ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4h24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY632536.1| Bussuquara virus polyprotein gene, complete cds 42 0.13
2gb|AF466202.2| Zea mays putative pol protein gene, partial cds; ... 42 0.13
3gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 36 8.0
4gb|AC183975.1| Mus musculus BAC clone RP24-352C21 from chromosom... 36 8.0
5gb|AF130342.2| Homo sapiens chromosome 8, complete sequence 36 8.0
6gb|AC129191.4| Mus musculus BAC clone RP24-81F10 from chromosome... 36 8.0
7gb|AC161467.2| Gallus gallus BAC clone CH261-89H14 from chromoso... 36 8.0
8gb|AC116952.4| Mus musculus BAC clone RP23-104A7 from 14, comple... 36 8.0
9emb|AL824707.7| Mouse DNA sequence from clone RP23-95O1 on chrom... 36 8.0

>gb|AY632536.1| Bussuquara virus polyprotein gene, complete cds
          Length = 10291

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 5    cacaagcacaatgccccaatc 25
            |||||||||||||||||||||
Sbjct: 2288 cacaagcacaatgccccaatc 2268



to top

>gb|AF466202.2| Zea mays putative pol protein gene, partial cds; and putative gag-pol
              precursor -orf2, putative Fourf gag/pol protein, putative
              NADP-dependent malic enzyme, putative argonaute protein,
              putative pinhead protein, putative pol protein, putative
              gag protein, putative TNP2, r1-B73 proteins, putative
              genetic modifier, putative S-receptor kinase, putative
              aldose reductase-related protein, putative glutathione
              peroxidase, putative glycerol 3-phosphate permease,
              putative response regulator, and putative 4-coumarate-CoA
              ligase-like protein genes, complete cds
          Length = 290350

 Score = 42.1 bits (21), Expect = 0.13
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 6      acaagcacaatgccccaatct 26
              |||||||||||||||||||||
Sbjct: 219328 acaagcacaatgccccaatct 219308



to top

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
             sequence
          Length = 1438950

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    acaatgccccaatctaca 29
             ||||||||||||||||||
Sbjct: 75595 acaatgccccaatctaca 75612



to top

>gb|AC183975.1| Mus musculus BAC clone RP24-352C21 from chromosome y, complete sequence
          Length = 129948

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 9     agcacaatgccccaatct 26
             ||||||||||||||||||
Sbjct: 39469 agcacaatgccccaatct 39486



to top

>gb|AF130342.2| Homo sapiens chromosome 8, complete sequence
          Length = 349992

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     atgccccaatctacaaat 32
              ||||||||||||||||||
Sbjct: 183846 atgccccaatctacaaat 183829



to top

>gb|AC129191.4| Mus musculus BAC clone RP24-81F10 from chromosome Y, complete sequence
          Length = 241616

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     agcacaatgccccaatct 26
             ||||||||||||||||||
Sbjct: 47209 agcacaatgccccaatct 47192



to top

>gb|AC161467.2| Gallus gallus BAC clone CH261-89H14 from chromosome unknown, complete
             sequence
          Length = 308703

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    cccaatctacaaatactt 36
             ||||||||||||||||||
Sbjct: 77801 cccaatctacaaatactt 77818



to top

>gb|AC116952.4| Mus musculus BAC clone RP23-104A7 from 14, complete sequence
          Length = 210088

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                  
Query: 30    aatacttncacagaaccacaa 50
             ||||||| |||||||||||||
Sbjct: 73295 aatacttacacagaaccacaa 73275



to top

>emb|AL824707.7| Mouse DNA sequence from clone RP23-95O1 on chromosome 4, complete
             sequence
          Length = 225002

 Score = 36.2 bits (18), Expect = 8.0
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                  
Query: 24    tctacaaatacttncacagaa 44
             ||||||||||||| |||||||
Sbjct: 93226 tctacaaatactttcacagaa 93246


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 318,208
Number of Sequences: 3902068
Number of extensions: 318208
Number of successful extensions: 18225
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18214
Number of HSP's gapped (non-prelim): 11
length of query: 57
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 36
effective length of database: 17,151,101,840
effective search space: 617439666240
effective search space used: 617439666240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top