>emb|Y14200.1|HVY14200 Hordeum vulgare mRNA for 14-3-3 protein (Hv1433c)
          Length = 1155

 Score = 85.7 bits (43), Expect = 2e-14
 Identities = 71/80 (88%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    acgaacggccacgaaccaccagcagtgcatgtggctnnnnnnnaagccaggaccaggagg 60
            |||||||||||||| |||||||||||||||||||||       ||||||| |||||||||
Sbjct: 1102 acgaacggccacga-ccaccagcagtgcatgtggctcccccccaagccag-accaggagg 1045

                                
Query: 61   cagccgcctacaggcagcga 80
            ||||||||||||||||||||
Sbjct: 1044 cagccgcctacaggcagcga 1025

>ref|NM_206094.1| Drosophila melanogaster Syntaxin 6 CG7736-RE, transcript variant E
           (Syx6), mRNA
          Length = 2087

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  ccaccagcagtgcatgtggc 35
           ||||||||||||||||||||
Sbjct: 468 ccaccagcagtgcatgtggc 449

>gb|AY089525.1| Drosophila melanogaster HL02043 full insert cDNA
          Length = 1916

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  ccaccagcagtgcatgtggc 35
           ||||||||||||||||||||
Sbjct: 422 ccaccagcagtgcatgtggc 403

>gb|AC013423.6|AC013423 Drosophila melanogaster, chromosome 2R, region 47D-47E, BAC clone
             BACR09B12, complete sequence
          Length = 170341

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ccaccagcagtgcatgtggc 35
             ||||||||||||||||||||
Sbjct: 90852 ccaccagcagtgcatgtggc 90833

>gb|AE003826.4| Drosophila melanogaster chromosome 2R, section 24 of 73 of the complete
             sequence
          Length = 310108

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ccaccagcagtgcatgtggc 35
             ||||||||||||||||||||
Sbjct: 65146 ccaccagcagtgcatgtggc 65127

>gb|AC006066.1|AC006066 Drosophila melanogaster, chromosome 2R, region 47D6-47E6, P1 clones
             DS00724 and DS00284, complete sequence
          Length = 110338

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ccaccagcagtgcatgtggc 35
             ||||||||||||||||||||
Sbjct: 33378 ccaccagcagtgcatgtggc 33359

>ref|XM_429121.1| PREDICTED: Gallus gallus similar to PDZ domain containing RING
           finger 3; semaphorin cytoplasmic domain-associated
           protein 3A (LOC431567), mRNA
          Length = 915

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 48  caggaccaggaggcagccg 66
           |||||||||||||||||||
Sbjct: 883 caggaccaggaggcagccg 901

>ref|XM_415947.1| PREDICTED: Gallus gallus similar to B-cell receptor-associated
            protein 29 (BCR-associated protein Bap29) (LOC417702),
            mRNA
          Length = 1938

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   accagcagtgcatgtggct 36
            |||||||||||||||||||
Sbjct: 1116 accagcagtgcatgtggct 1098

>gb|AC122355.4| Mus musculus BAC clone RP23-401L7 from chromosome 14, complete sequence
          Length = 198831

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 46    gccaggaccaggaggcagc 64
             |||||||||||||||||||
Sbjct: 16414 gccaggaccaggaggcagc 16432

>gb|AC182361.3| Spermophilus tridecemlineatus clone VMRC20-433G18, complete sequence
          Length = 140138

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     ccaccagcagtgcatgtgg 34
              |||||||||||||||||||
Sbjct: 118151 ccaccagcagtgcatgtgg 118169

>gb|AC151831.3| Mus musculus BAC clone RP24-81D24 from chromosome 14, complete sequence
          Length = 212749

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     gccaggaccaggaggcagc 64
              |||||||||||||||||||
Sbjct: 190060 gccaggaccaggaggcagc 190078

>emb|BX931564.1| Gallus gallus finished cDNA, clone ChEST390k12
          Length = 1171

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 18   accagcagtgcatgtggct 36
            |||||||||||||||||||
Sbjct: 1091 accagcagtgcatgtggct 1073

>gb|AC147596.5| Gallus gallus BAC clone CH261-29A2 from chromosome unknown, complete
              sequence
          Length = 190789

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 18     accagcagtgcatgtggct 36
              |||||||||||||||||||
Sbjct: 151160 accagcagtgcatgtggct 151142


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 542,636
Number of Sequences: 3902068
Number of extensions: 542636
Number of successful extensions: 32406
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32390
Number of HSP's gapped (non-prelim): 14
length of query: 80
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 59
effective length of database: 17,151,101,840
effective search space: 1011915008560
effective search space used: 1011915008560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)