.009
334emb|BX045715.1|CNS097FR Single read from an extremity of a full-... 50 0.009
335emb|BX045556.1|CNS097BC Single read from an extremity of a full-... 50 0.009
336emb|BX045555.1|CNS097BB Single read from an extremity of a full-... 50 0.009
337emb|BX045403.1|CNS09773 Single read from an extremity of a full-... 50 0.009
338emb|BX045134.1|CNS096ZM Single read from an extremity of a full-... 50 0.009
339emb|BX044945.1|CNS096UD Single read from an extremity of a full-... 50 0.009
340emb|BX044944.1|CNS096UC Single read from an extremity of a full-... 50 0.009
341emb|BX044938.1|CNS096U6 Single read from an extremity of a full-... 50 0.009
342emb|BX045333.1|CNS09755 Single read from an extremity of a full-... 50 0.009
343emb|BX045149.1|CNS09701 Single read from an extremity of a full-... 50 0.009
344emb|BX045148.1|CNS09700 Single read from an extremity of a full-... 50 0.009
345emb|BX044899.1|CNS096T3 Single read from an extremity of a full-... 50 0.009
346emb|BX044760.1|CNS096P8 Single read from an extremity of a full-... 50 0.009
347emb|BX044759.1|CNS096P7 Single read from an extremity of a full-... 50 0.009
348emb|BX044734.1|CNS096OI Single read from an extremity of a full-... 50 0.009
349emb|BX044733.1|CNS096OH Single read from an extremity of a full-... 50 0.009
350emb|BX043058.1|CNS095DY Single read from an extremity of a full-... 50 0.009
351emb|BX042942.1|CNS095AQ Single read from an extremity of a full-... 50 0.009
352emb|BX042940.1|CNS095AO Single read from an extremity of a full-... 50 0.009
353emb|BX044572.1|CNS096K0 Single read from an extremity of a full-... 50 0.009
354emb|BX044571.1|CNS096JZ Single read from an extremity of a full-... 50 0.009
355emb|BX044556.1|CNS096JK Single read from an extremity of a full-... 50 0.009
356emb|BX044555.1|CNS096JJ Single read from an extremity of a full-... 50 0.009
357emb|BX044543.1|CNS096J7 Single read from an extremity of a full-... 50 0.009
358emb|BX044359.1|CNS096E3 Single read from an extremity of a full-... 50 0.009
359emb|BX044326.1|CNS096D6 Single read from an extremity of a full-... 50 0.009
360emb|BX043414.1|CNS095NU Single read from an extremity of a full-... 50 0.009
361emb|BX043413.1|CNS095NT Single read from an extremity of a full-... 50 0.009
362emb|BX043705.1|CNS095VX Single read from an extremity of a full-... 50 0.009
363emb|BX043704.1|CNS095VW Single read from an extremity of a full-... 50 0.009
364emb|BX043693.1|CNS095VL Single read from an extremity of a full-... 50 0.009
365emb|BX043692.1|CNS095VK Single read from an extremity of a full-... 50 0.009
366emb|BX043620.1|CNS095TK Single read from an extremity of a full-... 50 0.009
367emb|BX043253.1|CNS095JD Single read from an extremity of a full-... 50 0.009
368emb|BX043218.1|CNS095IE Single read from an extremity of a full-... 50 0.009
369emb|BX043217.1|CNS095ID Single read from an extremity of a full-... 50 0.009
370emb|BX042607.1|CNS0951F Single read from an extremity of a full-... 50 0.009
371emb|BX042544.1|CNS094ZO Single read from an extremity of a full-... 50 0.009
372emb|BX042501.1|CNS094YH Single read from an extremity of a full-... 50 0.009
373emb|BX042314.1|CNS094TA Single read from an extremity of a full-... 50 0.009
374emb|BX042313.1|CNS094T9 Single read from an extremity of a full-... 50 0.009
375emb|BX042171.1|CNS094PB Single read from an extremity of a full-... 50 0.009
376emb|BX042170.1|CNS094PA Single read from an extremity of a full-... 50 0.009
377emb|BX042114.1|CNS094NQ Single read from an extremity of a full-... 50 0.009
378emb|BX042113.1|CNS094NP Single read from an extremity of a full-... 50 0.009
379emb|BX041967.1|CNS094JN Single read from an extremity of a full-... 50 0.009
380emb|BX041966.1|CNS094JM Single read from an extremity of a full-... 50 0.009
381emb|BX041543.1|CNS0947V Single read from an extremity of a full-... 50 0.009
382emb|BX041542.1|CNS0947U Single read from an extremity of a full-... 50 0.009
383emb|BX041157.1|CNS093X5 Single read from an extremity of a full-... 50 0.009
384emb|BX041079.1|CNS093UZ Single read from an extremity of a full-... 50 0.009
385emb|BX041078.1|CNS093UY Single read from an extremity of a full-... 50 0.009
386emb|BX041061.1|CNS093UH Single read from an extremity of a full-... 50 0.009
387emb|BX041042.1|CNS093TY Single read from an extremity of a full-... 50 0.009
388emb|BX041041.1|CNS093TX Single read from an extremity of a full-... 50 0.009
389emb|BX041013.1|CNS093T5 Single read from an extremity of a full-... 50 0.009
390emb|BX041004.1|CNS093SW Single read from an extremity of a full-... 50 0.009
391emb|BX041003.1|CNS093SV Single read from an extremity of a full-... 50 0.009
392emb|BX040961.1|CNS093RP Single read from an extremity of a full-... 50 0.009
393emb|BX040913.1|CNS093QD Single read from an extremity of a full-... 50 0.009
394emb|BX040657.1|CNS093J9 Single read from an extremity of a full-... 50 0.009
395emb|BX040656.1|CNS093J8 Single read from an extremity of a full-... 50 0.009
396emb|BX040549.1|CNS093G9 Single read from an extremity of a full-... 50 0.009
397emb|BX040526.1|CNS093FM Single read from an extremity of a full-... 50 0.009
398emb|BX040525.1|CNS093FL Single read from an extremity of a full-... 50 0.009
399emb|BX040483.1|CNS093EF Single read from an extremity of a full-... 50 0.009
400emb|BX040482.1|CNS093EE Single read from an extremity of a full-... 50 0.009
401emb|BX040432.1|CNS093D0 Single read from an extremity of a full-... 50 0.009
402emb|BX040275.1|CNS0938N Single read from an extremity of a full-... 50 0.009
403emb|BX040094.1|CNS0933M Single read from an extremity of a full-... 50 0.009
404emb|BX040093.1|CNS0933L Single read from an extremity of a full-... 50 0.009
405emb|BX039846.1|CNS092WQ Single read from an extremity of a full-... 50 0.009
406emb|BX039845.1|CNS092WP Single read from an extremity of a full-... 50 0.009
407emb|BX039411.1|CNS092KN Single read from an extremity of a full-... 50 0.009
408emb|BX039258.1|CNS092GE Single read from an extremity of a full-... 50 0.009
409emb|BX039226.1|CNS092FI Single read from an extremity of a full-... 50 0.009
410emb|BX038716.1|CNS0921C Single read from an extremity of a full-... 50 0.009
411emb|BX038017.1|CNS091HX Single read from an extremity of a full-... 50 0.009
412emb|BX038016.1|CNS091HW Single read from an extremity of a full-... 50 0.009
413emb|BX037836.1|CNS091CW Single read from an extremity of a full-... 50 0.009
414emb|BX037835.1|CNS091CV Single read from an extremity of a full-... 50 0.009
415emb|BX035905.1|CNS08ZV9 Single read from an extremity of a full-... 50 0.009
416emb|BX035473.1|CNS08ZJ9 Single read from an extremity of a full-... 50 0.009
417emb|BX035472.1|CNS08ZJ8 Single read from an extremity of a full-... 50 0.009
418emb|BX034565.1|CNS08YU1 Single read from an extremity of a full-... 50 0.009
419emb|BX034564.1|CNS08YU0 Single read from an extremity of a full-... 50 0.009
420emb|BX034153.1|CNS08YIL Single read from an extremity of a full-... 50 0.009
421emb|BX034152.1|CNS08YIK Single read from an extremity of a full-... 50 0.009
422emb|BX033493.1|CNS08Y09 Single read from an extremity of a full-... 50 0.009
423emb|BX031539.1|CNS08WHZ Single read from an extremity of a full-... 50 0.009
424emb|BX031538.1|CNS08WHY Single read from an extremity of a full-... 50 0.009
425emb|BX029440.1|CNS08UVO Single read from an extremity of a full-... 50 0.009
426emb|BX029439.1|CNS08UVN Single read from an extremity of a full-... 50 0.009
427emb|BX029319.1|CNS08USB Single read from an extremity of a full-... 50 0.009
428emb|BX029318.1|CNS08USA Single read from an extremity of a full-... 50 0.009
429emb|BX029180.1|CNS08UOG Single read from an extremity of a full-... 50 0.009
430emb|BX029179.1|CNS08UOF Single read from an extremity of a full-... 50 0.009
431emb|BX028718.1|CNS08UBM Single read from an extremity of a full-... 50 0.009
432emb|BX028717.1|CNS08UBL Single read from an extremity of a full-... 50 0.009
433emb|BX026644.1|CNS08SQ0 Single read from an extremity of a full-... 50 0.009
434emb|BX026643.1|CNS08SPZ Single read from an extremity of a full-... 50 0.009
435emb|BX026053.1|CNS08S9L Single read from an extremity of a full-... 50 0.009
436emb|BX026052.1|CNS08S9K Single read from an extremity of a full-... 50 0.009
437emb|BX025871.1|CNS08S4J Single read from an extremity of a full-... 50 0.009
438emb|BX025777.1|CNS08S1X Single read from an extremity of a full-... 50 0.009
439emb|BX025776.1|CNS08S1W Single read from an extremity of a full-... 50 0.009
440emb|BX024996.1|CNS08RG8 Single read from an extremity of a full-... 50 0.009
441emb|BX024995.1|CNS08RG7 Single read from an extremity of a full-... 50 0.009
442emb|BX024990.1|CNS08RG2 Single read from an extremity of a full-... 50 0.009
443emb|BX024989.1|CNS08RG1 Single read from an extremity of a full-... 50 0.009
444emb|BX023126.1|CNS08Q0A Single read from an extremity of a full-... 50 0.009
445emb|BX022230.1|CNS08PBE Single read from an extremity of a full-... 50 0.009
446emb|BX022229.1|CNS08PBD Single read from an extremity of a full-... 50 0.009
447emb|BX021905.1|CNS08P2D Single read from an extremity of a full-... 50 0.009
448emb|BX021904.1|CNS08P2C Single read from an extremity of a full-... 50 0.009
449emb|BX021723.1|CNS08OXB Single read from an extremity of a full-... 50 0.009
450emb|BX021634.1|CNS08OUU Single read from an extremity of a full-... 50 0.009
451emb|BX021059.1|CNS08OEV Single read from an extremity of a full-... 50 0.009
452emb|BX017503.1|CNS08LO3 Single read from an extremity of a full-... 50 0.009
453emb|BX017502.1|CNS08LO2 Single read from an extremity of a full-... 50 0.009
454emb|BX017166.1|CNS08LEQ Single read from an extremity of a full-... 50 0.009
455emb|BX017165.1|CNS08LEP Single read from an extremity of a full-... 50 0.009
456emb|BX016802.1|CNS08L4M Single read from an extremity of a full-... 50 0.009
457emb|BX015130.1|CNS08JU6 Single read from an extremity of a full-... 50 0.009
458emb|BX015002.1|CNS08JQM Single read from an extremity of a full-... 50 0.009
459emb|BX013744.1|CNS08IRO Single read from an extremity of a full-... 50 0.009
460emb|BX013575.1|CNS08IMZ Single read from an extremity of a full-... 50 0.009
461emb|BX013574.1|CNS08IMY Single read from an extremity of a full-... 50 0.009
462emb|BX013565.1|CNS08IMP Single read from an extremity of a full-... 50 0.009
463emb|BX013564.1|CNS08IMO Single read from an extremity of a full-... 50 0.009
464emb|BX012455.1|CNS08HRV Single read from an extremity of a full-... 50 0.009
465emb|BX012454.1|CNS08HRU Single read from an extremity of a full-... 50 0.009
466emb|BX012250.1|CNS08HM6 Single read from an extremity of a full-... 50 0.009
467emb|BX012249.1|CNS08HM5 Single read from an extremity of a full-... 50 0.009
468emb|BX009742.1|CNS08FOI Single read from an extremity of a full-... 50 0.009
469emb|BX009741.1|CNS08FOH Single read from an extremity of a full-... 50 0.009
470emb|BX009281.1|CNS08FBP Single read from an extremity of a full-... 50 0.009
471emb|BX009280.1|CNS08FBO Single read from an extremity of a full-... 50 0.009
472emb|BX008197.1|CNS08EHL Single read from an extremity of a full-... 50 0.009
473emb|BX008196.1|CNS08EHK Single read from an extremity of a full-... 50 0.009
474emb|BX007065.1|CNS08DM5 Single read from an extremity of a full-... 50 0.009
475emb|BX007002.1|CNS08DKE Single read from an extremity of a full-... 50 0.009
476emb|BX007001.1|CNS08DKD Single read from an extremity of a full-... 50 0.009
477emb|BX007137.1|CNS08DO5 Single read from an extremity of a full-... 50 0.009
478emb|BX007136.1|CNS08DO4 Single read from an extremity of a full-... 50 0.009
479emb|BX006303.1|CNS08D0Z Single read from an extremity of a full-... 50 0.009
480emb|BX006302.1|CNS08D0Y Single read from an extremity of a full-... 50 0.009
481emb|BX006198.1|CNS08CY2 Single read from an extremity of a full-... 50 0.009
482emb|BX005818.1|CNS08CNI Single read from an extremity of a full-... 50 0.009
483emb|BX005574.1|CNS08CGQ Single read from an extremity of a full-... 50 0.009
484gb|U10045.1|PSU10045 Pisum sativum ribosomal protein L27 homolog... 50 0.009
485gb|U10044.1|PSU10044 Pisum sativum ribosomal protein L27 homolog... 50 0.009
486gb|U10043.1|PSU10043 Pisum sativum ribosomal protein L27 homolog... 50 0.009
487emb|BX072104.1|CNS09RSS Single read from an extremity of a full-... 48 0.035
488emb|BX070590.1|CNS09QMQ Single read from an extremity of a full-... 48 0.035
489emb|BX068046.1|CNS09OO2 Single read from an extremity of a full-... 48 0.035
490emb|BX066570.1|CNS09NJ2 Single read from an extremity of a full-... 48 0.035
491emb|BX065974.1|CNS09N2I Single read from an extremity of a full-... 48 0.035
492emb|BX065587.1|CNS09MRR Single read from an extremity of a full-... 48 0.035
493emb|BX065268.1|CNS09MIW Single read from an extremity of a full-... 48 0.035
494emb|BX063140.1|CNS09KVS Single read from an extremity of a full-... 48 0.035
495emb|BX063130.1|CNS09KVI Single read from an extremity of a full-... 48 0.035
496emb|BX059767.1|CNS09IA3 Single read from an extremity of a full-... 48 0.035
497emb|BX059252.1|CNS09HVS Single read from an extremity of a full-... 48 0.035
498emb|BX058922.1|CNS09HMM Single read from an extremity of a full-... 48 0.035
499emb|BX057112.1|CNS09G8C Single read from an extremity of a full-... 48 0.035
500emb|BX055633.1|CNS09F39 Single read from an extremity of a full-... 48 0.035

>ref|NM_197775.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein
           L27 (OSJNBa0027P10.10), mRNA
          Length = 676

 Score =  521 bits (263), Expect = e-145
 Identities = 377/413 (91%), Gaps = 4/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 156 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 215
           |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 449 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 390

                                                                       
Query: 216 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 275
             |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 389 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 331

                                                                       
Query: 276 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 335
             || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 273

                                                                       
Query: 336 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 395
           |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||
Sbjct: 272 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 213

                                                                       
Query: 396 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 455
           ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 212 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 153

                                                                       
Query: 456 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 515
           |||||||||||||||||||||||||||| || || |||||||||||||||  ||||||| 
Sbjct: 152 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 94

                                                                
Query: 516 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 568
           | ||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 93  aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 41



to top

>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  521 bits (263), Expect = e-145
 Identities = 377/413 (91%), Gaps = 4/413 (0%)
 Strand = Plus / Plus

                                                                         
Query: 156   agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 215
             |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 84027 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 84086

                                                                         
Query: 216   tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 275
               |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 84087 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 84145

                                                                         
Query: 276   cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 335
               || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 84146 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 84203

                                                                         
Query: 336   tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 395
             |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||
Sbjct: 84204 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 84263

                                                                         
Query: 396   agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 455
             ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 84264 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 84323

                                                                         
Query: 456   aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 515
             |||||||||||||||||||||||||||| || || |||||||||||||||  ||||||| 
Sbjct: 84324 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 84382

                                                                  
Query: 516   accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 568
             | ||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 84383 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 84435



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  521 bits (263), Expect = e-145
 Identities = 377/413 (91%), Gaps = 4/413 (0%)
 Strand = Plus / Plus

                                                                            
Query: 156      agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 215
                |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 21769344 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 21769403

                                                                            
Query: 216      tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 275
                  |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 21769404 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 21769462

                                                                            
Query: 276      cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 335
                  || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21769463 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 21769520

                                                                            
Query: 336      tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 395
                |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||
Sbjct: 21769521 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 21769580

                                                                            
Query: 396      agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 455
                ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 21769581 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 21769640

                                                                            
Query: 456      aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 515
                |||||||||||||||||||||||||||| || || |||||||||||||||  ||||||| 
Sbjct: 21769641 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 21769699

                                                                     
Query: 516      accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 568
                | ||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 21769700 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 21769752



to top

>dbj|AK066340.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013064A22, full
           insert sequence
          Length = 723

 Score =  521 bits (263), Expect = e-145
 Identities = 377/413 (91%), Gaps = 4/413 (0%)
 Strand = Plus / Minus

                                                                       
Query: 156 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 215
           |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 463 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 404

                                                                       
Query: 216 tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 275
             |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 403 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 345

                                                                       
Query: 276 cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 335
             || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 287

                                                                       
Query: 336 tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 395
           |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||
Sbjct: 286 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 227

                                                                       
Query: 396 agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 455
           ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 226 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 167

                                                                       
Query: 456 aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 515
           |||||||||||||||||||||||||||| || || |||||||||||||||  ||||||| 
Sbjct: 166 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 108

                                                                
Query: 516 accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 568
           | ||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 107 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 55



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  521 bits (263), Expect = e-145
 Identities = 377/413 (91%), Gaps = 4/413 (0%)
 Strand = Plus / Plus

                                                                            
Query: 156      agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagct 215
                |||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||  
Sbjct: 21781007 agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaagcggtcctcgaggc 21781066

                                                                            
Query: 216      tggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggggg 275
                  |||||||||||||||  ||||| || |||||||||| |||||| ||| | ||||||  
Sbjct: 21781067 gcgccttggcggacttgcaggcggcgaccttcttgtccctggtggcgagcgcgtcgggc- 21781125

                                                                            
Query: 276      cgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 335
                  || | ||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21781126 --cccgcggcgacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtggg 21781183

                                                                            
Query: 336      tgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgccg 395
                |||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||
Sbjct: 21781184 tgaagttgacgagcttgaggaagcacttgacgcgcgacttcttcgccgtcttcttcgccg 21781243

                                                                            
Query: 396      agtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggccgt 455
                ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||
Sbjct: 21781244 agtccttgcggatcaccttcttggggtacttggcgaggccggcgacgaggcagtggccgt 21781303

                                                                            
Query: 456      aggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgcgt 515
                |||||||||||||||||||||||||||| || || |||||||||||||||  ||||||| 
Sbjct: 21781304 aggggcggtcgcgggtgccctcctcgaacacccgcacgatcaccgccttccgccccgcg- 21781362

                                                                     
Query: 516      accctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccat 568
                | ||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 21781363 aacctcccctgcagcaggatcaccgccttcccgggcttgagaaacttcaccat 21781415



to top

>ref|XM_464969.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 689

 Score =  509 bits (257), Expect = e-141
 Identities = 378/417 (90%), Gaps = 1/417 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 525 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 466

                                                                       
Query: 213 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 272
           |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 465 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 406

                                                                       
Query: 273 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 332
           |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 405 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 346

                                                                       
Query: 333 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 392
           ||||||||||||||||||||||||||  |||||| | ||||||||| |||||||||||||
Sbjct: 345 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 286

                                                                       
Query: 393 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 452
           ||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||
Sbjct: 285 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 226

                                                                       
Query: 453 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 512
           ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||  |||||
Sbjct: 225 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 166

                                                                    
Query: 513 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 569
           |||| ||  |||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 165 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 110



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  509 bits (257), Expect = e-141
 Identities = 378/417 (90%), Gaps = 1/417 (0%)
 Strand = Plus / Plus

                                                                            
Query: 153      cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 10700091 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 10700150

                                                                            
Query: 213      gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 272
                |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 10700151 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 10700210

                                                                            
Query: 273      gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 332
                |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 10700211 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 10700270

                                                                            
Query: 333      gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 392
                ||||||||||||||||||||||||||  |||||| | ||||||||| |||||||||||||
Sbjct: 10700271 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 10700330

                                                                            
Query: 393      ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 452
                ||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||
Sbjct: 10700331 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 10700390

                                                                            
Query: 453      cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 512
                ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||  |||||
Sbjct: 10700391 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 10700450

                                                                         
Query: 513      cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 569
                |||| ||  |||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 10700451 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 10700506



to top

>dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0018M09
          Length = 157377

 Score =  509 bits (257), Expect = e-141
 Identities = 378/417 (90%), Gaps = 1/417 (0%)
 Strand = Plus / Plus

                                                                          
Query: 153    cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 117781 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 117840

                                                                          
Query: 213    gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 272
              |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 117841 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 117900

                                                                          
Query: 273    gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 332
              |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 117901 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 117960

                                                                          
Query: 333    gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 392
              ||||||||||||||||||||||||||  |||||| | ||||||||| |||||||||||||
Sbjct: 117961 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 118020

                                                                          
Query: 393    ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 452
              ||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||
Sbjct: 118021 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 118080

                                                                          
Query: 453    cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 512
              ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||  |||||
Sbjct: 118081 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 118140

                                                                       
Query: 513    cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 569
              |||| ||  |||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 118141 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 118196



to top

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1115_D03
          Length = 169378

 Score =  509 bits (257), Expect = e-141
 Identities = 378/417 (90%), Gaps = 1/417 (0%)
 Strand = Plus / Plus

                                                                         
Query: 153   cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 39572 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 39631

                                                                         
Query: 213   gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 272
             |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 39632 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 39691

                                                                         
Query: 273   gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 332
             |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 39692 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 39751

                                                                         
Query: 333   gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 392
             ||||||||||||||||||||||||||  |||||| | ||||||||| |||||||||||||
Sbjct: 39752 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 39811

                                                                         
Query: 393   ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 452
             ||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||
Sbjct: 39812 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 39871

                                                                         
Query: 453   cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 512
             ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||  |||||
Sbjct: 39872 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 39931

                                                                      
Query: 513   cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 569
             |||| ||  |||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 39932 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 39987



to top

>dbj|AK121593.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038C19, full
           insert sequence
          Length = 689

 Score =  509 bits (257), Expect = e-141
 Identities = 378/417 (90%), Gaps = 1/417 (0%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 525 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 466

                                                                       
Query: 213 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 272
           |    |||||||||| ||||  |||||  | |||||||||   ||||| ||||| |||||
Sbjct: 465 ggcgagccttggcggccttgcaggcggccaccttcttgtcgcgggtggcgagggcgtcgg 406

                                                                       
Query: 273 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 332
           |  | ||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 405 gtcccccggaggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgatgt 346

                                                                       
Query: 333 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 392
           ||||||||||||||||||||||||||  |||||| | ||||||||| |||||||||||||
Sbjct: 345 gggtgaagttgacgagcttgaggaagcacttgaccctcgacttcttcgccgtcttcttcg 286

                                                                       
Query: 393 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 452
           ||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||
Sbjct: 285 ccgagtccttgcggatcaccttcttcgggtacttggcgaggccggcgacgaggcagtggc 226

                                                                       
Query: 453 cgtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccg 512
           ||||||||||||| ||||||||||||||||| ||||| |||||||||||||||  |||||
Sbjct: 225 cgtaggggcggtcacgggtgccctcctcgaacacgcgcacgatcaccgccttccgccccg 166

                                                                    
Query: 513 cgtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 569
           |||| ||  |||||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 165 cgta-ccgcccctgcagcaggatcaccgccttccccggcttcaggaacttcaccatc 110



to top

>gb|BT016577.1| Zea mays clone Contig410 mRNA sequence
          Length = 724

 Score =  468 bits (236), Expect = e-128
 Identities = 372/416 (89%), Gaps = 1/416 (0%)
 Strand = Plus / Minus

                                                                       
Query: 154 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 213
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 ctagaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcgag 395

                                                                       
Query: 214 cttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggg 273
               |||||||||| ||||   |||| || |||||||||   ||||| ||| | ||||||
Sbjct: 394 gcgcgccttggcggccttgcatgcggcgaccttcttgtcgcgggtggagagcgcgtcggg 335

                                                                       
Query: 274 ggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtg 333
             |||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 334 cccgccggtggccacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgaggtg 275

                                                                       
Query: 334 ggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgc 393
           |||||||||||||||||||| ||||  |||||||||||||||||| ||||||||||| ||
Sbjct: 274 ggtgaagttgacgagcttgatgaagcacttgacgcgcgacttcttcgccgtcttcttggc 215

                                                                       
Query: 394 cgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggcc 453
           ||||||| |||||| |||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 214 cgagtccctgcggaccaccttcttggggtacttggcgaggccggcgacgaggcagtggcc 155

                                                                       
Query: 454 gtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgc 513
           |||||||||||||||||||||||||||||| ||||| |||||| | |||||| | || ||
Sbjct: 154 gtaggggcggtcgcgggtgccctcctcgaacacgcgcacgatctctgccttcctgccggc 95

                                                                   
Query: 514 gtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatc 569
           | | || ||||||||| |||||||| ||||| ||||||||||||||||||||||||
Sbjct: 94  g-aaccggccctgcaggaggatcacggccttgccgggcttgaggaacttcaccatc 40



to top

>gb|AY104535.1| Zea mays PCO094675 mRNA sequence
          Length = 995

 Score =  379 bits (191), Expect = e-102
 Identities = 363/419 (86%), Gaps = 1/419 (0%)
 Strand = Plus / Minus

                                                                       
Query: 154 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 213
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||
Sbjct: 478 ctagaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcaag 419

                                                                       
Query: 214 cttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcggg 273
               || ||||| | ||||  ||||| || ||||||||| | ||| | ||| | ||||||
Sbjct: 418 gcgcgctttggccgtcttgcaggcggcgaccttcttgtcgtgggtagagagtgcgtcggg 359

                                                                       
Query: 274 ggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtg 333
             | |||| ||| || |||||||  |||||||||||||||||||||||||||||||||||
Sbjct: 358 cccaccggtggcgacatccttgaaatcgacgtcgagggtgtagcgggtgggcatgaggtg 299

                                                                       
Query: 334 ggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcgc 393
            ||||||||||||||||||| ||||  |||||||||||||||||| || |||||||| ||
Sbjct: 298 agtgaagttgacgagcttgatgaagcacttgacgcgcgacttcttcgcagtcttcttggc 239

                                                                       
Query: 394 cgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggcc 453
            ||||||||||||||||||||||| |||||||| || ||||| |||||||||||||||||
Sbjct: 238 ggagtccttgcggatcaccttctttgggtacttggcgaggcctgcgacgaggcagtggcc 179

                                                                       
Query: 454 gtaggggcggtcgcgggtgccctcctcgaagacgcggacgatcaccgccttcttccccgc 513
            ||||||||||||||||||||||||||||| ||||| ||||| || |||||| | || ||
Sbjct: 178 ataggggcggtcgcgggtgccctcctcgaacacgcgcacgataactgccttcctgccggc 119

                                                                      
Query: 514 gtaccctgccctgcagcaggatcaccgccttcccgggcttgaggaacttcaccatcttc 572
           | |  | |||||| || ||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 118 g-aagcggccctggaggaggataacggccttgccgggcttgaggaacttcaccatcttc 61



to top

>gb|BT017753.1| Zea mays clone EL01N0450E09.c mRNA sequence
          Length = 537

 Score =  357 bits (180), Expect = 3e-95
 Identities = 291/328 (88%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
           |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 336 cctaaaagcggagcttggtaaagaaccacctgttcttgccggtcttgaacctctcctcga 277

                                                                       
Query: 213 gcttggccttggcggacttggcggcggtgagcttcttgtccttggtggtgagggagtcgg 272
           |    |||||||||| ||||  |||   || ||||||||||  ||||| ||| | |||||
Sbjct: 276 ggcgcgccttggcggccttgcaggcttcgaccttcttgtcccgggtggagagcgcgtcgg 217

                                                                       
Query: 273 gggcgccggaggccacctccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggt 332
           |  |||| || || || ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 216 gcccgcccgatgcgacgtccttgaagtcgacgtcgagggtgtagcgggtgggcatgaggt 157

                                                                       
Query: 333 gggtgaagttgacgagcttgaggaagaccttgacgcgcgacttcttggccgtcttcttcg 392
           | ||||| ||||||||||||| ||||  ||||||||| |||||||||||||||||||| |
Sbjct: 156 gagtgaaattgacgagcttgatgaagcacttgacgcgggacttcttggccgtcttcttgg 97

                                                                       
Query: 393 ccgagtccttgcggatcaccttcttggggtacttcgccaggccggcgacgaggcagtggc 452
           | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 96  cggagtccttgcggatcaccttcttggggtacttggccaggccggcgacgaggcagtgcc 37

                                       
Query: 453 cgtaggggcggtcgcgggtgccctcctc 480
           | ||||| ||||||||||||||||||||
Sbjct: 36  catagggacggtcgcgggtgccctcctc 9



to top

>emb|X68202.1|CSL27 C.stellata mRNA for ribosomal protein L27
          Length = 485

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 54/56 (96%)
 Strand = Plus / Minus

                                                                   
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctc 210
           |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 427 tagaagcgcagcttggtgaagaaccacctgttcttgccggtcttgaacttctcctc 372



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 291 ccttgaggtcgacgtcgagggtgtagcgggtgggcatgaggtgggtgaagttgac 345
           |||||| ||| || || |||||||||||||||||||| |||||| || |||||||
Sbjct: 300 ccttgaagtccacatccagggtgtagcgggtgggcatcaggtggttgtagttgac 246



to top

>ref|NM_117587.2| Arabidopsis thaliana structural constituent of ribosome AT4G15000
           mRNA, complete cds
          Length = 657

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 462 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 403



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 257 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 198

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 197 ccggcgacgaggcagtgtccgta 175



to top

>gb|DQ226702.1| Boechera divaricarpa isolate SLW-A-H01 mRNA sequence
          Length = 379

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||||||||||||||||||||| || |||||||| | |||||| ||||| |||||
Sbjct: 215 gagcttggtgaagaaccacctgttcttcccagtcttgaaacgctcctcaagcttagcctt 156



to top

>emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 2
          Length = 202860

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                          
Query: 163    gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
              ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 137361 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 137302



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                          
Query: 374    ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
              ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 137156 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 137097

                                     
Query: 434    ccggcgacgaggcagtggccgta 456
              ||||||||||||||||| |||||
Sbjct: 137096 ccggcgacgaggcagtgtccgta 137074



to top

>gb|AY096731.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA,
           complete cds
          Length = 439

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 399 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 340



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 194 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 135

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 134 ccggcgacgaggcagtgtccgta 112



to top

>gb|AY063987.1| Arabidopsis thaliana putative ribosomal protein (At4g15000) mRNA,
           complete cds
          Length = 640

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 462 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 403



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 257 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 198

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 197 ccggcgacgaggcagtgtccgta 175



to top

>emb|BX827228.1|CNS0A2SV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZG03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 625

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 438 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 379



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 233 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 174

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 173 ccggcgacgaggcagtgtccgta 151



to top

>emb|BX827216.1|CNS0A2RL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS22ZD04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 625

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 438 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 379



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 233 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 174

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 173 ccggcgacgaggcagtgtccgta 151



to top

>gb|AY085487.1| Arabidopsis thaliana clone 15384 mRNA, complete sequence
          Length = 631

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           ||||||||| |||||||| |||||||| || ||||||||||||||||| ||||| |||||
Sbjct: 460 gagcttggtaaagaaccatctgttcttaccagtcttgaacctctcctcaagcttagcctt 401



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 255 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttcagt 196

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 195 ccggcgacgaggcagtgtccgta 173



to top

>emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 40
          Length = 197405

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                         
Query: 163   gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
             ||||||||| |||||||| |||||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 82815 gagcttggtaaagaaccatctgttcttaccggttttgaacctctcctcaagcttagcctt 82756



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 374   ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
             ||||| || |||||||| || ||||| |||||||| || ||  | |||||||||   || 
Sbjct: 82610 ttcttagctgtcttcttagctgagtctttgcggatgactttgctcgggtacttcttgagt 82551

                                    
Query: 434   ccggcgacgaggcagtggccgta 456
             ||||||||||||||||| |||||
Sbjct: 82550 ccggcgacgaggcagtgtccgta 82528



to top

>ref|NM_113120.2| Arabidopsis thaliana structural constituent of ribosome AT3G22230
           mRNA, complete cds
          Length = 631

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 248 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 189

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 188 ccggcgacgaggcagtgtccgta 166



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 453 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 394



to top

>gb|AY091218.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230)
           mRNA, complete cds
          Length = 439

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 194 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 135

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 134 ccggcgacgaggcagtgtccgta 112



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 399 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 340



to top

>gb|AY063860.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230)
           mRNA, complete cds
          Length = 577

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 210 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 151

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 150 ccggcgacgaggcagtgtccgta 128



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 415 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 356



to top

>gb|AY136321.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230)
           mRNA, complete cds
          Length = 631

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 248 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 189

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 188 ccggcgacgaggcagtgtccgta 166



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 453 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 394



to top

>gb|AY093389.1| Arabidopsis thaliana 60S ribosomal protein L27 (MKA23.13) mRNA,
           complete cds
          Length = 503

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 194 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 135

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 134 ccggcgacgaggcagtgtccgta 112



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 399 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 340



to top

>gb|AY062617.1| Arabidopsis thaliana 60S ribosomal protein L27 (MKA23.13) mRNA,
           complete cds
          Length = 567

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 210 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 151

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 150 ccggcgacgaggcagtgtccgta 128



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 415 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 356



to top

>emb|BX822979.1|CNS0A73W Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZE05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 552

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 184 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 125

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 124 ccggcgacgaggcagtgtccgta 102



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 389 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 330



to top

>gb|AY086536.1| Arabidopsis thaliana clone 25631 mRNA, complete sequence
          Length = 577

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 210 ttcttcgccgtcttcttcgcggagtctttgcggatgactttgctcgggtacttcttcagt 151

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 150 ccggcgacgaggcagtgtccgta 128



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaa 201
           |||||| || ||||||||||||||||| || ||||||||
Sbjct: 415 gagcttagtaaagaaccacctgttcttaccagtcttgaa 377



to top

>dbj|AP001306.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MKA23
          Length = 70100

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                         
Query: 374   ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
             ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 52907 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 52966

                                    
Query: 434   ccggcgacgaggcagtggccgta 456
             ||||||||||||||||| |||||
Sbjct: 52967 ccggcgacgaggcagtgtccgta 52989



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                         
Query: 163   gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
             |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 52702 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 52761



to top

>gb|BT014180.1| Lycopersicon esculentum clone 133344F, mRNA sequence
          Length = 640

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 305 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaagaccttg 364
           ||||| ||||| || || ||||||| |||| || |||| |||||||||| |||  |||| 
Sbjct: 301 tcgagtgtgtaacgagtaggcatgatgtggttgtagttcacgagcttgatgaaagcctta 242

                                                                       
Query: 365 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 424
           || || || ||||| |||  |||||| || || |||||||||||||||||||| ||||||
Sbjct: 241 acacgagatttcttcgcctgcttctttgctgaatccttgcggatcaccttcttcgggtac 182

             
Query: 425 tt 426
           ||
Sbjct: 181 tt 180



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 agcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 223
           |||||||| |||||||| |  || || |||||||||||||||||||| ||| | ||||||
Sbjct: 436 agcttggtaaagaaccagcgatttttcccggtcttgaacctctcctcaagcctagccttg 377

            
Query: 224 g 224
           |
Sbjct: 376 g 376



to top

>dbj|AB043975.1| Panax ginseng mRNA for ribosomal protein L27, complete cds
          Length = 649

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 94/114 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 cgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgc 429
           ||||||||| |||||||||||||||||||| || |  ||||||||||| |||||||| | 
Sbjct: 210 cgacttcttcgccgtcttcttcgccgagtctttccttatcaccttcttcgggtacttgga 151

                                                                 
Query: 430 caggccggcgacgaggcagtggccgtaggggcggtcgcgggtgccctcctcgaa 483
            |  ||||| || |  ||||| ||||| |||||||| ||||| ||||| |||||
Sbjct: 150 tattccggcaaccaaacagtgtccgtacgggcggtctcgggttccctcgtcgaa 97



to top

>gb|AF401581.1| Ictalurus punctatus ribosomal protein L27 mRNA, complete cds
          Length = 469

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 153 cctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
           ||||||| ||||||||   |||||||||  ||||||||||||||||| |||||||||| |
Sbjct: 431 cctagaatcggagcttctggaagaaccatttgttcttgccggtcttgtacctctcctcaa 372

                        
Query: 213 gcttggccttggc 225
            |||| |||||||
Sbjct: 371 acttgaccttggc 359



to top

>ref|NM_128781.2| Arabidopsis thaliana structural constituent of ribosome AT2G32220
           mRNA, complete cds
          Length = 605

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 164 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 207
           ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 424 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 381



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 365 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 424
           |||||||| ||||| ||||||||||| ||||| |||||||| || || ||  | ||||||
Sbjct: 229 acgcgcgatttcttagccgtcttctttgccgaatccttgcgaatgactttgcttgggtac 170

                                           
Query: 425 ttcgccaggccggcgacgaggcagtggccgta 456
           |||  ||  ||||||||||| ||||| |||||
Sbjct: 169 ttcttcaatccggcgacgagacagtgaccgta 138



to top

>gb|AC006223.4| Arabidopsis thaliana chromosome 2 clone F22D22 map TEn5, complete
             sequence
          Length = 103194

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 164   agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 207
             ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 10068 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 10111



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 365   acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 424
             |||||||| ||||| ||||||||||| ||||| |||||||| || || ||  | ||||||
Sbjct: 10263 acgcgcgatttcttagccgtcttctttgccgaatccttgcgaatgactttgcttgggtac 10322

                                             
Query: 425   ttcgccaggccggcgacgaggcagtggccgta 456
             |||  ||  ||||||||||| ||||| |||||
Sbjct: 10323 ttcttcaatccggcgacgagacagtgaccgta 10354



to top

>gb|BT021972.1| Arabidopsis thaliana At2g32220 mRNA, complete cds
          Length = 509

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 164 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 207
           ||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 417 agcttggtgaagaaccatctgttcttgccagtcttaaacctctc 374



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 365 acgcgcgacttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtac 424
           |||||||| ||||| ||||||||||| ||||| |||||||| || || ||  | ||||||
Sbjct: 222 acgcgcgatttcttagccgtcttctttgccgaatccttgcgaatgactttgcttgggtac 163

                                           
Query: 425 ttcgccaggccggcgacgaggcagtggccgta 456
           |||  ||  ||||||||||| ||||| |||||
Sbjct: 162 ttcttcaatccggcgacgagacagtgaccgta 131



to top

>gb|BT000418.1| Arabidopsis thaliana putative ribosomal protein L27 (At3g22230)
           mRNA, complete cds
          Length = 502

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| || ||  | |||||||||  ||| 
Sbjct: 194 ttcttcgccgtcttcttcgctgagtctttgcggatgactttgctcgggtacttcttcagt 135

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           |||||||| |||||||| |||||
Sbjct: 134 ccggcgacaaggcagtgtccgta 112



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 399 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 340



to top

>emb|BX823175.1|CNS0A74P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZD12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 545

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 374 ttcttggccgtcttcttcgccgagtccttgcggatcaccttcttggggtacttcgccagg 433
           ||||| |||||||||||||| ||||| |||||||| |  ||  | |||||||||  ||| 
Sbjct: 197 ttcttcgccgtcttcttcgctgagtctttgcggatgagtttgctcgggtacttcttcagt 138

                                  
Query: 434 ccggcgacgaggcagtggccgta 456
           ||||||||||||||||| |||||
Sbjct: 137 ccggcgacgaggcagtgtccgta 115



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggcctt 222
           |||||| || ||||||||||||||||| || |||||||| |  ||||| ||||| |||||
Sbjct: 402 gagcttagtaaagaaccacctgttcttcccagtcttgaaacgttcctcaagcttagcctt 343



to top

>ref|XM_370196.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein
           (MG06693.4) partial mRNA
          Length = 450

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 305 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
           ||||| |||||||||||||||||||||||| || ||||||| | ||||| ||||
Sbjct: 302 tcgagagtgtagcgggtgggcatgaggtggttgtagttgacaaccttgacgaag 249



to top

>ref|XM_850644.1| PREDICTED: Canis familiaris similar to ribosomal protein L27,
           transcript variant 3 (LOC486183), mRNA
          Length = 464

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 172 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 225
           |||||||||| | ||||||| ||||||| |||||||||||| |||| |||||||
Sbjct: 411 gaagaaccacttattcttgctggtcttgtacctctcctcgaacttgaccttggc 358



to top

>ref|XM_543309.2| PREDICTED: Canis familiaris similar to ribosomal protein L27,
           transcript variant 1 (LOC486183), mRNA
          Length = 483

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 172 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 225
           |||||||||| | ||||||| ||||||| |||||||||||| |||| |||||||
Sbjct: 426 gaagaaccacttattcttgctggtcttgtacctctcctcgaacttgaccttggc 373



to top

>emb|CR733949.2|CNS0GT3G Tetraodon nigroviridis full-length cDNA
          Length = 479

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 172 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 225
           |||||||||| |||| ||||| |||||| |||||||||| | ||||||||||||
Sbjct: 422 gaagaaccacttgtttttgcccgtcttgtacctctcctcaaacttggccttggc 369



to top

>gb|AC134322.25| Medicago truncatula clone mth2-17i21, complete sequence
          Length = 136954

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 163    gagcttggtgaagaaccacctgttcttgccggtcttgaacct 204
              |||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 110830 gagcttggtgaagaaccatctgttcttcccggttttgaacct 110789



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 16    atccaatctaaaaacatagtc 36
             |||||||||||||||||||||
Sbjct: 23032 atccaatctaaaaacatagtc 23012



to top

>gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete sequence
          Length = 136333

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 163   gagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcga 212
             ||||||||| ||||||||||| ||||| || ||||| |||||||||||||
Sbjct: 38418 gagcttggtaaagaaccacctattctttccagtcttaaacctctcctcga 38467



to top

>gb|AF266223.1|AF266223 Gillichthys mirabilis ribosomal protein L27 mRNA, complete cds
          Length = 474

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 172 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 225
           ||||||||||||||| ||||| |||||| |||||||||| | |||| |||||||
Sbjct: 421 gaagaaccacctgtttttgcccgtcttgtacctctcctcaaacttgaccttggc 368



to top

>gb|AY610378.1| Sus scrofa clone relu1310b_k10.y1.abd, mRNA sequence
          Length = 483

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                 
Query: 172 gaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttggc 225
           |||||||||  ||||||||||||||||| | |||||||||| |||| |||||||
Sbjct: 413 gaagaaccatttgttcttgccggtcttgtatctctcctcgaacttgaccttggc 360



to top

>gb|AF548324.1| Branchiostoma belcheri ribosomal protein L27 mRNA, complete cds
          Length = 514

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 154 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctc 210
           ||||||||| |||||   |||||||||| ||||||||||||||||| | ||||||||
Sbjct: 442 ctagaagcgtagcttctggaagaaccacttgttcttgccggtcttgtatctctcctc 386



to top

>gb|AF003143.2| Caenorhabditis elegans cosmid C53H9, complete sequence
          Length = 7003

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 167  ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 223
            ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| ||||
Sbjct: 3200 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 3144



to top

>ref|NM_058504.4| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-27) (rpl-27) mRNA, complete cds
          Length = 463

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 167 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 223
           ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| ||||
Sbjct: 406 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 350



to top

>gb|U89308.1|CEU89308 Caenorhabditis elegans ribosomal protein L27 homolog mRNA, SL2
           trans-spliced, complete cds
          Length = 506

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 167 ttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagcttggccttg 223
           ||||||||||||||| ||||||| ||||||||| | | |||||||| ||||| ||||
Sbjct: 426 ttggtgaagaaccacttgttctttccggtcttgtaacgctcctcgaacttggacttg 370



to top

>gb|AY682471.1| Chara globularis 60S ribosomal protein L27 mRNA, complete cds
          Length = 830

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 166 cttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgag 213
           ||||| ||| ||||| |||||||| || ||||||||||||||||||||
Sbjct: 466 cttggagaaaaaccatctgttctttcctgtcttgaacctctcctcgag 419



to top

>gb|U10046.1|PSU10046 Pisum sativum ribosomal protein L27 homolog (RPL27-5) mRNA,
           complete cds
          Length = 568

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 164 agcttggtgaagaaccacctgttcttgccggtcttgaacctctc 207
           ||||||||||| |||||||||||||| || || |||||||||||
Sbjct: 436 agcttggtgaaaaaccacctgttcttccctgttttgaacctctc 393



to top

>gb|AY508978.1| Pectinaria gouldii ribosomal protein L27 mRNA, complete cds
          Length = 519

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 163 gagcttggtgaagaaccacctgttctt 189
           |||||||||||||||||||||||||||
Sbjct: 444 gagcttggtgaagaaccacctgttctt 418



to top

>ref|XM_500549.1| Yarrowia lipolytica CLIB122, YALI0B05896g predicted mRNA
          Length = 396

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 155 tagaagcggagcttggtgaagaaccacctgttctt 189
           ||||| ||||||||||||||||||||| |||||||
Sbjct: 395 tagaatcggagcttggtgaagaaccacttgttctt 361



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 304 gtcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
           |||||||||||| || |||||||| | |||| || ||||||||| ||||| ||||
Sbjct: 246 gtcgagggtgtatcgagtgggcatcatgtggttgtagttgacgaccttgatgaag 192



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                 
Query: 155    tagaagcggagcttggtgaagaaccacctgttctt 189
              ||||| ||||||||||||||||||||| |||||||
Sbjct: 790846 tagaatcggagcttggtgaagaaccacttgttctt 790812



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                     
Query: 304    gtcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
              |||||||||||| || |||||||| | |||| || ||||||||| ||||| ||||
Sbjct: 790697 gtcgagggtgtatcgagtgggcatcatgtggttgtagttgacgaccttgatgaag 790643



to top

>ref|XM_951518.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial
           mRNA
          Length = 408

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 169 ggtgaagaaccacctgttcttgccgg 194
           ||||||||||||||||||||||||||
Sbjct: 393 ggtgaagaaccacctgttcttgccgg 368



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 305 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
           ||||||||||||||||||||||| | |||| || |||||| || ||||| ||||
Sbjct: 260 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 207



to top

>ref|XM_328265.1| Neurospora crassa OR74A hypothetical protein (NCU01827.1) partial
           mRNA
          Length = 408

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 169 ggtgaagaaccacctgttcttgccgg 194
           ||||||||||||||||||||||||||
Sbjct: 393 ggtgaagaaccacctgttcttgccgg 368



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 305 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
           ||||||||||||||||||||||| | |||| || |||||| || ||||| ||||
Sbjct: 260 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 207



to top

>gb|AY292611.1| Oikopleura dioica 60S ribosomal protein RL27 (RL27) gene, complete
           cds
          Length = 691

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                         
Query: 154 ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           |||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 691 ctagaatcggagcttctggaagaaccacttgttcttgccggtcttg 646



to top

>ref|XM_656734.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4222.2), mRNA
          Length = 408

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 305 tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
           ||||| ||||| ||||||||||| |||||| || ||||||||| ||||| ||||
Sbjct: 260 tcgagagtgtaacgggtgggcatcaggtggttgtagttgacgaccttgatgaag 207



to top

>emb|BX060631.1|CNS09IY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 170 gtgaagaaccacctgttcttgccggtcttg 199
           |||||||||||| |||||||||||||||||
Sbjct: 347 gtgaagaaccacttgttcttgccggtcttg 376



to top

>emb|BX006453.1|CNS08D55 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagc 214
           ||||| ||||||||   |||||||||| |||||||||||||||||   | |||||||| |
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttgtgtcgctcctcgaac 531

                 
Query: 215 ttggcc 220
           ||||||
Sbjct: 532 ttggcc 537



to top

>emb|BX006452.1|CNS08D54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctctcctcgagc 214
           ||||| ||||||||   |||||||||| |||||||||||||||||   | |||||||| |
Sbjct: 409 tagaaacggagcttctggaagaaccacttgttcttgccggtcttgtgtcgctcctcgaac 350

                 
Query: 215 ttggcc 220
           ||||||
Sbjct: 349 ttggcc 344



to top

>emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BAC contig B23G1
          Length = 106111

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 169   ggtgaagaaccacctgttcttgccgg 194
             ||||||||||||||||||||||||||
Sbjct: 94824 ggtgaagaaccacctgttcttgccgg 94799



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 305   tcgagggtgtagcgggtgggcatgaggtgggtgaagttgacgagcttgaggaag 358
             ||||||||||||||||||||||| | |||| || |||||| || ||||| ||||
Sbjct: 94691 tcgagggtgtagcgggtgggcatcaagtggttgtagttgatgaccttgatgaag 94638



to top

>emb|BX072103.1|CNS09RSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420



to top

>emb|BX072102.1|CNS09RSQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529



to top

>emb|BX072101.1|CNS09RSP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428



to top

>emb|BX072044.1|CNS09RR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514



to top

>emb|BX072043.1|CNS09RR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 460 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 416



to top

>emb|BX071795.1|CNS09RK7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 493 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 537



to top

>emb|BX071794.1|CNS09RK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405



to top

>emb|BX071773.1|CNS09RJL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 487 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 531



to top

>emb|BX071772.1|CNS09RJK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408



to top

>emb|BX071703.1|CNS09RHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 471 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 515



to top

>emb|BX071702.1|CNS09RHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392



to top

>emb|BX071484.1|CNS09RBK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 477 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 521



to top

>emb|BX071483.1|CNS09RBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 459 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 415



to top

>emb|BX071109.1|CNS09R15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513



to top

>emb|BX071108.1|CNS09R14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407



to top

>emb|BX071294.1|CNS09R6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 434 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 390



to top

>emb|BX070984.1|CNS09QXO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 484 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 528



to top

>emb|BX070983.1|CNS09QXN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 436



to top

>emb|BX070927.1|CNS09QW3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 478 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 522



to top

>emb|BX070926.1|CNS09QW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 394



to top

>emb|BX070787.1|CNS09QS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 479 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 523



to top

>emb|BX070786.1|CNS09QS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 421



to top

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 843 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 799



to top

>emb|BX070475.1|CNS09QJJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 488

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 426 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 382



to top

>emb|BX070293.1|CNS09QEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 444 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 400



to top

>emb|BX070240.1|CNS09QD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518



to top

>emb|BX070239.1|CNS09QCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 411



to top

>emb|BX070199.1|CNS09QBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517



to top

>emb|BX069996.1|CNS09Q68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513



to top

>emb|BX069995.1|CNS09Q67 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408



to top

>emb|BX069838.1|CNS09Q1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514



to top

>emb|BX069837.1|CNS09Q1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391



to top

>emb|BX069816.1|CNS09Q18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530



to top

>emb|BX069815.1|CNS09Q17 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412



to top

>emb|BX061095.1|CNS09JAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 510



to top

>emb|BX061094.1|CNS09JAY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391



to top

>emb|BX060930.1|CNS09J6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 506



to top

>emb|BX060929.1|CNS09J6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 509

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 393 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 349



to top

>emb|BX069521.1|CNS09PT1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 491 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 535



to top

>emb|BX069520.1|CNS09PT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 430



to top

>emb|BX069417.1|CNS09PQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518



to top

>emb|BX069416.1|CNS09PQ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 405 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 361



to top

>emb|BX069166.1|CNS09PJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 388 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 344



to top

>emb|BX069144.1|CNS09PIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 415 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 371



to top

>emb|BX069128.1|CNS09PI4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409



to top

>emb|BX069070.1|CNS09PGI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412



to top

>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 495 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 539



to top

>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 414



to top

>emb|BX069033.1|CNS09PFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 488 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 532



to top

>emb|BX069032.1|CNS09PFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393



to top

>emb|BX069017.1|CNS09PF1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 491 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 535



to top

>emb|BX069016.1|CNS09PF0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407



to top

>emb|BX068777.1|CNS09P8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 468 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 512



to top

>emb|BX068776.1|CNS09P8C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 420 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 376



to top

>emb|BX068480.1|CNS09P04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 637

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 463 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 507



to top

>emb|BX068479.1|CNS09P03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 406 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 362



to top

>emb|BX068045.1|CNS09OO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413



to top

>emb|BX067898.1|CNS09OJY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 488 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 532



to top

>emb|BX067672.1|CNS09ODO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383



to top

>emb|BX067447.1|CNS09O7F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408



to top

>emb|BX067015.1|CNS09NVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514



to top

>emb|BX067014.1|CNS09NVE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401



to top

>emb|BX067249.1|CNS09O1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513



to top

>emb|BX067248.1|CNS09O1W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383



to top

>emb|BX067222.1|CNS09O16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518



to top

>emb|BX067221.1|CNS09O15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409



to top

>emb|BX067182.1|CNS09O02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517



to top

>emb|BX067181.1|CNS09O01 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 461 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 417



to top

>emb|BX067173.1|CNS09NZT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 392 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 348



to top

>emb|BX066730.1|CNS09NNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 496 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 540



to top

>emb|BX066729.1|CNS09NNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428



to top

>emb|BX066569.1|CNS09NJ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408



to top

>emb|BX066542.1|CNS09NIA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 479 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 523



to top

>emb|BX066541.1|CNS09NI9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409



to top

>emb|BX066194.1|CNS09N8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387



to top

>emb|BX066150.1|CNS09N7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 412



to top

>emb|BX066095.1|CNS09N5V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 433 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 389



to top

>emb|BX065973.1|CNS09N2H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 391 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 347



to top

>emb|BX065830.1|CNS09MYI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402



to top

>emb|BX065804.1|CNS09MXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 418



to top

>emb|BX065733.1|CNS09MVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 388 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 344



to top

>emb|BX065586.1|CNS09MRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 441 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 397



to top

>emb|BX065527.1|CNS09MQ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530



to top

>emb|BX065526.1|CNS09MQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409



to top

>emb|BX065395.1|CNS09MMF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 456 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 500



to top

>emb|BX065394.1|CNS09MME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 433 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 389



to top

>emb|BX065267.1|CNS09MIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398



to top

>emb|BX064786.1|CNS09M5I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 427 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 383



to top

>emb|BX064578.1|CNS09LZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 407 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 363



to top

>emb|BX064318.1|CNS09LSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529



to top

>emb|BX064317.1|CNS09LSH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 467 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 423



to top

>emb|BX064256.1|CNS09LQS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405



to top

>emb|BX064193.1|CNS09LP1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 501



to top

>emb|BX064192.1|CNS09LP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407



to top

>emb|BX064097.1|CNS09LMD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 484 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 528



to top

>emb|BX064096.1|CNS09LMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 414



to top

>emb|BX064002.1|CNS09LJQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 508



to top

>emb|BX064001.1|CNS09LJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408



to top

>emb|BX063528.1|CNS09L6K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 465

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 435 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 391



to top

>emb|BX063517.1|CNS09L69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 720

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 314 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 358



to top

>emb|BX063516.1|CNS09L68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393



to top

>emb|BX063197.1|CNS09KXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517



to top

>emb|BX063196.1|CNS09KXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 463 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 419



to top

>emb|BX063195.1|CNS09KXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 466 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 510



to top

>emb|BX063194.1|CNS09KXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 462 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 418



to top

>emb|BX063139.1|CNS09KVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 457 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 413



to top

>emb|BX063083.1|CNS09KU7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 501 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 457



to top

>emb|BX062398.1|CNS09KB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 524



to top

>emb|BX062397.1|CNS09KB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407



to top

>emb|BX062248.1|CNS09K70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 443 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 399



to top

>emb|BX062217.1|CNS09K65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 473 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 517



to top

>emb|BX061945.1|CNS09JYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 416 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 372



to top

>emb|BX061917.1|CNS09JXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 509



to top

>emb|BX061916.1|CNS09JXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387



to top

>emb|BX061583.1|CNS09JOJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 440 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 396



to top

>emb|BX060671.1|CNS09IZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 110 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 66



to top

>emb|BX060630.1|CNS09IY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 114

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 47  tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 3



to top

>emb|BX060522.1|CNS09IV2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 459 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 503



to top

>emb|BX060521.1|CNS09IV1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401



to top

>emb|BX060463.1|CNS09ITF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 513



to top

>emb|BX060462.1|CNS09ITE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402



to top

>emb|BX060432.1|CNS09ISK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 475 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 519



to top

>emb|BX060431.1|CNS09ISJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402



to top

>emb|BX060386.1|CNS09IRA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 482 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 526



to top

>emb|BX060385.1|CNS09IR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 467 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 423



to top

>emb|BX060142.1|CNS09IKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 482



to top

>emb|BX060141.1|CNS09IKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386



to top

>emb|BX059766.1|CNS09IA2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 451 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 407



to top

>emb|BX059737.1|CNS09I99 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392



to top

>emb|BX059721.1|CNS09I8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 439 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 395



to top

>emb|BX059691.1|CNS09I7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 431 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 387



to top

>emb|BX059325.1|CNS09HXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 492 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 536



to top

>emb|BX059324.1|CNS09HXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 460 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 416



to top

>emb|BX059251.1|CNS09HVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401



to top

>emb|BX059147.1|CNS09HSV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 486 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 530



to top

>emb|BX059146.1|CNS09HSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420



to top

>emb|BX059121.1|CNS09HS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 445 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 401



to top

>emb|BX059021.1|CNS09HPD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 458 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 502



to top

>emb|BX059020.1|CNS09HPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 439 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 395



to top

>emb|BX058945.1|CNS09HN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 500 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 544



to top

>emb|BX058944.1|CNS09HN8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 471 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 427



to top

>emb|BX058853.1|CNS09HKP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 429 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 385



to top

>emb|BX058608.1|CNS09HDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392



to top

>emb|BX058465.1|CNS09H9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 464 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 420



to top

>emb|BX056668.1|CNS09FW0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 448 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 404



to top

>emb|BX057944.1|CNS09GVG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 450 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 406



to top

>emb|BX057637.1|CNS09GMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 500 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 544



to top

>emb|BX057636.1|CNS09GMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 438 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 394



to top

>emb|BX057549.1|CNS09GKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 489 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 533



to top

>emb|BX057548.1|CNS09GKG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 440 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 396



to top

>emb|BX057428.1|CNS09GH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 455 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 499



to top

>emb|BX057427.1|CNS09GH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 447 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 403



to top

>emb|BX057217.1|CNS09GB9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 446 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 402



to top

>emb|BX057111.1|CNS09G8B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 449 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 405



to top

>emb|BX057064.1|CNS09G70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 469 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 425



to top

>emb|BX056980.1|CNS09G4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 494

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 437 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 393



to top

>emb|BX056911.1|CNS09G2R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 511 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 555



to top

>emb|BX056910.1|CNS09G2Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 472 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 428



to top

>emb|BX056816.1|CNS09G04 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 401 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 357



to top

>emb|BX056561.1|CNS09FT1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 480 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 524



to top

>emb|BX056560.1|CNS09FT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 453 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 409



to top

>emb|BX056536.1|CNS09FSC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 394 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 350



to top

>emb|BX056232.1|CNS09FJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 547

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398



to top

>emb|BX056161.1|CNS09FHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 485 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 529



to top

>emb|BX056160.1|CNS09FHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 452 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 408



to top

>emb|BX055158.1|CNS09EQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 385 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 341



to top

>emb|BX053204.1|CNS09D7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 461 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 417



to top

>emb|BX054990.1|CNS09ELE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 224 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 180



to top

>emb|BX054749.1|CNS09EEP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 454 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 410



to top

>emb|BX053049.1|CNS09D3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 518



to top

>emb|BX053048.1|CNS09D3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 405 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 361



to top

>emb|BX054473.1|CNS09E71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 357 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 313



to top

>emb|BX054408.1|CNS09E58 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 733

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 358 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 314



to top

>emb|BX054219.1|CNS09DZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 493 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 537



to top

>emb|BX054218.1|CNS09DZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 465 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 421



to top

>emb|BX053917.1|CNS09DRL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 482

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386



to top

>emb|BX053763.1|CNS09DNB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 474 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 430



to top

>emb|BX053650.1|CNS09DK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 436 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 392



to top

>emb|BX053531.1|CNS09DGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 514



to top

>emb|BX053530.1|CNS09DGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 442 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 398



to top

>emb|BX052795.1|CNS09CWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 509 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 553



to top

>emb|BX052794.1|CNS09CWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 470 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 426



to top

>emb|BX052608.1|CNS09CR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 481 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 525



to top

>emb|BX052607.1|CNS09CR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 430 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 386



to top

>emb|BX052579.1|CNS09CQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 155 tagaagcggagcttggtgaagaaccacctgttcttgccggtcttg 199
           ||||| ||||||||   |||||||||| |||||||||||||||||
Sbjct: 478 tagaaacggagcttctggaagaaccacttgttcttgccggtcttg 522


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,929,720
Number of Sequences: 3902068
Number of extensions: 4929720
Number of successful extensions: 102574
Number of sequences better than 10.0: 693
Number of HSP's better than 10.0 without gapping: 695
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100072
Number of HSP's gapped (non-prelim): 2465
length of query: 633
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 610
effective length of database: 17,143,297,704
effective search space: 10457411599440
effective search space used: 10457411599440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top