ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4j09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX663614.24| Zebrafish DNA sequence from clone DKEY-148L2 in... 44 0.42
2emb|BX927303.11| Zebrafish DNA sequence from clone CH211-67L13 i... 44 0.42
3gb|AC104864.6| Homo sapiens chromosome 8, clone RP11-324E17, com... 42 1.6
4gb|AC073359.12| Homo sapiens 3 BAC RP11-439C8 (Roswell Park Canc... 42 1.6
5gb|AC018796.4|AC018796 Homo sapiens chromosome 8, clone RP11-51K... 42 1.6
6dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 42 1.6
7ref|XM_710947.1| Candida albicans SC5314 hypothetical protein (C... 40 6.5
8ref|XM_710889.1| Candida albicans SC5314 hypothetical protein (C... 40 6.5
9ref|XM_747311.1| Aspergillus fumigatus Af293 nonribosomal peptid... 40 6.5
10gb|AC005084.2| Homo sapiens BAC clone CTA-298G8 from 7, complete... 40 6.5
11gb|AC104866.10| Mus musculus chromosome 17, clone RP23-268C14, c... 40 6.5
12emb|AL607125.14| Mouse DNA sequence from clone RP23-309F11 on ch... 40 6.5
13dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 40 6.5
14gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 40 6.5
15emb|AL844588.17| Mouse DNA sequence from clone RP23-244N6 on chr... 40 6.5
16gb|AC110186.10| Mus musculus chromosome 7, clone RP24-503J9, com... 40 6.5

>emb|BX663614.24| Zebrafish DNA sequence from clone DKEY-148L2 in linkage group 6, complete
              sequence
          Length = 191715

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 240    tcatcattagaaacaaactctt 261
              ||||||||||||||||||||||
Sbjct: 179542 tcatcattagaaacaaactctt 179563



to top

>emb|BX927303.11| Zebrafish DNA sequence from clone CH211-67L13 in linkage group 6,
              complete sequence
          Length = 163380

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 240    tcatcattagaaacaaactctt 261
              ||||||||||||||||||||||
Sbjct: 140169 tcatcattagaaacaaactctt 140148



to top

>gb|AC104864.6| Homo sapiens chromosome 8, clone RP11-324E17, complete sequence
          Length = 168786

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 394   catgaagatgatgagtacttc 414
             |||||||||||||||||||||
Sbjct: 24845 catgaagatgatgagtacttc 24865



to top

>gb|AC073359.12| Homo sapiens 3 BAC RP11-439C8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178336

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 410    acttctttctcttgtctagca 430
              |||||||||||||||||||||
Sbjct: 144233 acttctttctcttgtctagca 144253



to top

>gb|AC018796.4|AC018796 Homo sapiens chromosome 8, clone RP11-51K12, complete sequence
          Length = 148189

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 394    catgaagatgatgagtacttc 414
              |||||||||||||||||||||
Sbjct: 145156 catgaagatgatgagtacttc 145176



to top

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 56      tcactaagtcacaaccaaaag 76
               |||||||||||||||||||||
Sbjct: 3009654 tcactaagtcacaaccaaaag 3009674



to top

>ref|XM_710947.1| Candida albicans SC5314 hypothetical protein (CaO19_2200), mRNA
          Length = 1311

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 37   ttcttgctctttgattctct 56
            ||||||||||||||||||||
Sbjct: 1119 ttcttgctctttgattctct 1100



to top

>ref|XM_710889.1| Candida albicans SC5314 hypothetical protein (CaO19_9746), mRNA
          Length = 1311

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 37   ttcttgctctttgattctct 56
            ||||||||||||||||||||
Sbjct: 1119 ttcttgctctttgattctct 1100



to top

>ref|XM_747311.1| Aspergillus fumigatus Af293 nonribosomal peptide synthase NRPS
           (Afu1g10380) partial mRNA
          Length = 18810

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 129 caaggttgcatatgatcttc 148
           ||||||||||||||||||||
Sbjct: 912 caaggttgcatatgatcttc 931



to top

>gb|AC005084.2| Homo sapiens BAC clone CTA-298G8 from 7, complete sequence
          Length = 177901

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 236   aatttcatcattagaaacaa 255
             ||||||||||||||||||||
Sbjct: 89597 aatttcatcattagaaacaa 89578



to top

>gb|AC104866.10| Mus musculus chromosome 17, clone RP23-268C14, complete sequence
          Length = 176240

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 415    tttctcttgtctagcattct 434
              ||||||||||||||||||||
Sbjct: 117380 tttctcttgtctagcattct 117399



to top

>emb|AL607125.14| Mouse DNA sequence from clone RP23-309F11 on chromosome 11, complete
             sequence
          Length = 170708

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 386   gaggacatcatgaagatgatgagt 409
             |||||||||||||| |||||||||
Sbjct: 63403 gaggacatcatgaacatgatgagt 63426



to top

>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete
               genome
          Length = 2516575

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 229     caacgtcaatttcatcatta 248
               ||||||||||||||||||||
Sbjct: 2245839 caacgtcaatttcatcatta 2245858



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 234     tcaatttcatcattagaaac 253
               ||||||||||||||||||||
Sbjct: 1681520 tcaatttcatcattagaaac 1681539



to top

>emb|AL844588.17| Mouse DNA sequence from clone RP23-244N6 on chromosome 2, complete
             sequence
          Length = 142422

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 96    ctcacaactcacaacaccaa 115
             ||||||||||||||||||||
Sbjct: 33595 ctcacaactcacaacaccaa 33576



to top

>gb|AC110186.10| Mus musculus chromosome 7, clone RP24-503J9, complete sequence
          Length = 168058

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    tttcatcattagaaacaaac 257
              ||||||||||||||||||||
Sbjct: 103566 tttcatcattagaaacaaac 103585


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,735,380
Number of Sequences: 3902068
Number of extensions: 3735380
Number of successful extensions: 70069
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70003
Number of HSP's gapped (non-prelim): 66
length of query: 480
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 458
effective length of database: 17,147,199,772
effective search space: 7853417495576
effective search space used: 7853417495576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top