ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4i23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF074969.1|AF074969 Triticum aestivum heat shock protein 70 (... 718 0.0
2dbj|AK060410.1| Oryza sativa (japonica cultivar-group) cDNA clon... 317 3e-83
3gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome... 266 1e-67
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 266 1e-67
5gb|AY108828.1| Zea mays PCO138532 mRNA sequence 214 3e-52
6dbj|AK121949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 5e-48
7dbj|AK119535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 5e-48
8dbj|AK072071.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 5e-48
9dbj|AK069937.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 5e-48
10gb|AY104911.1| Zea mays PCO138533 mRNA sequence 182 1e-42
11gb|AY105690.1| Zea mays PCO065072 mRNA sequence 180 4e-42
12gb|BT018142.1| Zea mays clone EL01N0555B07.c mRNA sequence 178 2e-41
13gb|BT016772.1| Zea mays clone Contig605 mRNA sequence 163 1e-36
14gb|BT024111.1| Zea mays clone EL01N0516B01 mRNA sequence 163 1e-36
15gb|AY224466.1| Oryza sativa (japonica cultivar-group) isolate 23... 157 6e-35
16dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 111 3e-21
17gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 111 3e-21
18emb|AL831810.4|CNS08CAN Oryza sativa chromosome 12, . BAC OSJNBa... 111 3e-21
19gb|DQ224261.1| Aquilegia pyrenaica putative heat shock protein 7... 109 1e-20
20gb|DQ224260.1| Aquilegia brevistyla putative heat shock protein ... 109 1e-20
21gb|DQ224258.1| Aquilegia formosa putative heat shock protein 70 ... 109 1e-20
22gb|DQ224263.1| Semiaquilegia adoxoides putative heat shock prote... 101 3e-18
23gb|DQ224262.1| Aquilegia olympica putative heat shock protein 70... 101 3e-18
24gb|DQ224259.1| Aquilegia chrysantha putative heat shock protein ... 101 3e-18
25emb|X69213.1|PSST70 P.sativum Psst70 gene for heat-shock protein 98 5e-17
26gb|L03299.1|PEA70HSP Pisum sativum chloroplast stromal 70 kDa he... 98 5e-17
27ref|NM_118561.2| Arabidopsis thaliana CPHSC70-1; ATP binding AT4... 94 8e-16
28gb|AY072138.1| Arabidopsis thaliana putative hsp 70 protein (At4... 94 8e-16
29gb|BT001950.1| Arabidopsis thaliana clone U19959 putative hsp 70... 94 8e-16
30gb|DQ224254.1| Aquilegia formosa heak shock protein 70 (HSP70) m... 88 5e-14
31gb|AC140550.31| Medicago truncatula clone mth2-54a24, complete s... 86 2e-13
32gb|U92815.1|CLU92815 Citrullus lanatus heat shock protein 70 pre... 86 2e-13
33emb|X73961.1|CSHSP70 C.sativus mRNA for heat shock protein 70 (h... 84 8e-13
34emb|AL078637.1|ATT22A6 Arabidopsis thaliana DNA chromosome 4, BA... 68 5e-08
35emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, ... 68 5e-08
36dbj|AB181295.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 62 3e-06
37ref|NM_124369.2| Arabidopsis thaliana cpHSC70-2 (HEAT SHOCK PROT... 58 4e-05
38gb|BT000919.1| Arabidopsis thaliana clone C105236 putative heat ... 58 4e-05
39gb|AY080761.1| Arabidopsis thaliana At5g49910 mRNA sequence 58 4e-05
40emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognat... 54 7e-04
41gb|AY072744.1| Dunaliella salina heat shock protein 70B (hsp70B)... 54 7e-04
42gb|AF217459.1|AF217459 Arabidopsis thaliana heat shock protein 7... 54 7e-04
43ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA 54 7e-04
44gb|AY081331.1| Arabidopsis thaliana heat shock protein 70 (At5g4... 50 0.011
45dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock prote... 48 0.042
46gb|AF502513.1| Isurus oxyrinchus isolate Isox10 Hsp70 pseudogene... 46 0.17
47gb|AF502437.1| Carcharias taurus isolate Cata2 Hsp70 protein (Hs... 46 0.17
48gb|AF502436.1| Carcharias taurus isolate Cata1 Hsp70 protein (Hs... 46 0.17
49gb|AF427596.1|AF427596 Artemia franciscana 70 kDa heat shock pro... 46 0.17
50gb|AF035457.1|AF035457 Spinacia oleracea heat shock 70 protein (... 46 0.17
51emb|AL034399.6|HS191P20 Human DNA sequence from clone RP6-191P20... 46 0.17
52emb|AL137065.10| Human DNA sequence from clone RP11-4P13 on chro... 46 0.17
53gb|BC105182.1| Bos taurus heat shock 70 kDa protein 8, mRNA (cDN... 44 0.66
54gb|AC074052.6| Homo sapiens chromosome 16 clone RP11-483K5, comp... 44 0.66
55gb|AC137777.3| Homo sapiens chromosome 16 clone LA16c-500E3, com... 44 0.66
56dbj|AB024032.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.66
57ref|NM_174345.3| Bos taurus heat shock 70 kDa protein 8 (HSPA8),... 44 0.66
58emb|X53827.1|BTHSCP Bovine mRNA for 7O KDa heat shock cognate pr... 44 0.66
59emb|X53335.1|BT70HSP Bovine mRNA for a 70 Kd heat shock cognate ... 44 0.66
60ref|NM_124370.3| Arabidopsis thaliana unknown protein AT5G49920 ... 42 2.6
61gb|AY766104.1| Dengue virus type 3 strain Singapore 8120/95, com... 42 2.6
62gb|AY665402.1| Dengue virus type 3 polyprotein gene, partial cds 42 2.6
63gb|AY632355.1| Dengue virus type 3 isolate AM2394 from Brazil po... 42 2.6
64gb|AY662691.1| Dengue virus type 3 from Singapore, complete genome 42 2.6
65gb|AY099336.1| Dengue virus type 3 isolate D3/H/IMTSSA-SRI/2000/... 42 2.6
66gb|AF547260.1| Dengue virus type 3 612210 polyprotein gene, part... 42 2.6
67gb|AF547242.1| Dengue virus type 3 L57 polyprotein gene, partial... 42 2.6
68gb|AF547241.1| Dengue virus type 3 073 polyprotein gene, partial... 42 2.6
69gb|AF547240.1| Dengue virus type 3 SOM079 polyprotein gene, part... 42 2.6
70gb|AF547239.1| Dengue virus type 3 251991 polyprotein gene, part... 42 2.6
71gb|AF547238.1| Dengue virus type 3 1559 polyprotein gene, partia... 42 2.6
72gb|AF547237.1| Dengue virus type 3 1558 polyprotein gene, partia... 42 2.6
73gb|AF547236.1| Dengue virus type 3 1557 polyprotein gene, partia... 42 2.6
74gb|AF547235.1| Dengue virus type 3 D9397 polyprotein gene, parti... 42 2.6
75gb|AF547234.1| Dengue virus type 3 D5231 polyprotein gene, parti... 42 2.6
76gb|AF547233.1| Dengue virus type 3 D3197 polyprotein gene, parti... 42 2.6
77gb|AF547232.1| Dengue virus type 3 D2803 polyprotein gene, parti... 42 2.6
78gb|AF547231.1| Dengue virus type 3 D2863 polyprotein gene, parti... 42 2.6
79gb|AF547230.1| Dengue virus type 3 D2783 polyprotein gene, parti... 42 2.6
80gb|AF547229.1| Dengue virus type 3 D1440 polyprotein gene, parti... 42 2.6
81gb|AF547228.1| Dengue virus type 3 D1336 polyprotein gene, parti... 42 2.6
82gb|AF547227.1| Dengue virus type 3 D1307 polyprotein gene, parti... 42 2.6
83gb|AF547226.1| Dengue virus type 3 D1306 polyprotein gene, parti... 42 2.6
84gb|AF547225.1| Dengue virus type 3 D1266 polyprotein gene, parti... 42 2.6
85emb|AL732556.7| Mouse DNA sequence from clone RP24-144L11 on chr... 42 2.6
86emb|AJ271605.2|DSA271605 Dunaliella salina mRNA for chloroplast-... 42 2.6
87gb|AC154913.4| Ornithorhynchus anatinus BAC clone OABb-535A1 fro... 42 2.6
88gb|DQ401695.1| Dengue virus type 3 isolate mutant PhMH-J1-97, co... 42 2.6
89gb|DQ401694.1| Dengue virus type 3 isolate mutant InJ-I6-82, com... 42 2.6
90gb|DQ401693.1| Dengue virus type 3 isolate mutant BDH02-07, comp... 42 2.6
91gb|DQ401692.1| Dengue virus type 3 isolate mutant BDH02-04, comp... 42 2.6
92gb|DQ401691.1| Dengue virus type 3 isolate mutant BDH02-03, comp... 42 2.6
93gb|DQ401690.1| Dengue virus type 3 isolate InJ-16-82, complete g... 42 2.6
94gb|DQ401689.1| Dengue virus type 3 isolate mutant BDH02-01, comp... 42 2.6
95gb|AY496878.1| Dengue virus type 3 isolate BDH02-8 polyprotein g... 42 2.6
96gb|AY496876.1| Dengue virus type 3 isolate BDH02-6 polyprotein g... 42 2.6
97gb|AY496875.1| Dengue virus type 3 isolate BDH02-5 polyprotein g... 42 2.6
98gb|AY496872.1| Dengue virus type 3 isolate BDH02-2 polyprotein g... 42 2.6
99gb|AY496871.2| Dengue virus type 3 isolate BDH02-1, complete genome 42 2.6
100gb|AY496873.2| Dengue virus type 3 isolate BDH02-3, complete genome 42 2.6
101gb|AY496874.2| Dengue virus type 3 isolate BDH02-4, complete genome 42 2.6
102gb|AY496877.2| Dengue virus type 3 isolate BDH02-7, complete genome 42 2.6
103gb|AY496879.2| Dengue virus type 3 isolate PhMH-J1-97, complete ... 42 2.6
104dbj|AB214882.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.6
105dbj|AB214881.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.6
106dbj|AB214880.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.6
107dbj|AB214879.1| Dengue virus type 3 genomic RNA, neally complete... 42 2.6
108gb|AY960633.1| Dengue virus type 3 isolate RGN576 polyprotein ge... 42 2.6
109gb|AY960632.1| Dengue virus type 3 isolate MTO3103 polyprotein g... 42 2.6
110gb|AY960629.1| Dengue virus type 3 isolate CEA4739 polyprotein g... 42 2.6
111gb|AY960628.1| Dengue virus type 3 isolate Bel73318 polyprotein ... 42 2.6
112gb|AC008705.6| Homo sapiens chromosome 5 clone CTB-77H17, comple... 42 2.6
113gb|AY265857.1| Dengue virus type 3 isolate NAMRU-2 98901620 poly... 42 2.6
114gb|AY265856.1| Dengue virus type 3 isolate NAMRU-2 98901413 poly... 42 2.6
115dbj|AK020205.1| Mus musculus 15 days embryo male testis cDNA, RI... 42 2.6
116gb|AY923865.1| Dengue virus type 3 strain C0360/94, complete genome 42 2.6
117gb|AY912458.1| Dengue virus type 3 strain KPS-4-0657/207 polypro... 42 2.6
118gb|AY912455.1| Dengue virus type 3 strain 98901640 polyprotein m... 42 2.6
119gb|AY912454.1| Dengue virus type 3 strain 98901590 polyprotein m... 42 2.6
120dbj|AK005815.1| Mus musculus adult male testis cDNA, RIKEN full-... 42 2.6
121gb|AF349753.1|AF349753 Dengue virus type 3 strain PaH881/88 poly... 42 2.6
122gb|AF317645.1|AF317645 Dengue virus type 3 strain 80-2, complete... 42 2.6
123dbj|AB189127.1| Dengue virus type 3 genomic RNA, complete genome... 42 2.6
124dbj|AB189126.1| Dengue virus type 3 genomic RNA, complete genome... 42 2.6
125dbj|AB189125.1| Dengue virus type 3 genomic RNA, complete genome... 42 2.6
126emb|AL935144.11| Zebrafish DNA sequence from clone CH211-89B14 i... 42 2.6
127dbj|AP001093.5| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 2.6
128emb|AJ563355.1|DVI563355 Dengue virus type 3 proviral partial ge... 42 2.6
129gb|M93130.1|DENCME Dengue type 3 virus complete genome RNA, comp... 42 2.6
130gb|AY676353.1| Dengue virus type 3 strain ThD3_0007_87, complete... 42 2.6
131gb|AY676352.1| Dengue virus type 3 strain ThD3_0010_87, complete... 42 2.6
132gb|AY676351.1| Dengue virus type 3 strain ThD3_0055_93, complete... 42 2.6
133gb|AY676350.1| Dengue virus type 3 strain ThD3_0104_93, complete... 42 2.6
134gb|AY676349.1| Dengue virus type 3 strain ThD3_1283_98, complete... 42 2.6
135gb|AY676348.1| Dengue virus type 3 strain ThD3_1687_98, complete... 42 2.6
136gb|AC122767.16| Mus musculus chromosome 7, clone RP24-143L4, com... 42 2.6
137gb|M86733.1|DENENVAA Dengue virus type 3 structural proteins, co... 42 2.6
138gb|AY858048.1| Dengue virus type 3 strain TB55i, complete genome 42 2.6
139gb|AY858047.1| Dengue virus type 3 strain TB16, complete genome 42 2.6
140gb|AY858046.1| Dengue virus type 3 strain PI64, complete genome 42 2.6
141gb|AY858045.1| Dengue virus type 3 strain PH86, complete genome 42 2.6
142gb|AY858044.1| Dengue virus type 3 strain KJ71, complete genome 42 2.6
143gb|AY858042.1| Dengue virus type 3 strain KJ30i, complete genome 42 2.6
144gb|AY858041.1| Dengue virus type 3 strain FW06, complete genome 42 2.6
145gb|AY858040.1| Dengue virus type 3 strain FW01, complete genome 42 2.6
146gb|AY858039.1| Dengue virus type 3 strain den3_98, complete genome 42 2.6
147gb|AY858037.1| Dengue virus type 3 strain BA51, complete genome 42 2.6
148gb|M25277.1|DENSP5AA Dengue virus type 3 5' region of the genome... 42 2.6
149gb|L11620.1|DENENVGLYW Dengue virus type 3 membrane protein (prM... 42 2.6
150dbj|AB010990.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
151dbj|AB010989.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
152dbj|AB010988.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
153dbj|AB010987.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
154dbj|AB010986.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
155dbj|AB010985.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
156dbj|AB010984.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
157dbj|AB010983.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
158dbj|AB010982.1| Dengue virus type 3 RNA for polyprotein (C/C'/pr... 42 2.6
159gb|L11427.1|DENENVGLYF Dengue virus type 3 membrane protein (prM... 42 2.6
160gb|L11442.1|DENENVGLYU Dengue virus type 3 membrane protein (prM... 42 2.6
161gb|L11441.1|DENENVGLYT Dengue virus type 3 membrane protein (prM... 42 2.6
162gb|L11439.1|DENENVGLYR Dengue virus type 3 membrane protein (prM... 42 2.6
163gb|L11438.1|DENENVGLYQ Dengue virus type 3 membrane protein (prM... 42 2.6
164gb|L11437.1|DENENVGLYP Dengue virus type 3 membrane protein (prM... 42 2.6
165gb|L11436.1|DENENVGLYO Dengue virus type 3 membrane protein (prM... 42 2.6
166gb|L11435.1|DENENVGLYN Dengue virus type 3 membrane protein (prM... 42 2.6
167gb|L11434.1|DENENVGLYM Dengue virus type 3 membrane protein (prM... 42 2.6
168gb|L11433.1|DENENVGLYL Dengue virus type 3 membrane protein (prM... 42 2.6
169gb|L11431.1|DENENVGLYJ Dengue virus type 3 membrane protein (prM... 42 2.6
170gb|L11430.1|DENENVGLYI Dengue virus type 3 membrane protein (prM... 42 2.6
171gb|L11429.1|DENENVGLYH Dengue virus type 3 membrane protein (prM... 42 2.6
172gb|L11428.1|DENENVGLYG Dengue virus type 3 membrane protein (prM... 42 2.6
173gb|L11426.1|DENENVGLYE Dengue virus type 3 membrane protein (prM... 42 2.6
174gb|L11425.1|DENENVGLYD Dengue virus type 3 membrane protein (prM... 42 2.6
175gb|L11423.1|DENENVGLYB Dengue virus type 3 membrane protein (prM... 42 2.6
176gb|M99565.1|SPI80HSP Spinach 80 kDa heat shock protein (HSP80) m... 42 2.6

>gb|AF074969.1|AF074969 Triticum aestivum heat shock protein 70 (HSP70) mRNA, HSP70-S allele,
            complete cds
          Length = 1569

 Score =  718 bits (362), Expect = 0.0
 Identities = 410/426 (96%)
 Strand = Plus / Minus

                                                                        
Query: 325  cagctccaggggtagggccagatccctgctgctggtagagggactgaccaagctgcatca 384
            ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
Sbjct: 1278 cagctccaggggtagggcctgacccctgctgctggtagagggactgaccaagctgcatca 1219

                                                                        
Query: 385  cttcttggttcaacgcagctagtgcatcctttatcgtctctgtcgatccaccagcaacag 444
            ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
Sbjct: 1218 cttcttggttcaacgcagctagtgcatcctttatcgtctgtgtcgatccaccagcaacgg 1159

                                                                        
Query: 445  cgtcctggagttccttgagcttcccctccaccttctccttgacatcgccggggaccttgt 504
            || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1158 cgacctggagttccttgagcttcccctccaccttctccttgacatcgcctgggaccttgt 1099

                                                                        
Query: 505  ctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctggttcttgg 564
            | || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1098 ccccgagctccttcagttgtttctcagtctggtagatcacagattctgcctggttcttgg 1039

                                                                        
Query: 565  tgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttcttccacca 624
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1038 tgtcaattgcgtccctcttctccttgtcctccgccgcgaatttttcagcttcttccacca 979

                                                                        
Query: 625  tcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttct 684
            ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 978  tcttctctacctcatcctttggcagtgtgctggctccagtgatcgtaatgtcctgcttct 919

                                                                        
Query: 685  tttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaact 744
            |  |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 918  tcccagtacccttatccaccgcagcaacagacagaatgccattggcatcaatatcaaact 859

                  
Query: 745  tgactt 750
            ||||||
Sbjct: 858  tgactt 853



 Score =  176 bits (89), Expect = 7e-41
 Identities = 123/133 (92%), Gaps = 1/133 (0%)
 Strand = Plus / Minus

                                                                        
Query: 166  tactaggcaatcctgttgaacaaaatcatactcacttgttgcaccatgtcctaacctaca 225
            |||||||||||| ||| ||||||| ||||||||||||||| || ||||||||||||||| 
Sbjct: 1442 tactaggcaatcatgtggaacaaattcatactcacttgtt-catcatgtcctaacctact 1384

                                                                        
Query: 226  gttctattcaattgctatcagtaaaatcagcgtctataacgtcaccaccatcgcctgtct 285
            |||||||||||||||| ||  |||||||||||||||| ||||||||||||||||||||||
Sbjct: 1383 gttctattcaattgctgtcgataaaatcagcgtctatgacgtcaccaccatcgcctgtct 1324

                         
Query: 286  tctcagatgggcc 298
            |||||||||||||
Sbjct: 1323 tctcagatgggcc 1311



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                        
Query: 99   tgaactctccaaacctccaacatcacgaactc---cgataccctgacaggagacaaggtc 155
            |||||||||||||||||||||||||  |||||   | | |||||||||||| ||||||||
Sbjct: 1533 tgaactctccaaacctccaacatcaaaaactcgtacaacaccctgacaggaaacaaggtc 1474

                 
Query: 156  ccaat 160
             ||||
Sbjct: 1473 tcaat 1469



to top

>dbj|AK060410.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-D10, full
            insert sequence
          Length = 1581

 Score =  317 bits (160), Expect = 3e-83
 Identities = 334/392 (85%)
 Strand = Plus / Minus

                                                                        
Query: 359  gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 418
            |||||||| ||| || |||||||||||||| ||||||   ||||| || |||||||| ||
Sbjct: 1250 gtagagggcctgccccagctgcatcacttcctggttcggagcagcgagagcatccttcat 1191

                                                                        
Query: 419  cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 478
            ||||| |||||| ||||| ||||||||||||| ||| ||| | |||||| |||| |||||
Sbjct: 1190 cgtctgtgtcgagccacctgcaacagcgtccttgagctccgtcagcttcgcctcaacctt 1131

                                                                        
Query: 479  ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 538
              |||| |||||||| ||||||||||| || |||||||||| ||||||||||||||||||
Sbjct: 1130 acccttcacatcgcctgggaccttgtcaccgagctccttcaattgtttctcagtctggta 1071

                                                                        
Query: 539  gatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgc 598
            ||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||  
Sbjct: 1070 gatgacagactctgcctggttcttggtgtcgattgcgtccctcttctctttgtcctcctt 1011

                                                                        
Query: 599  cgcaaatttttcagcttcttccaccatcttctctacctcatcctttggcagtgtgcttgc 658
             ||||| || || |||||||| ||||||||||| ||||||||||| |||| |||||| ||
Sbjct: 1010 ggcaaacttctctgcttcttcaaccatcttctccacctcatccttcggcaatgtgctggc 951

                                                                        
Query: 659  tccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaacagacag 718
             ||||| || |||||||||||||||||| |||| ||||| || || ||    ||||| ||
Sbjct: 950  accagttatcgtaatgtcctgcttctttccagtacccttgtctacggcgctgacagaaag 891

                                            
Query: 719  aatgccattggcatcaatatcgaacttgactt 750
             |||||||||||||| || || ||||| ||||
Sbjct: 890  gatgccattggcatcgatgtcaaacttaactt 859



to top

>gb|AC098572.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OJ1234_D05, complete sequence
          Length = 107476

 Score =  266 bits (134), Expect = 1e-67
 Identities = 242/278 (87%)
 Strand = Plus / Minus

                                                                         
Query: 359   gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 418
             |||||||| ||| || |||||||||||||| |||||||  ||||| || |||||||| ||
Sbjct: 37314 gtagagggcctgccccagctgcatcacttcctggttcagagcagcgagagcatccttcat 37255

                                                                         
Query: 419   cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 478
             ||||| |||||| ||||| ||||||||||||| ||| ||| | |||||| |||| |||||
Sbjct: 37254 cgtctgtgtcgagccacctgcaacagcgtccttgagctccgtcagcttcgcctcaacctt 37195

                                                                         
Query: 479   ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 538
               |||| |||||||| ||||||||||| || |||||||||| ||||||||||||||||||
Sbjct: 37194 acccttcacatcgcctgggaccttgtcaccgagctccttcaattgtttctcagtctggta 37135

                                                                         
Query: 539   gatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgc 598
             ||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||  
Sbjct: 37134 gatgacagactctgcctggttcttggtgtcgattgcgtccctcttctctttgtcctcctt 37075

                                                   
Query: 599   cgcaaatttttcagcttcttccaccatcttctctacct 636
              ||||| || || |||||||| ||||||||||| ||||
Sbjct: 37074 ggcaaacttctctgcttcttcaaccatcttctccacct 37037



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 98/119 (82%)
 Strand = Plus / Minus

                                                                         
Query: 632   tacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagt 691
             |||||||||||| |||| |||||| || ||||| || |||||||||||||||||| ||||
Sbjct: 36951 tacctcatccttcggcaatgtgctggcaccagttatcgtaatgtcctgcttctttccagt 36892

                                                                        
Query: 692   gcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
              ||||| || || ||    ||||| || |||||||||||||| || || ||||| ||||
Sbjct: 36891 acccttgtctacggcgctgacagaaaggatgccattggcatcgatgtcaaacttaactt 36833



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  266 bits (134), Expect = 1e-67
 Identities = 242/278 (87%)
 Strand = Plus / Minus

                                                                            
Query: 359      gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 418
                |||||||| ||| || |||||||||||||| |||||||  ||||| || |||||||| ||
Sbjct: 13493268 gtagagggcctgccccagctgcatcacttcctggttcagagcagcgagagcatccttcat 13493209

                                                                            
Query: 419      cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 478
                ||||| |||||| ||||| ||||||||||||| ||| ||| | |||||| |||| |||||
Sbjct: 13493208 cgtctgtgtcgagccacctgcaacagcgtccttgagctccgtcagcttcgcctcaacctt 13493149

                                                                            
Query: 479      ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 538
                  |||| |||||||| ||||||||||| || |||||||||| ||||||||||||||||||
Sbjct: 13493148 acccttcacatcgcctgggaccttgtcaccgagctccttcaattgtttctcagtctggta 13493089

                                                                            
Query: 539      gatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgc 598
                ||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||  
Sbjct: 13493088 gatgacagactctgcctggttcttggtgtcgattgcgtccctcttctctttgtcctcctt 13493029

                                                      
Query: 599      cgcaaatttttcagcttcttccaccatcttctctacct 636
                 ||||| || || |||||||| ||||||||||| ||||
Sbjct: 13493028 ggcaaacttctctgcttcttcaaccatcttctccacct 13492991



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 98/119 (82%)
 Strand = Plus / Minus

                                                                            
Query: 632      tacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagt 691
                |||||||||||| |||| |||||| || ||||| || |||||||||||||||||| ||||
Sbjct: 13492905 tacctcatccttcggcaatgtgctggcaccagttatcgtaatgtcctgcttctttccagt 13492846

                                                                           
Query: 692      gcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
                 ||||| || || ||    ||||| || |||||||||||||| || || ||||| ||||
Sbjct: 13492845 acccttgtctacggcgctgacagaaaggatgccattggcatcgatgtcaaacttaactt 13492787



to top

>gb|AY108828.1| Zea mays PCO138532 mRNA sequence
          Length = 662

 Score =  214 bits (108), Expect = 3e-52
 Identities = 275/328 (83%), Gaps = 2/328 (0%)
 Strand = Plus / Minus

                                                                       
Query: 359 gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtg-catccttta 417
           |||||||||||| |||| |||||| ||||| |||||||| ||| ||| || | ||||| |
Sbjct: 360 gtagagggactgcccaatctgcatgacttcctggttcaatgca-ctaatggcgtccttca 302

                                                                       
Query: 418 tcgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacct 477
           |||||| ||| || |||||||||||||| |||| ||| || |  ||||||  ||| ||||
Sbjct: 301 tcgtctgtgtggagccaccagcaacagcatccttgagctcttgcagcttcgactcgacct 242

                                                                       
Query: 478 tctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggt 537
           || ||||||| ||||| ||||||||||| || || ||||||||||||||||| |||||||
Sbjct: 241 tccccttgacgtcgcccgggaccttgtcccctagttccttcagttgtttctcggtctggt 182

                                                                       
Query: 538 agatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcctccg 597
           | || || ||||| || ||||||||||||||||| || || ||||||||||| |||||| 
Sbjct: 181 aaatgaccgactcggcttggttcttggtgtcaatggcatctctcttctccttatcctcct 122

                                                                       
Query: 598 ccgcaaatttttcagcttcttccaccatcttctctacctcatcctttggcagtgtgcttg 657
             ||||| || |||||||| || |||||| |||| ||||| ||||||||||| ||||| |
Sbjct: 121 ttgcaaacttctcagcttcgtcaaccatcctctccacctcgtcctttggcagagtgctgg 62

                                       
Query: 658 ctccagtgattgtaatgtcctgcttctt 685
           | ||||| |||||||| |||||||||||
Sbjct: 61  caccagtaattgtaatatcctgcttctt 34



to top

>dbj|AK121949.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107J07, full
            insert sequence
          Length = 2462

 Score =  200 bits (101), Expect = 5e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 498  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 1883 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 1824

                                                                        
Query: 558  ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
            || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 1823 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 1764

                                                                        
Query: 618  tccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcc 677
            ||||||||  |||| |||||||||||||||||||| || || || ||||| || || |||
Sbjct: 1763 tccaccattctctcaacctcatcctttggcagtgtactagcgccggtgatggtgatatcc 1704

                                                                        
Query: 678  tgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaata 737
            || |||||  |||| |||||||| |  ||||||||||| ||||| |||||||||||||||
Sbjct: 1703 tgtttcttcccagtacccttatcaatagcagcaacagagagaataccattggcatcaata 1644

                         
Query: 738  tcgaacttgactt 750
            || ||||||||||
Sbjct: 1643 tcaaacttgactt 1631



to top

>dbj|AK119535.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B03, full
            insert sequence
          Length = 1667

 Score =  200 bits (101), Expect = 5e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 498  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 1112 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 1053

                                                                        
Query: 558  ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
            || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 1052 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 993

                                                                        
Query: 618  tccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcc 677
            ||||||||  |||| |||||||||||||||||||| || || || ||||| || || |||
Sbjct: 992  tccaccattctctcaacctcatcctttggcagtgtactagcgccggtgatggtgatatcc 933

                                                                        
Query: 678  tgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaata 737
            || |||||  |||| |||||||| |  ||||||||||| ||||| |||||||||||||||
Sbjct: 932  tgtttcttcccagtacccttatcaatagcagcaacagagagaataccattggcatcaata 873

                         
Query: 738  tcgaacttgactt 750
            || ||||||||||
Sbjct: 872  tcaaacttgactt 860



to top

>dbj|AK072071.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111L16, full
            insert sequence
          Length = 2201

 Score =  200 bits (101), Expect = 5e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 498  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
            |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 1628 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 1569

                                                                        
Query: 558  ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
            || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 1568 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 1509

                                                                        
Query: 618  tccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcc 677
            ||||||||  |||| |||||||||||||||||||| || || || ||||| || || |||
Sbjct: 1508 tccaccattctctcaacctcatcctttggcagtgtactagcgccggtgatggtgatatcc 1449

                                                                        
Query: 678  tgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaata 737
            || |||||  |||| |||||||| |  ||||||||||| ||||| |||||||||||||||
Sbjct: 1448 tgtttcttcccagtacccttatcaatagcagcaacagagagaataccattggcatcaata 1389

                         
Query: 738  tcgaacttgactt 750
            || ||||||||||
Sbjct: 1388 tcaaacttgactt 1376



to top

>dbj|AK069937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038F19, full
           insert sequence
          Length = 1293

 Score =  200 bits (101), Expect = 5e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                       
Query: 498 accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
           |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 714 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 655

                                                                       
Query: 558 ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
           || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 654 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 595

                                                                       
Query: 618 tccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcc 677
           ||||||||  |||| |||||||||||||||||||| || || || ||||| || || |||
Sbjct: 594 tccaccattctctcaacctcatcctttggcagtgtactagcgccggtgatggtgatatcc 535

                                                                       
Query: 678 tgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaata 737
           || |||||  |||| |||||||| |  ||||||||||| ||||| |||||||||||||||
Sbjct: 534 tgtttcttcccagtacccttatcaatagcagcaacagagagaataccattggcatcaata 475

                        
Query: 738 tcgaacttgactt 750
           || ||||||||||
Sbjct: 474 tcaaacttgactt 462



to top

>gb|AY104911.1| Zea mays PCO138533 mRNA sequence
          Length = 1751

 Score =  182 bits (92), Expect = 1e-42
 Identities = 317/392 (80%)
 Strand = Plus / Minus

                                                                        
Query: 359  gtagagggactgaccaagctgcatcacttcttggttcaacgcagctagtgcatcctttat 418
            |||||||| ||| || | |||||| ||||| ||||||||||||   |  || ||||| ||
Sbjct: 1387 gtagagggcctgcccgatctgcatgacttcctggttcaacgcactcatggcgtccttcat 1328

                                                                        
Query: 419  cgtctctgtcgatccaccagcaacagcgtcctggagttccttgagcttcccctccacctt 478
            |||||  || || |||||||||||||| |||| ||| || |  ||||||  ||| || ||
Sbjct: 1327 cgtctgcgtggagccaccagcaacagcatccttgagctcttgcagcttcgactcgacttt 1268

                                                                        
Query: 479  ctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtctggta 538
            | ||||||| || || ||||||||||| || || ||||||||||| ||||| ||||||||
Sbjct: 1267 ccccttgacgtcacctgggaccttgtcccctagttccttcagttgcttctcggtctggta 1208

                                                                        
Query: 539  gatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgc 598
            ||| || ||||| || ||||||||||||||||| ||||| | ||||||||||||||||  
Sbjct: 1207 gatgaccgactcggcttggttcttggtgtcaatggcgtctcgcttctccttgtcctcctt 1148

                                                                        
Query: 599  cgcaaatttttcagcttcttccaccatcttctctacctcatcctttggcagtgtgcttgc 658
             ||||| || ||||||||  | |||||| |||| ||||| ||||||||||| ||||| ||
Sbjct: 1147 tgcaaacttctcagcttcgccaaccatcctctccacctcgtcctttggcagagtgctagc 1088

                                                                        
Query: 659  tccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaacagacag 718
             ||||| ||||| || |||||||||||  | || ||||| ||||| |||   ||||| ||
Sbjct: 1087 accagtaattgtgatatcctgcttcttccctgtacccttgtccacagcactgacagagag 1028

                                            
Query: 719  aatgccattggcatcaatatcgaacttgactt 750
             || || || ||||||||||| ||||||||||
Sbjct: 1027 gataccgttagcatcaatatcaaacttgactt 996



to top

>gb|AY105690.1| Zea mays PCO065072 mRNA sequence
          Length = 1632

 Score =  180 bits (91), Expect = 4e-42
 Identities = 307/379 (81%)
 Strand = Plus / Minus

                                                                        
Query: 372  ccaagctgcatcacttcttggttcaacgcagctagtgcatcctttatcgtctctgtcgat 431
            |||| ||||||||| || |||||||  ||||| |  ||||| || ||  ||| ||| |||
Sbjct: 1233 ccaatctgcatcacctcctggttcagagcagccatggcatctttcatactctgtgttgat 1174

                                                                        
Query: 432  ccaccagcaacagcgtcctggagttccttgagcttcccctccaccttctccttgacatcg 491
            ||||||| ||  ||||| | ||| |||| ||||||| | ||||||||||| || |||   
Sbjct: 1173 ccaccagaaatggcgtctttgagctcctggagcttcacatccaccttctctttcacagga 1114

                                                                        
Query: 492  ccggggaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactct 551
             ||||||| ||||| ||||||||||||||||| |||||||||||||||| |||||| || 
Sbjct: 1113 gcggggactttgtcgccaagctccttcagttgcttctcagtctggtagaccacagaatcg 1054

                                                                        
Query: 552  gcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttca 611
            ||||| || || ||||| ||||| || |||||||| |||||||||   ||||| || || 
Sbjct: 1053 gcctgattttttgtgtcgattgcatctctcttctctttgtcctccttggcaaacttatcg 994

                                                                        
Query: 612  gcttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgta 671
            |||||||| |||||  |||| ||||||||||| || || || || || |||||||| || 
Sbjct: 993  gcttcttctaccattctctcaacctcatccttaggtagcgtactagcaccagtgatggtg 934

                                                                        
Query: 672  atgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggca 731
            |||||||| |||||| ||||||||||||| |  |||||||| || || || ||||| |||
Sbjct: 933  atgtcctgtttctttccagtgcccttatcaatggcagcaactgagaggataccatttgca 874

                               
Query: 732  tcaatatcgaacttgactt 750
            |||||||| ||||| ||||
Sbjct: 873  tcaatatcaaacttcactt 855



to top

>gb|BT018142.1| Zea mays clone EL01N0555B07.c mRNA sequence
          Length = 1284

 Score =  178 bits (90), Expect = 2e-41
 Identities = 303/374 (81%)
 Strand = Plus / Minus

                                                                       
Query: 377 ctgcatcacttcttggttcaacgcagctagtgcatcctttatcgtctctgtcgatccacc 436
           |||||| ||||| ||||||||||||  ||  |  ||||| || ||||  ||||| |||| 
Sbjct: 949 ctgcatgacttcctggttcaacgcacttatggggtccttcattgtctgcgtcgagccact 890

                                                                       
Query: 437 agcaacagcgtcctggagttccttgagcttcccctccaccttctccttgacatcgccggg 496
           ||||||||| |||| ||| || |  ||||||  ||| || ||| ||||||| || || ||
Sbjct: 889 agcaacagcatccttgagctcttgcagcttcgactcgactttccccttgacgtcacctgg 830

                                                                       
Query: 497 gaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctg 556
           ||||||||| ||||| ||||||||||| ||||| ||||||||||| || ||||| || ||
Sbjct: 829 gaccttgtccccaagttccttcagttgcttctcggtctggtagatgaccgactcggcttg 770

                                                                       
Query: 557 gttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttc 616
           ||||||||||||||| ||||| | ||||||||||||||||   ||||| || ||||||||
Sbjct: 769 gttcttggtgtcaatggcgtctcgcttctccttgtcctcctttgcaaacttctcagcttc 710

                                                                       
Query: 617 ttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtc 676
             | |||||| |||| ||||| ||||||||||| ||||| || ||||| ||||| || ||
Sbjct: 709 gccaaccatcctctccacctcgtcctttggcagagtgctagcaccagtaattgtgatatc 650

                                                                       
Query: 677 ctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaat 736
           |||||||||  | || ||||| ||||| |||   ||||| || || || || ||||||||
Sbjct: 649 ctgcttcttccctgtacccttgtccacagcactgacagagaggataccgttagcatcaat 590

                         
Query: 737 atcgaacttgactt 750
           ||| ||||||||||
Sbjct: 589 atcaaacttgactt 576



to top

>gb|BT016772.1| Zea mays clone Contig605 mRNA sequence
          Length = 1938

 Score =  163 bits (82), Expect = 1e-36
 Identities = 214/258 (82%)
 Strand = Plus / Minus

                                                                        
Query: 493  cggggaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctg 552
            ||||||| || || ||||||||||||||||| |||||||||||||||| |||||| || |
Sbjct: 1425 cggggactttatcgccaagctccttcagttgcttctcagtctggtagaccacagaatcgg 1366

                                                                        
Query: 553  cctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcag 612
            |||| || || ||||||||||| || |||||||| |||||||||   ||||| || || |
Sbjct: 1365 cctgattttttgtgtcaattgcatctctcttctctttgtcctccttggcaaacttatcgg 1306

                                                                        
Query: 613  cttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaa 672
            ||||||| |||||  |||| ||||||||||| || |  || || || |||||||| || |
Sbjct: 1305 cttcttctaccattctctcaacctcatccttaggtaacgtactagcaccagtgatggtga 1246

                                                                        
Query: 673  tgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcat 732
            ||||||| |||||| ||||||||||||| |  |||||||| || || || ||||| ||||
Sbjct: 1245 tgtcctgtttctttccagtgcccttatcaatggcagcaactgagagtatcccatttgcat 1186

                              
Query: 733  caatatcgaacttgactt 750
            ||||||| ||||| ||||
Sbjct: 1185 caatatcaaacttcactt 1168



to top

>gb|BT024111.1| Zea mays clone EL01N0516B01 mRNA sequence
          Length = 2060

 Score =  163 bits (82), Expect = 1e-36
 Identities = 214/258 (82%)
 Strand = Plus / Minus

                                                                        
Query: 493  cggggaccttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctg 552
            ||||||| || || ||||||||||||||||| |||||||||||||||| |||||| || |
Sbjct: 1589 cggggactttatcgccaagctccttcagttgcttctcagtctggtagaccacagaatcgg 1530

                                                                        
Query: 553  cctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcag 612
            |||| || || ||||||||||| || |||||||| |||||||||   ||||| || || |
Sbjct: 1529 cctgattttttgtgtcaattgcatctctcttctctttgtcctccttggcaaacttatcgg 1470

                                                                        
Query: 613  cttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaa 672
            ||||||| |||||  |||| ||||||||||| || |  || || || |||||||| || |
Sbjct: 1469 cttcttctaccattctctcaacctcatccttaggtaacgtactagcaccagtgatggtga 1410

                                                                        
Query: 673  tgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcat 732
            ||||||| |||||| ||||||||||||| |  |||||||| || || || ||||| ||||
Sbjct: 1409 tgtcctgtttctttccagtgcccttatcaatggcagcaactgagagtatcccatttgcat 1350

                              
Query: 733  caatatcgaacttgactt 750
            ||||||| ||||| ||||
Sbjct: 1349 caatatcaaacttcactt 1332



to top

>gb|AY224466.1| Oryza sativa (japonica cultivar-group) isolate 23949 heat
           shock-related protein mRNA, partial cds
          Length = 1257

 Score =  157 bits (79), Expect = 6e-35
 Identities = 214/255 (83%), Gaps = 3/255 (1%)
 Strand = Plus / Minus

                                                                       
Query: 498 accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
           |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 992 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 933

                                                                       
Query: 558 ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
           || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 932 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 873

                                                                       
Query: 618 tccaccatcttctctacctcatcctttggcagtgtgct-tgctccagtgattgtaatgtc 676
           ||||||||  |||| |||||||||||||||||||| ||  || || ||||| |  || ||
Sbjct: 872 tccaccattctctcaacctcatcctttggcagtgtactaagcgccggtgatggggatatc 813

                                                                       
Query: 677 ctgcttcttttcagtgcccttatccaccgcagcaacagacaga-atgccattggcatcaa 735
           ||| |||||  |||| |||||||| |  ||||||||||| ||| || |||||||||||||
Sbjct: 812 ctgtttcttcccagtacccttatcaatagcagcaacaga-agagataccattggcatcaa 754

                          
Query: 736 tatcgaacttgactt 750
           |||| ||||||||||
Sbjct: 753 tatcaaacttgactt 739



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                           
Query: 498     accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
               |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 7990287 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 7990228

                                                                           
Query: 558     ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
               || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 7990227 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 7990168

                       
Query: 618     tccaccat 625
               ||||||||
Sbjct: 7990167 tccaccat 7990160



 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                           
Query: 632     tacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagt 691
               ||||||||||||||||||||| || || || ||||| || || ||||| |||||  ||||
Sbjct: 7989697 tacctcatcctttggcagtgtactagcgccggtgatggtgatatcctgtttcttcccagt 7989638

                                                                          
Query: 692     gcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
                |||||||| |  ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 7989637 acccttatcaatagcagcaacagagagaataccattggcatcaatatcaaacttgactt 7989579



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                           
Query: 498     accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
               |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 7990168 accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 7990109

                                                                           
Query: 558     ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
               || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 7990108 tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 7990049

                       
Query: 618     tccaccat 625
               ||||||||
Sbjct: 7990048 tccaccat 7990041



 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                           
Query: 632     tacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagt 691
               ||||||||||||||||||||| || || || ||||| || || ||||| |||||  ||||
Sbjct: 7989578 tacctcatcctttggcagtgtactagcgccggtgatggtgatatcctgtttcttcccagt 7989519

                                                                          
Query: 692     gcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
                |||||||| |  ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 7989518 acccttatcaatagcagcaacagagagaataccattggcatcaatatcaaacttgactt 7989460



to top

>emb|AL831810.4|CNS08CAN Oryza sativa chromosome 12, . BAC OSJNBa0077B14 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 153111

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                         
Query: 498   accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
             |||||||| || |||||||||||||| |||||||||||||||| |||||| |||||||||
Sbjct: 9883  accttgtcacctagctccttcagttgcttctcagtctggtagaccacagagtctgcctgg 9942

                                                                         
Query: 558   ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
             || ||||| ||||| || || || ||||| |||||||||   ||||| || ||||| |||
Sbjct: 9943  tttttggtatcaatggcatctcttttctctttgtcctcctgagcaaacttgtcagcctct 10002

                     
Query: 618   tccaccat 625
             ||||||||
Sbjct: 10003 tccaccat 10010



 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                         
Query: 632   tacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagt 691
             ||||||||||||||||||||| || || || ||||| || || ||||| |||||  ||||
Sbjct: 10473 tacctcatcctttggcagtgtactagcgccggtgatggtgatatcctgtttcttcccagt 10532

                                                                        
Query: 692   gcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
              |||||||| |  ||||||||||| ||||| ||||||||||||||||| ||||||||||
Sbjct: 10533 acccttatcaatagcagcaacagagagaataccattggcatcaatatcaaacttgactt 10591



to top

>gb|DQ224261.1| Aquilegia pyrenaica putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1268

 Score =  109 bits (55), Expect = 1e-20
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                        
Query: 474  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
            |||||||||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1072 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1013

                                                                        
Query: 534  tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
            |||||||  ||||| ||||| |||||||| |||||||| || || ||||||||||| |||
Sbjct: 1012 tggtagacaacagaatctgcttggttctttgtgtcaatggcatctctcttctccttatcc 953

                                   
Query: 594  tccgccgcaaatttttcagcttc 616
            |||   |||||||| ||||||||
Sbjct: 952  tcctttgcaaatttctcagcttc 930



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 654 cttgctccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaaca 713
           ||||| ||||| || |||||||||||||||||| | || ||||| || |  ||||  |||
Sbjct: 172 cttgcgccagtaatagtaatgtcctgcttctttcctgtccccttgtcaagagcagtgaca 113

                                  
Query: 714 gacagaatgccattggcatcaat 736
           || ||||| ||||||||||||||
Sbjct: 112 gaaagaataccattggcatcaat 90



 Score = 48.1 bits (24), Expect = 0.042
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 363  agggactgaccaagctgcatcacttcttggtt 394
            |||||||||||||||||||| ||||| |||||
Sbjct: 1183 agggactgaccaagctgcattacttcctggtt 1152



to top

>gb|DQ224260.1| Aquilegia brevistyla putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1271

 Score =  109 bits (55), Expect = 1e-20
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                        
Query: 474  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
            |||||||||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1075 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1016

                                                                        
Query: 534  tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
            |||||||  ||||| ||||| |||||||| |||||||| || || ||||||||||| |||
Sbjct: 1015 tggtagacaacagaatctgcttggttctttgtgtcaatggcatctctcttctccttatcc 956

                                   
Query: 594  tccgccgcaaatttttcagcttc 616
            |||  |||||| || ||||||||
Sbjct: 955  tccttcgcaaacttctcagcttc 933



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 654 cttgctccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaaca 713
           ||||| ||||| || |||||||||||||||||| | || ||||| || |  |||| ||||
Sbjct: 172 cttgcgccagtaatagtaatgtcctgcttctttcctgtccccttgtcaagagcagtaaca 113

                                  
Query: 714 gacagaatgccattggcatcaat 736
           || ||||| ||||||||||||||
Sbjct: 112 gaaagaataccattggcatcaat 90



to top

>gb|DQ224258.1| Aquilegia formosa putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1271

 Score =  109 bits (55), Expect = 1e-20
 Identities = 121/143 (84%)
 Strand = Plus / Minus

                                                                        
Query: 474  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
            |||||||||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1075 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1016

                                                                        
Query: 534  tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
            |||||||  ||||| ||||| |||||||| |||||||| || || ||||||||||| |||
Sbjct: 1015 tggtagacaacagaatctgcttggttctttgtgtcaatggcatctctcttctccttatcc 956

                                   
Query: 594  tccgccgcaaatttttcagcttc 616
            |||  |||||| || ||||||||
Sbjct: 955  tccttcgcaaacttctcagcttc 933



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 654 cttgctccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaaca 713
           ||||| ||||| || |||||||||||||||||| | || ||||| || |  |||| ||||
Sbjct: 172 cttgcgccagtaatagtaatgtcctgcttctttcctgtccccttgtcaagagcagtaaca 113

                                  
Query: 714 gacagaatgccattggcatcaat 736
           || ||||| ||||||||||||||
Sbjct: 112 gaaagaataccattggcatcaat 90



to top

>gb|DQ224263.1| Semiaquilegia adoxoides putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1268

 Score =  101 bits (51), Expect = 3e-18
 Identities = 120/143 (83%)
 Strand = Plus / Minus

                                                                        
Query: 474  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
            |||||||||||||| ||  | |||||||||||||| |||||||| || || ||||| |||
Sbjct: 1072 accttctccttgacttcagcagggaccttgtctcccagctccttgagctgcttctccgtc 1013

                                                                        
Query: 534  tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
            |||||||  ||||| ||||| || ||||| |||||||| || || ||||||||||| |||
Sbjct: 1012 tggtagacaacagaatctgcttgattctttgtgtcaatggcatctctcttctccttatcc 953

                                   
Query: 594  tccgccgcaaatttttcagcttc 616
            |||   |||||||| ||||||||
Sbjct: 952  tcctttgcaaatttctcagcttc 930



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 654 cttgctccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaaca 713
           ||||| ||||| || |||||||||||||||||| | || ||||| || |  |||| ||||
Sbjct: 172 cttgcaccagtaatagtaatgtcctgcttctttcctgtccccttgtcaagagcagtaaca 113

                                  
Query: 714 gacagaatgccattggcatcaat 736
           || ||||| ||||||||||||||
Sbjct: 112 gaaagaataccattggcatcaat 90



to top

>gb|DQ224262.1| Aquilegia olympica putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1269

 Score =  101 bits (51), Expect = 3e-18
 Identities = 120/143 (83%)
 Strand = Plus / Minus

                                                                        
Query: 474  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
            ||||| |||||||||||  | |||||||||||||| | |||||| || || ||||| |||
Sbjct: 1073 accttttccttgacatcagcagggaccttgtctcccaactccttgagctgcttctccgtc 1014

                                                                        
Query: 534  tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
            |||||||  ||||| ||||| |||||||| |||||||| || || ||||||||||| |||
Sbjct: 1013 tggtagacaacagaatctgcttggttctttgtgtcaatggcatctctcttctccttatcc 954

                                   
Query: 594  tccgccgcaaatttttcagcttc 616
            |||   |||||||| ||||||||
Sbjct: 953  tcctttgcaaatttctcagcttc 931



 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 654 cttgctccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaaca 713
           ||||| ||||| || |||||||||||||||||| | || ||||| || |  ||||  |||
Sbjct: 172 cttgcgccagtaatagtaatgtcctgcttctttcccgtccccttgtcaagagcagtgaca 113

                                  
Query: 714 gacagaatgccattggcatcaat 736
           || ||||| ||||||||||||||
Sbjct: 112 gaaagaataccattggcatcaat 90



to top

>gb|DQ224259.1| Aquilegia chrysantha putative heat shock protein 70 (hsp70) gene,
            partial cds
          Length = 1271

 Score =  101 bits (51), Expect = 3e-18
 Identities = 120/143 (83%)
 Strand = Plus / Minus

                                                                        
Query: 474  accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
            |||||||||||||||||  | |||||||||||||| | |||||| || || || || |||
Sbjct: 1075 accttctccttgacatcagcagggaccttgtctcccaactccttgagctgcttttccgtc 1016

                                                                        
Query: 534  tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
            |||||||  ||||| ||||| |||||||| |||||||| || || ||||||||||| |||
Sbjct: 1015 tggtagacaacagaatctgcttggttctttgtgtcaatagcatctctcttctccttatcc 956

                                   
Query: 594  tccgccgcaaatttttcagcttc 616
            |||  |||||| || ||||||||
Sbjct: 955  tccttcgcaaacttctcagcttc 933



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 654 cttgctccagtgattgtaatgtcctgcttcttttcagtgcccttatccaccgcagcaaca 713
           ||||| ||||| || |||||||||||||||||| | || ||||| || |  |||| ||||
Sbjct: 172 cttgcgccagtaatagtaatgtcctgcttctttcctgtccccttgtcaagagcagtaaca 113

                                  
Query: 714 gacagaatgccattggcatcaat 736
           || ||||| ||||||||||||||
Sbjct: 112 gaaagaataccattggcatcaat 90



to top

>emb|X69213.1|PSST70 P.sativum Psst70 gene for heat-shock protein
          Length = 4974

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 471  tccaccttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctca 530
            ||||||||||| || |||  | |||| || || ||||| ||||| |||| ||| ||||||
Sbjct: 3494 tccaccttctctttaacaggggcgggaactttctctcctagctctttcaattgcttctca 3435

                                                                        
Query: 531  gtctggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttg 590
            ||||||||||  ||||| |||||||||||||||||||| ||||| |||||||| || |||
Sbjct: 3434 gtctggtagacaacagagtctgcctggttcttggtgtcgattgcttccctcttttctttg 3375

                 
Query: 591  tcctc 595
            |||||
Sbjct: 3374 tcctc 3370



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||||||||||||||| ||||| |||||
Sbjct: 3599 gactgaccaagctgcataacttcctggtt 3571



to top

>gb|L03299.1|PEA70HSP Pisum sativum chloroplast stromal 70 kDa heat shock protein (hsp70)
            mRNA, complete cds
          Length = 2474

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 471  tccaccttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctca 530
            ||||||||||| || |||  | |||| || || ||||| ||||| |||| ||| ||||||
Sbjct: 1925 tccaccttctctttaacaggggcgggaactttctctcctagctctttcaattgcttctca 1866

                                                                        
Query: 531  gtctggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttg 590
            ||||||||||  ||||| |||||||||||||||||||| ||||| |||||||| || |||
Sbjct: 1865 gtctggtagacaacagagtctgcctggttcttggtgtcgattgcttccctcttttctttg 1806

                 
Query: 591  tcctc 595
            |||||
Sbjct: 1805 tcctc 1801



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||||||||||||||| ||||| |||||
Sbjct: 2030 gactgaccaagctgcataacttcctggtt 2002



to top

>ref|NM_118561.2| Arabidopsis thaliana CPHSC70-1; ATP binding AT4G24280 (CPHSC70-1)
            mRNA, complete cds
          Length = 2456

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 188/235 (80%)
 Strand = Plus / Minus

                                                                        
Query: 516  ttcagttgtttctcagtctggtagatcacagactctgcctggttcttggtgtcaattgcg 575
            |||||||| ||||| |||||||| | ||| || ||||| ||||| || ||||| ||||||
Sbjct: 1971 ttcagttgcttctctgtctggtacaccactgaatctgcttggtttttcgtgtcgattgcg 1912

                                                                        
Query: 576  tccctcttctccttgtcctccgccgcaaatttttcagcttcttccaccatcttctctacc 635
            || |||||||| ||||| ||    |||||| |||| || || |  ||||| |  ||||||
Sbjct: 1911 tctctcttctctttgtcatcttttgcaaatctttctgcctcctggaccatttggtctacc 1852

                                                                        
Query: 636  tcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagtgccc 695
            |||||||| |||| ||| ||||| ||||| || || ||||| ||||||||| | ||||||
Sbjct: 1851 tcatccttgggcaatgtacttgcgccagtaatggtgatgtcttgcttctttcctgtgccc 1792

                                                                   
Query: 696  ttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
            || || || |||   ||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1791 ttgtcaacagcactgacagatagaattccattggcatcaatgtcaaatttgactt 1737



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            |||||||||| ||||||||||||||||||
Sbjct: 2121 gactgaccaatctgcatcacttcttggtt 2093



to top

>gb|AY072138.1| Arabidopsis thaliana putative hsp 70 protein (At4g24280) mRNA,
            complete cds
          Length = 2495

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 188/235 (80%)
 Strand = Plus / Minus

                                                                        
Query: 516  ttcagttgtttctcagtctggtagatcacagactctgcctggttcttggtgtcaattgcg 575
            |||||||| ||||| |||||||| | ||| || ||||| ||||| || ||||| ||||||
Sbjct: 1972 ttcagttgcttctctgtctggtacaccactgaatctgcttggtttttcgtgtcgattgcg 1913

                                                                        
Query: 576  tccctcttctccttgtcctccgccgcaaatttttcagcttcttccaccatcttctctacc 635
            || |||||||| ||||| ||    |||||| |||| || || |  ||||| |  ||||||
Sbjct: 1912 tctctcttctctttgtcatcttttgcaaatctttctgcctcctggaccatttggtctacc 1853

                                                                        
Query: 636  tcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagtgccc 695
            |||||||| |||| ||| ||||| ||||| || || ||||| ||||||||| | ||||||
Sbjct: 1852 tcatccttgggcaatgtacttgcgccagtaatggtgatgtcttgcttctttcctgtgccc 1793

                                                                   
Query: 696  ttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
            || || || |||   ||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1792 ttgtcaacagcactgacagatagaattccattggcatcaatgtcaaatttgactt 1738



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            |||||||||| ||||||||||||||||||
Sbjct: 2122 gactgaccaatctgcatcacttcttggtt 2094



to top

>gb|BT001950.1| Arabidopsis thaliana clone U19959 putative hsp 70 protein (At4g24280)
            mRNA, complete cds
          Length = 2188

 Score = 93.7 bits (47), Expect = 8e-16
 Identities = 188/235 (80%)
 Strand = Plus / Minus

                                                                        
Query: 516  ttcagttgtttctcagtctggtagatcacagactctgcctggttcttggtgtcaattgcg 575
            |||||||| ||||| |||||||| | ||| || ||||| ||||| || ||||| ||||||
Sbjct: 1865 ttcagttgcttctctgtctggtacaccactgaatctgcttggtttttcgtgtcgattgcg 1806

                                                                        
Query: 576  tccctcttctccttgtcctccgccgcaaatttttcagcttcttccaccatcttctctacc 635
            || |||||||| ||||| ||    |||||| |||| || || |  ||||| |  ||||||
Sbjct: 1805 tctctcttctctttgtcatcttttgcaaatctttctgcctcctggaccatttggtctacc 1746

                                                                        
Query: 636  tcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagtgccc 695
            |||||||| |||| ||| ||||| ||||| || || ||||| ||||||||| | ||||||
Sbjct: 1745 tcatccttgggcaatgtacttgcgccagtaatggtgatgtcttgcttctttcctgtgccc 1686

                                                                   
Query: 696  ttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
            || || || |||   ||||| ||||| |||||||||||||| || || |||||||
Sbjct: 1685 ttgtcaacagcactgacagatagaattccattggcatcaatgtcaaatttgactt 1631



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            |||||||||| ||||||||||||||||||
Sbjct: 2015 gactgaccaatctgcatcacttcttggtt 1987



to top

>gb|DQ224254.1| Aquilegia formosa heak shock protein 70 (HSP70) mRNA, partial cds
          Length = 548

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 169/212 (79%)
 Strand = Plus / Minus

                                                                       
Query: 474 accttctccttgacatcgccggggaccttgtctccaagctccttcagttgtttctcagtc 533
           ||||||||||| ||| |  | || ||||| ||||| | |||||| ||||||||||| |||
Sbjct: 352 accttctccttcacagcagcaggtaccttttctcccaactccttgagttgtttctctgtc 293

                                                                       
Query: 534 tggtagatcacagactctgcctggttcttggtgtcaattgcgtccctcttctccttgtcc 593
           |||||||  ||||| || || |||||||| |||||||| || || |||||||||||||||
Sbjct: 292 tggtagacaacagaatcggcttggttctttgtgtcaatggcatctctcttctccttgtcc 233

                                                                       
Query: 594 tccgccgcaaatttttcagcttcttccaccatcttctctacctcatcctttggcagtgtg 653
           |||   ||||| || |||| ||| |  |||||  |||| ||||||||  | || || || 
Sbjct: 232 tccttggcaaanttntcagnttcgttaaccattctctccacctcatcgctaggaagagta 173

                                           
Query: 654 cttgctccagtgattgtaatgtcctgcttctt 685
           ||||| ||||| || || ||||| ||||||||
Sbjct: 172 cttgcgccagtaatagtgatgtcntgcttctt 141



 Score = 48.1 bits (24), Expect = 0.042
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 363 agggactgaccaagctgcatcacttcttggtt 394
           |||||||||||||||||||| ||||| |||||
Sbjct: 463 agggactgaccaagctgcattacttcctggtt 432



to top

>gb|AC140550.31| Medicago truncatula clone mth2-54a24, complete sequence
          Length = 129388

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                         
Query: 498   accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
             ||||| ||||| ||||| |||| ||| || |||||||||||||  ||||| || ||||| 
Sbjct: 28897 accttttctcctagctctttcaattgcttttcagtctggtagacaacagagtccgcctga 28838

                                                    
Query: 558   ttcttggtgtcaattgcgtccctcttctccttgtcctcc 596
             ||||| ||||| ||||| |||||||||||||||||||||
Sbjct: 28837 ttctttgtgtctattgcatccctcttctccttgtcctcc 28799



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                           
Query: 705   gcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
             |||||||| |||||||||||||| |||||||| |||||||| ||||
Sbjct: 28549 gcagcaactgacagaatgccatttgcatcaatgtcgaacttcactt 28504



to top

>gb|U92815.1|CLU92815 Citrullus lanatus heat shock protein 70 precursor mRNA, complete cds
          Length = 2430

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                        
Query: 498  accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
            |||||||||||||||||||||||||| ||||| ||||| || |  ||||| || || |||
Sbjct: 1898 accttgtctccaagctccttcagttgcttctctgtctgatacacaacagaatcagcttgg 1839

                                                   
Query: 558  ttcttggtgtcaattgcgtccctcttctccttgtcctcc 596
            ||||| ||||| || || || ||||||||||||||||||
Sbjct: 1838 ttcttcgtgtcgatagcatctctcttctccttgtcctcc 1800



to top

>emb|X73961.1|CSHSP70 C.sativus mRNA for heat shock protein 70 (hsp70)
          Length = 2511

 Score = 83.8 bits (42), Expect = 8e-13
 Identities = 198/250 (79%)
 Strand = Plus / Minus

                                                                        
Query: 501  ttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctggttc 560
            ||||||||||||||||||||||| ||||| ||||| || |  ||||| || |||||||||
Sbjct: 1959 ttgtctccaagctccttcagttgcttctctgtctgatacacaacagaatcagcctggttc 1900

                                                                        
Query: 561  ttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttcttcc 620
            || || || || || || ||||||||||||||||||   ||||| || ||||||||    
Sbjct: 1899 ttcgtatcgatggcatctctcttctccttgtcctccttggcaaacttatcagcttcgcta 1840

                                                                        
Query: 621  accatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgc 680
            ||||||  ||| ||||||||  | |||| |||||| || ||||| || || || || |||
Sbjct: 1839 accatccgctccacctcatcactaggcaatgtgctagcaccagtaatggtgatatcttgc 1780

                                                                        
Query: 681  ttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatcg 740
            |||||  ||| ||| || || |  |||| ||| || || || ||||||||||| ||||||
Sbjct: 1779 ttcttgccagagcctttgtcaattgcagtaaccgagaggattccattggcatcgatatcg 1720

                      
Query: 741  aacttgactt 750
            || |||||||
Sbjct: 1719 aatttgactt 1710



to top

>emb|AL078637.1|ATT22A6 Arabidopsis thaliana DNA chromosome 4, BAC clone T22A6 (ESSA project)
          Length = 108459

 Score = 67.9 bits (34), Expect = 5e-08
 Identities = 97/118 (82%)
 Strand = Plus / Minus

                                                                         
Query: 633   acctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagtg 692
             ||||||||||| |||| ||| ||||| ||||| || || ||||| ||||||||| | |||
Sbjct: 43825 acctcatccttgggcaatgtacttgcgccagtaatggtgatgtcttgcttctttcctgtg 43766

                                                                       
Query: 693   cccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
             ||||| || || |||   ||||| ||||| |||||||||||||| || || |||||||
Sbjct: 43765 cccttgtcaacagcactgacagatagaattccattggcatcaatgtcaaatttgactt 43708



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 366   gactgaccaagctgcatcacttcttggtt 394
             |||||||||| ||||||||||||||||||
Sbjct: 44346 gactgaccaatctgcatcacttcttggtt 44318



to top

>emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 61
          Length = 198402

 Score = 67.9 bits (34), Expect = 5e-08
 Identities = 97/118 (82%)
 Strand = Plus / Minus

                                                                         
Query: 633   acctcatcctttggcagtgtgcttgctccagtgattgtaatgtcctgcttcttttcagtg 692
             ||||||||||| |||| ||| ||||| ||||| || || ||||| ||||||||| | |||
Sbjct: 60482 acctcatccttgggcaatgtacttgcgccagtaatggtgatgtcttgcttctttcctgtg 60423

                                                                       
Query: 693   cccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaacttgactt 750
             ||||| || || |||   ||||| ||||| |||||||||||||| || || |||||||
Sbjct: 60422 cccttgtcaacagcactgacagatagaattccattggcatcaatgtcaaatttgactt 60365



 Score = 50.1 bits (25), Expect = 0.011
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 366   gactgaccaagctgcatcacttcttggtt 394
             |||||||||| ||||||||||||||||||
Sbjct: 61003 gactgaccaatctgcatcacttcttggtt 60975



to top

>dbj|AB181295.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, clone:NbHsp70cp-1
          Length = 741

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 160/203 (78%)
 Strand = Plus / Minus

                                                                       
Query: 498 accttgtctccaagctccttcagttgtttctcagtctggtagatcacagactctgcctgg 557
           ||||||||||| | ||| || || || |||||||| || || |  ||||| || || |||
Sbjct: 455 accttgtctcccaactcttttagctgcttctcagtttgatatacaacagattcggcttgg 396

                                                                       
Query: 558 ttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttcagcttct 617
           ||||| ||||||||||  ||||||||||||||||||||    ||||| || |||||||| 
Sbjct: 395 ttctttgtgtcaattgaatccctcttctccttgtcctctttagcaaacttctcagcttcc 336

                                                                       
Query: 618 tccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgtaatgtcc 677
           |  |||||  | || |||||||| || ||||  || || || || || || |||||||||
Sbjct: 335 tgaaccattctatcaacctcatctttcggcaaagtactagcaccggttatagtaatgtcc 276

                                  
Query: 678 tgcttcttttcagtgcccttatc 700
           ||||||||| | || ||||||||
Sbjct: 275 tgcttctttccggtacccttatc 253



 Score = 52.0 bits (26), Expect = 0.003
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 366 gactgaccaagctgcatcacttcttggttcaacgcagc 403
           ||||| || |||||||| ||||||||||||||||||||
Sbjct: 587 gactgtcccagctgcatgacttcttggttcaacgcagc 550



to top

>ref|NM_124369.2| Arabidopsis thaliana cpHSC70-2 (HEAT SHOCK PROTEIN 70-7); ATP binding
            AT5G49910 (cpHSC70-2) mRNA, complete cds
          Length = 2731

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 155/197 (78%)
 Strand = Plus / Minus

                                                                        
Query: 552  gcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttca 611
            ||||||||||| |||||||| || || ||||| || ||||| |||   |||||  | || 
Sbjct: 1885 gcctggttctttgtgtcaatcgcatctctcttttctttgtcttcctttgcaaacctctct 1826

                                                                        
Query: 612  gcttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgta 671
            ||||||| ||||||  | ||||||||||||||||| |  || || || ||||| || || 
Sbjct: 1825 gcttcttgcaccattgtgtctacctcatcctttggtaaggtactagcaccagtaatggtg 1766

                                                                        
Query: 672  atgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggca 731
            ||||||||||||||| | || || || |||   |||   ||||| ||||| |||||||||
Sbjct: 1765 atgtcctgcttctttcctgtacctttgtccgaagcactgacagatagaattccattggca 1706

                             
Query: 732  tcaatatcgaacttgac 748
            ||||| ||||| |||||
Sbjct: 1705 tcaatgtcgaatttgac 1689



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||| |||| ||||||||||||||||||
Sbjct: 2071 gactggccaatctgcatcacttcttggtt 2043



to top

>gb|BT000919.1| Arabidopsis thaliana clone C105236 putative heat shock protein 70
            (At5g49910) mRNA, complete cds
          Length = 2187

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 155/197 (78%)
 Strand = Plus / Minus

                                                                        
Query: 552  gcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttca 611
            ||||||||||| |||||||| || || ||||| || ||||| |||   |||||  | || 
Sbjct: 1829 gcctggttctttgtgtcaatcgcatctctcttttctttgtcttcctttgcaaacctctct 1770

                                                                        
Query: 612  gcttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgta 671
            ||||||| ||||||  | ||||||||||||||||| |  || || || ||||| || || 
Sbjct: 1769 gcttcttgcaccattgtgtctacctcatcctttggtaaggtactagcaccagtaatggtg 1710

                                                                        
Query: 672  atgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggca 731
            ||||||||||||||| | || || || |||   |||   ||||| ||||| |||||||||
Sbjct: 1709 atgtcctgcttctttcctgtacctttgtccgaagcactgacagatagaattccattggca 1650

                             
Query: 732  tcaatatcgaacttgac 748
            ||||| ||||| |||||
Sbjct: 1649 tcaatgtcgaatttgac 1633



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||| |||| ||||||||||||||||||
Sbjct: 2015 gactggccaatctgcatcacttcttggtt 1987



to top

>gb|AY080761.1| Arabidopsis thaliana At5g49910 mRNA sequence
          Length = 2331

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 155/197 (78%)
 Strand = Plus / Minus

                                                                        
Query: 552  gcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttca 611
            ||||||||||| |||||||| || || ||||| || ||||| |||   |||||  | || 
Sbjct: 1885 gcctggttctttgtgtcaatcgcatctctcttttctttgtcttcctttgcaaacctctct 1826

                                                                        
Query: 612  gcttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgta 671
            ||||||| ||||||  | ||||||||||||||||| |  || || || ||||| || || 
Sbjct: 1825 gcttcttgcaccattgtgtctacctcatcctttggtaaggtactagcaccagtaatggtg 1766

                                                                        
Query: 672  atgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggca 731
            ||||||||||||||| | || || || |||   |||   ||||| ||||| |||||||||
Sbjct: 1765 atgtcctgcttctttcctgtacctttgtccgaagcactgacagatagaattccattggca 1706

                             
Query: 732  tcaatatcgaacttgac 748
            ||||| ||||| |||||
Sbjct: 1705 tcaatgtcgaatttgac 1689



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||| |||| ||||||||||||||||||
Sbjct: 2071 gactggccaatctgcatcacttcttggtt 2043



to top

>emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognate 70
          Length = 2120

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 688  cagtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaa 742
            |||||| ||||||||| ||||  |||  ||| |||||||||||||||||||||||
Sbjct: 1532 cagtgctcttatccacagcagacacattcaggatgccattggcatcaatatcgaa 1478



to top

>gb|AY072744.1| Dunaliella salina heat shock protein 70B (hsp70B) mRNA, complete cds
          Length = 2732

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 518  cagttgtttctcagtctggtagatcacagactctgcctggttcttggtgtc 568
            |||||| || ||||||||||||||||    |||||||||||||||||||||
Sbjct: 1776 cagttgcttttcagtctggtagatcatgctctctgcctggttcttggtgtc 1726



 Score = 46.1 bits (23), Expect = 0.17
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 711  acagacagaatgccattggcatcaatatcgaactt 745
            |||||||| ||||| |||||||||||||| |||||
Sbjct: 1583 acagacaggatgccgttggcatcaatatcaaactt 1549



to top

>gb|AF217459.1|AF217459 Arabidopsis thaliana heat shock protein 70 (Hsc70-7) mRNA, complete
            cds; nuclear gene for chloroplast product
          Length = 2157

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 108/135 (80%)
 Strand = Plus / Minus

                                                                        
Query: 552  gcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttca 611
            ||||||||||| |||||||| || || ||||| || ||||| |||   |||||  | || 
Sbjct: 1829 gcctggttctttgtgtcaatcgcatctctcttttctttgtcttcctttgcaaacctctct 1770

                                                                        
Query: 612  gcttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgta 671
            ||||||| ||||||  | ||||||||||||||||| |  || || || ||||| || || 
Sbjct: 1769 gcttcttgcaccattgtgtctacctcatcctttggtaaggtactagcaccagtaatggtg 1710

                           
Query: 672  atgtcctgcttcttt 686
            |||||||||||||||
Sbjct: 1709 atgtcctgcttcttt 1695



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||| |||| ||||||||||||||||||
Sbjct: 2015 gactggccaatctgcatcacttcttggtt 1987



to top

>ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA
          Length = 2120

 Score = 54.0 bits (27), Expect = 7e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 688  cagtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatcgaa 742
            |||||| ||||||||| ||||  |||  ||| |||||||||||||||||||||||
Sbjct: 1532 cagtgctcttatccacagcagacacattcaggatgccattggcatcaatatcgaa 1478



to top

>gb|AY081331.1| Arabidopsis thaliana heat shock protein 70 (At5g49910) mRNA, complete
            cds
          Length = 1925

 Score = 50.1 bits (25), Expect = 0.011
 Identities = 109/137 (79%)
 Strand = Plus / Minus

                                                                        
Query: 612  gcttcttccaccatcttctctacctcatcctttggcagtgtgcttgctccagtgattgta 671
            ||||||| ||||||  | ||||||||||||||||| |  || || || ||||| || || 
Sbjct: 1905 gcttcttgcaccattgtgtctacctcatcctttggtaaggtactagcaccagtaatggtg 1846

                                                                        
Query: 672  atgtcctgcttcttttcagtgcccttatccaccgcagcaacagacagaatgccattggca 731
            ||||||||||||||| | || || || |||   |||   ||||| ||||| |||||||||
Sbjct: 1845 atgtcctgcttctttcctgtacctttgtccgaagcactgacagatagaattccattggca 1786

                             
Query: 732  tcaatatcgaacttgac 748
            ||||| ||||| |||||
Sbjct: 1785 tcaatgtcgaatttgac 1769



to top

>dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock protein, complete cds
          Length = 2269

 Score = 48.1 bits (24), Expect = 0.042
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 688  cagtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatc 739
            |||||| ||||||||| ||||  |||  ||| ||||||||||||||||||||
Sbjct: 1612 cagtgctcttatccacagcagacacattcaggatgccattggcatcaatatc 1561



to top

>gb|AF502513.1| Isurus oxyrinchus isolate Isox10 Hsp70 pseudogene, partial sequence
          Length = 681

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 720 atgccattggcatcaatatcgaa 742
           |||||||||||||||||||||||
Sbjct: 632 atgccattggcatcaatatcgaa 610



to top

>gb|AF502437.1| Carcharias taurus isolate Cata2 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 720  atgccattggcatcaatatcgaa 742
            |||||||||||||||||||||||
Sbjct: 1337 atgccattggcatcaatatcgaa 1315



to top

>gb|AF502436.1| Carcharias taurus isolate Cata1 Hsp70 protein (Hsp70) gene, partial
            cds
          Length = 1386

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 720  atgccattggcatcaatatcgaa 742
            |||||||||||||||||||||||
Sbjct: 1337 atgccattggcatcaatatcgaa 1315



to top

>gb|AF427596.1|AF427596 Artemia franciscana 70 kDa heat shock protein (HSP70) mRNA, complete
            cds
          Length = 2081

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 720  atgccattggcatcaatatcgaa 742
            |||||||||||||||||||||||
Sbjct: 1497 atgccattggcatcaatatcgaa 1475



to top

>gb|AF035457.1|AF035457 Spinacia oleracea heat shock 70 protein (HSC70-10) mRNA, nuclear gene
            encoding mitochondrial protein, complete cds
          Length = 2419

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 705  gcagcaacagacagaatgccattggcatcaatatc 739
            |||| ||||| || |||||||||||||||||||||
Sbjct: 1755 gcagaaacagtcacaatgccattggcatcaatatc 1721



to top

>emb|AL034399.6|HS191P20 Human DNA sequence from clone RP6-191P20 on chromosome Xq23 Contains
             the TEX13B gene for testis expressed sequence 13B, a novel
             pseudogene, the 3' end of the MID2 gene for midline 2
             (FXY2, RNF60, TRIM1), a novel  gene and a CpG island,
             complete sequence
          Length = 118456

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 511   gctccttcagttgtttctcagtctggt 537
             |||||||||||||| ||||||||||||
Sbjct: 24846 gctccttcagttgtgtctcagtctggt 24820



to top

>emb|AL137065.10| Human DNA sequence from clone RP11-4P13 on chromosome Xq22.1-23,
             complete sequence
          Length = 119311

 Score = 46.1 bits (23), Expect = 0.17
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 511   gctccttcagttgtttctcagtctggt 537
             |||||||||||||| ||||||||||||
Sbjct: 51509 gctccttcagttgtgtctcagtctggt 51535



to top

>gb|BC105182.1| Bos taurus heat shock 70 kDa protein 8, mRNA (cDNA clone MGC:128130
            IMAGE:7950124), complete cds
          Length = 2273

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 690  gtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatc 739
            |||| ||||||||| |||| ||||   || ||||||||||||||||||||
Sbjct: 1560 gtgctcttatccacagcagaaacattgaggatgccattggcatcaatatc 1511



to top

>gb|AC074052.6| Homo sapiens chromosome 16 clone RP11-483K5, complete sequence
          Length = 188458

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 609    tcagcttcttccaccatcttct 630
              ||||||||||||||||||||||
Sbjct: 166482 tcagcttcttccaccatcttct 166503



to top

>gb|AC137777.3| Homo sapiens chromosome 16 clone LA16c-500E3, complete sequence
          Length = 37346

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 609   tcagcttcttccaccatcttct 630
             ||||||||||||||||||||||
Sbjct: 29199 tcagcttcttccaccatcttct 29178



to top

>dbj|AB024032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9P8
          Length = 70670

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 711   acagacagaatgccattggcatcaatatcgaacttgac 748
             ||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 35672 acagatagaattccattggcatcaatgtcgaatttgac 35635



 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 366   gactgaccaagctgcatcacttcttggtt 394
             ||||| |||| ||||||||||||||||||
Sbjct: 36113 gactggccaatctgcatcacttcttggtt 36085



to top

>ref|NM_174345.3| Bos taurus heat shock 70 kDa protein 8 (HSPA8), mRNA
          Length = 2273

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 690  gtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatc 739
            |||| ||||||||| |||| ||||   || ||||||||||||||||||||
Sbjct: 1560 gtgctcttatccacagcagaaacattgaggatgccattggcatcaatatc 1511



to top

>emb|X53827.1|BTHSCP Bovine mRNA for 7O KDa heat shock cognate protein
          Length = 2046

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 690  gtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatc 739
            |||| ||||||||| |||| ||||   || ||||||||||||||||||||
Sbjct: 1518 gtgctcttatccacagcagaaacattgaggatgccattggcatcaatatc 1469



to top

>emb|X53335.1|BT70HSP Bovine mRNA for a 70 Kd heat shock cognate protein
          Length = 1953

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 690  gtgcccttatccaccgcagcaacagacagaatgccattggcatcaatatc 739
            |||| ||||||||| |||| ||||   || ||||||||||||||||||||
Sbjct: 1484 gtgctcttatccacagcagaaacattgaggatgccattggcatcaatatc 1435



to top

>ref|NM_124370.3| Arabidopsis thaliana unknown protein AT5G49920 mRNA, complete cds
          Length = 1876

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 366  gactgaccaagctgcatcacttcttggtt 394
            ||||| |||| ||||||||||||||||||
Sbjct: 1711 gactggccaatctgcatcacttcttggtt 1739



to top

>gb|AY766104.1| Dengue virus type 3 strain Singapore 8120/95, complete genome
          Length = 10696

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY665402.1| Dengue virus type 3 polyprotein gene, partial cds
          Length = 1923

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 620 cttgtctccaagctccttcag 600



to top

>gb|AY632355.1| Dengue virus type 3 isolate AM2394 from Brazil polyprotein gene,
           partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY662691.1| Dengue virus type 3 from Singapore, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY099336.1| Dengue virus type 3 isolate D3/H/IMTSSA-SRI/2000/1266, complete
           genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AF547260.1| Dengue virus type 3 612210 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547242.1| Dengue virus type 3 L57 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547241.1| Dengue virus type 3 073 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547240.1| Dengue virus type 3 SOM079 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547239.1| Dengue virus type 3 251991 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547238.1| Dengue virus type 3 1559 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547237.1| Dengue virus type 3 1558 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547236.1| Dengue virus type 3 1557 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547235.1| Dengue virus type 3 D9397 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547234.1| Dengue virus type 3 D5231 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547233.1| Dengue virus type 3 D3197 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547232.1| Dengue virus type 3 D2803 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547231.1| Dengue virus type 3 D2863 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547230.1| Dengue virus type 3 D2783 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547229.1| Dengue virus type 3 D1440 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547228.1| Dengue virus type 3 D1336 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547227.1| Dengue virus type 3 D1307 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547226.1| Dengue virus type 3 D1306 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>gb|AF547225.1| Dengue virus type 3 D1266 polyprotein gene, partial cds
          Length = 963

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 616 cttgtctccaagctccttcag 596



to top

>emb|AL732556.7| Mouse DNA sequence from clone RP24-144L11 on chromosome 4 Contains the
             Tnc gene for tenascin C, the 5' end of a novel gene and a
             novel gene, complete sequence
          Length = 148021

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 613   cttcttccaccatcttctctacctc 637
             |||||||||||||||||||| ||||
Sbjct: 36443 cttcttccaccatcttctctccctc 36419



to top

>emb|AJ271605.2|DSA271605 Dunaliella salina mRNA for chloroplast-localised heat shock protein
            (hsp70B gene)
          Length = 2764

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 525  ttctcagtctggtagatcacagactctgcctggttcttggt 565
            ||||| |||||||||||||    ||||||||||||||||||
Sbjct: 1825 ttctccgtctggtagatcatgctctctgcctggttcttggt 1785



to top

>gb|AC154913.4| Ornithorhynchus anatinus BAC clone OABb-535A1 from chromosome unknown,
              complete sequence
          Length = 199332

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 315    ccgtcagctccagctccaggg 335
              |||||||||||||||||||||
Sbjct: 144619 ccgtcagctccagctccaggg 144639



to top

>gb|DQ401695.1| Dengue virus type 3 isolate mutant PhMH-J1-97, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401694.1| Dengue virus type 3 isolate mutant InJ-I6-82, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401693.1| Dengue virus type 3 isolate mutant BDH02-07, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401692.1| Dengue virus type 3 isolate mutant BDH02-04, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401691.1| Dengue virus type 3 isolate mutant BDH02-03, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401690.1| Dengue virus type 3 isolate InJ-16-82, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|DQ401689.1| Dengue virus type 3 isolate mutant BDH02-01, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496878.1| Dengue virus type 3 isolate BDH02-8 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496876.1| Dengue virus type 3 isolate BDH02-6 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496875.1| Dengue virus type 3 isolate BDH02-5 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496872.1| Dengue virus type 3 isolate BDH02-2 polyprotein gene, partial cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY496871.2| Dengue virus type 3 isolate BDH02-1, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496873.2| Dengue virus type 3 isolate BDH02-3, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496874.2| Dengue virus type 3 isolate BDH02-4, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496877.2| Dengue virus type 3 isolate BDH02-7, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY496879.2| Dengue virus type 3 isolate PhMH-J1-97, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214882.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL129NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214881.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL109NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214880.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL029NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB214879.1| Dengue virus type 3 genomic RNA, neally complete genome,
           strain:D3/Hu/TL018NIID/2005
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY960633.1| Dengue virus type 3 isolate RGN576 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY960632.1| Dengue virus type 3 isolate MTO3103 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY960629.1| Dengue virus type 3 isolate CEA4739 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AY960628.1| Dengue virus type 3 isolate Bel73318 polyprotein gene, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|AC008705.6| Homo sapiens chromosome 5 clone CTB-77H17, complete sequence
          Length = 159709

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 602   aaatttttcagcttcttccac 622
             |||||||||||||||||||||
Sbjct: 82183 aaatttttcagcttcttccac 82163



to top

>gb|AY265857.1| Dengue virus type 3 isolate NAMRU-2 98901620 polyprotein gene,
           partial cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 510 cttgtctccaagctccttcag 490



to top

>gb|AY265856.1| Dengue virus type 3 isolate NAMRU-2 98901413 polyprotein gene,
           partial cds
          Length = 2207

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 510 cttgtctccaagctccttcag 490



to top

>dbj|AK020205.1| Mus musculus 15 days embryo male testis cDNA, RIKEN full-length
           enriched library, clone:8030451A03
           product:unclassifiable, full insert sequence
          Length = 689

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 613 cttcttccaccatcttctctacctc 637
           |||||||||||||||||||| ||||
Sbjct: 273 cttcttccaccatcttctctccctc 249



to top

>gb|AY923865.1| Dengue virus type 3 strain C0360/94, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY912458.1| Dengue virus type 3 strain KPS-4-0657/207 polyprotein mRNA, partial
           cds
          Length = 3469

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY912455.1| Dengue virus type 3 strain 98901640 polyprotein mRNA, partial cds
          Length = 3469

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY912454.1| Dengue virus type 3 strain 98901590 polyprotein mRNA, partial cds
          Length = 3469

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AK005815.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700010B23 product:unclassifiable, full
           insert sequence
          Length = 454

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 613 cttcttccaccatcttctctacctc 637
           |||||||||||||||||||| ||||
Sbjct: 162 cttcttccaccatcttctctccctc 138



to top

>gb|AF349753.1|AF349753 Dengue virus type 3 strain PaH881/88 polyprotein precursor, prM-E
           genes, partial cds
          Length = 2150

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 454 cttgtctccaagctccttcag 434



to top

>gb|AF317645.1|AF317645 Dengue virus type 3 strain 80-2, complete genome
          Length = 10696

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB189127.1| Dengue virus type 3 genomic RNA, complete genome, strain: 98901517
           DHF DV-3
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB189126.1| Dengue virus type 3 genomic RNA, complete genome, strain: 98901437
           DSS DV-3
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>dbj|AB189125.1| Dengue virus type 3 genomic RNA, complete genome, strain: 98901403
           DSS DV-3
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>emb|AL935144.11| Zebrafish DNA sequence from clone CH211-89B14 in linkage group 23,
             complete sequence
          Length = 155322

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 222   tacagttctattcaattgcta 242
             |||||||||||||||||||||
Sbjct: 44112 tacagttctattcaattgcta 44092



to top

>dbj|AP001093.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-774L13, complete
             sequence
          Length = 91073

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 627   ttctctacctcatcctttggcagtg 651
             ||||||||||||||||||| |||||
Sbjct: 32930 ttctctacctcatcctttgacagtg 32954



to top

>emb|AJ563355.1|DVI563355 Dengue virus type 3 proviral partial gene for polyprotein, genomic
           RNA
          Length = 2348

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 542 cttgtctccaagctccttcag 522



to top

>gb|M93130.1|DENCME Dengue type 3 virus complete genome RNA, complete cds
          Length = 10696

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676353.1| Dengue virus type 3 strain ThD3_0007_87, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676352.1| Dengue virus type 3 strain ThD3_0010_87, complete genome
          Length = 10709

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676351.1| Dengue virus type 3 strain ThD3_0055_93, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676350.1| Dengue virus type 3 strain ThD3_0104_93, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676349.1| Dengue virus type 3 strain ThD3_1283_98, complete genome
          Length = 10707

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY676348.1| Dengue virus type 3 strain ThD3_1687_98, complete genome
          Length = 10702

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AC122767.16| Mus musculus chromosome 7, clone RP24-143L4, complete sequence
          Length = 192484

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 510    agctccttcagttgtttctcagtct 534
              |||||||||| ||||||||||||||
Sbjct: 116930 agctccttcatttgtttctcagtct 116954



to top

>gb|M86733.1|DENENVAA Dengue virus type 3 structural proteins, complete cds
          Length = 2297

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 663 cttgtctccaagctccttcag 643



to top

>gb|AY858048.1| Dengue virus type 3 strain TB55i, complete genome
          Length = 10697

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY858047.1| Dengue virus type 3 strain TB16, complete genome
          Length = 10658

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 764 cttgtctccaagctccttcag 744



to top

>gb|AY858046.1| Dengue virus type 3 strain PI64, complete genome
          Length = 10699

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 786 cttgtctccaagctccttcag 766



to top

>gb|AY858045.1| Dengue virus type 3 strain PH86, complete genome
          Length = 10695

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 793 cttgtctccaagctccttcag 773



to top

>gb|AY858044.1| Dengue virus type 3 strain KJ71, complete genome
          Length = 10685

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 783 cttgtctccaagctccttcag 763



to top

>gb|AY858042.1| Dengue virus type 3 strain KJ30i, complete genome
          Length = 10690

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|AY858041.1| Dengue virus type 3 strain FW06, complete genome
          Length = 10687

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 783 cttgtctccaagctccttcag 763



to top

>gb|AY858040.1| Dengue virus type 3 strain FW01, complete genome
          Length = 10704

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 792 cttgtctccaagctccttcag 772



to top

>gb|AY858039.1| Dengue virus type 3 strain den3_98, complete genome
          Length = 10661

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 783 cttgtctccaagctccttcag 763



to top

>gb|AY858037.1| Dengue virus type 3 strain BA51, complete genome
          Length = 10705

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 792 cttgtctccaagctccttcag 772



to top

>gb|M25277.1|DENSP5AA Dengue virus type 3 5' region of the genome encoding structural
           proteins
          Length = 3000

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 794 cttgtctccaagctccttcag 774



to top

>gb|L11620.1|DENENVGLYW Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>dbj|AB010990.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain Z026
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010989.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM181
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010988.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM180
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010987.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM119
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010986.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM098
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010985.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM091
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010984.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM086
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010983.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM068
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>dbj|AB010982.1| Dengue virus type 3 RNA for polyprotein (C/C'/preM/M/E region),
           partial cds, strain JM006
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 700 cttgtctccaagctccttcag 680



to top

>gb|L11427.1|DENENVGLYF Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11442.1|DENENVGLYU Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11441.1|DENENVGLYT Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11439.1|DENENVGLYR Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11438.1|DENENVGLYQ Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11437.1|DENENVGLYP Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11436.1|DENENVGLYO Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11435.1|DENENVGLYN Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11434.1|DENENVGLYM Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11433.1|DENENVGLYL Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11431.1|DENENVGLYJ Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11430.1|DENENVGLYI Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11429.1|DENENVGLYH Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11428.1|DENENVGLYG Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11426.1|DENENVGLYE Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11425.1|DENENVGLYD Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|L11423.1|DENENVGLYB Dengue virus type 3 membrane protein (prM/M)/envelope glycoprotein
           (E) polyprotein mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 500 cttgtctccaagctccttcag 520
           |||||||||||||||||||||
Sbjct: 358 cttgtctccaagctccttcag 338



to top

>gb|M99565.1|SPI80HSP Spinach 80 kDa heat shock protein (HSP80) mRNA, 3' end
          Length = 2040

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                        
Query: 552  gcctggttcttggtgtcaattgcgtccctcttctccttgtcctccgccgcaaatttttca 611
            ||||||||||| ||||||||  | || ||||| |||||||| |||   |||||||| |||
Sbjct: 1439 gcctggttcttcgtgtcaatcacttctctcttttccttgtcttccttggcaaatttctca 1380

                                         
Query: 612  gcttcttccaccatcttctctacctcatc 640
            || ||   ||||||  |||||||||||||
Sbjct: 1379 gcctcgctcaccattctctctacctcatc 1351


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,623,081
Number of Sequences: 3902068
Number of extensions: 6623081
Number of successful extensions: 150902
Number of sequences better than 10.0: 176
Number of HSP's better than 10.0 without gapping: 175
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 150514
Number of HSP's gapped (non-prelim): 369
length of query: 750
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 727
effective length of database: 17,143,297,704
effective search space: 12463177430808
effective search space used: 12463177430808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)
to top