ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4h19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR932586.1|CNS0KYBH Paramecium tetraurelia, Small GTPase rab... 44 0.52
2emb|CR788261.6| Human DNA sequence from clone RP11-93P10 on chro... 44 0.52
3emb|BX664608.6| Human DNA sequence from clone RP11-1082I11 on ch... 44 0.52
4emb|BX248098.7| Human DNA sequence from clone CTD-2173L22 on chr... 44 0.52
5emb|BX005209.7| Human DNA sequence from clone RP11-448C16 on chr... 44 0.52
6emb|AL445584.16| Human DNA sequence from clone RP11-366N18 on ch... 44 0.52
7emb|BX664609.6| Human DNA sequence from clone RP11-111O3 on chro... 44 0.52
8gb|AC127365.4| Mus musculus BAC clone RP23-8K10 from 3, complete... 42 2.1
9emb|CR855371.13| Chicken DNA sequence from clone WAG-45A21, comp... 42 2.1
10gb|AC107806.10| Mus musculus chromosome 3, clone RP23-55C1, comp... 42 2.1
11gb|AC087283.10| Homo sapiens chromosome 15, clone RP11-597G23, c... 42 2.1
12gb|AC068875.5| Homo sapiens chromosome 15, clone RP11-720L8, com... 42 2.1
13gb|AC035247.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 8.2
14gb|AC115890.8| Mus musculus chromosome 6, clone RP24-421B23, com... 40 8.2
15gb|AC149162.3| Xenopus tropicalis clone ISB-362P17, complete seq... 40 8.2
16gb|AC132371.2| Mus musculus BAC clone RP23-477D20 from chromosom... 40 8.2
17emb|BX908777.15| Zebrafish DNA sequence from clone CH211-133H13 ... 40 8.2
18emb|AL731669.8| Human DNA sequence from clone RP11-20I18 on chro... 40 8.2
19gb|AF186621.2| Porcine adenovirus 5 HNF-61 pVIII, ORF2, ORF3, OR... 40 8.2
20emb|AL353751.13| Human DNA sequence from clone RP11-149I23 on ch... 40 8.2
21emb|AL157758.10| Human DNA sequence from clone RP11-106H11 on ch... 40 8.2
22emb|AL035633.18|HS1046G13 Human DNA sequence from clone RP5-1046... 40 8.2
23gb|AC158386.4| Mus musculus chromosome 3, clone RP24-281K23, com... 40 8.2
24emb|BX842622.1| Neurospora crassa DNA linkage group I BAC clone ... 40 8.2
25emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig... 40 8.2
26gb|AC131068.11| Mus musculus chromosome 15, clone RP23-383I12, c... 40 8.2
27gb|AC149150.3| Xenopus tropicalis clone ISB-186B10, complete seq... 40 8.2
28gb|AC099509.2| Homo sapiens chromosome 5 clone RP11-254I22, comp... 40 8.2
29gb|AC105445.3| Homo sapiens BAC clone RP11-350B19 from 4, comple... 40 8.2
30gb|AC010345.6| Homo sapiens chromosome 5 clone CTD-2017K17, comp... 40 8.2
31dbj|BA000023.2| Sulfolobus tokodaii str. 7 DNA, complete genome 40 8.2
32gb|AC092353.2| Homo sapiens chromosome 5 clone RP11-305P14, comp... 40 8.2
33gb|AC157328.2| Mus musculus BAC clone RP23-230P11 from chromosom... 40 8.2
34dbj|AK083735.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 8.2
35dbj|AK041930.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 8.2
36gb|AC009315.5| Homo sapiens BAC clone RP11-466K9 from 2, complet... 40 8.2
37gb|AC079631.16| Homo sapiens 12 BAC RP11-389G16 (Roswell Park Ca... 40 8.2
38gb|AC149165.3| Xenopus tropicalis clone ISB-5C15, complete sequence 40 8.2
39gb|BC093492.1| Xenopus laevis cDNA clone IMAGE:5506661, partial cds 40 8.2
40gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 40 8.2
41emb|BX927072.10| Zebrafish DNA sequence from clone CH211-227D19 ... 40 8.2
42gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 40 8.2
43gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome 40 8.2
44emb|X66796.1|HSD5S63 H.sapiens DNA for CA repeat (locus D5S63) 40 8.2

>emb|CR932586.1|CNS0KYBH Paramecium tetraurelia, Small GTPase rab, putative, complete gene
          Length = 3001

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 180 agttctcatataatataaaata 201
           ||||||||||||||||||||||
Sbjct: 619 agttctcatataatataaaata 640



to top

>emb|CR788261.6| Human DNA sequence from clone RP11-93P10 on chromosome 9 Contains an ATP
              synthase, H+ transporting, mitochondrial F1 complex, alpha
              subunit, isoform 2, non-cardiac muscle (ATP5A2) pseudogene,
              a novel pseudogene, a FK506 binding protein 4, 59kDa
              (FKBP4) pseudogene and a CpG island, complete sequence
          Length = 169752

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 174    aaaaatagttctcatataatataaaa 199
              ||||||||||||||||||| ||||||
Sbjct: 143460 aaaaatagttctcatataaaataaaa 143435



to top

>emb|BX664608.6| Human DNA sequence from clone RP11-1082I11 on chromosome 9 Contains an
             S-phase kinase-associated protein 1A (p19A) (SKP1A)
             pseudogene, a novel protein and two CpG islands, complete
             sequence
          Length = 168113

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 174   aaaaatagttctcatataatataaaa 199
             ||||||||||||||||||| ||||||
Sbjct: 76016 aaaaatagttctcatataaaataaaa 75991



to top

>emb|BX248098.7| Human DNA sequence from clone CTD-2173L22 on chromosome 9 Contains a
             novel gene, a zinc finger protein pseudogene, a S-phase
             kinase-associated protein 1A (p19A) (SKP1A) pseudogene and
             two CpG islands, complete sequence
          Length = 119184

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 174   aaaaatagttctcatataatataaaa 199
             ||||||||||||||||||| ||||||
Sbjct: 11501 aaaaatagttctcatataaaataaaa 11476



to top

>emb|BX005209.7| Human DNA sequence from clone RP11-448C16 on chromosome 9 Contains a
             CpG island, complete sequence
          Length = 65900

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 174   aaaaatagttctcatataatataaaa 199
             ||||||||||||||||||| ||||||
Sbjct: 24965 aaaaatagttctcatataaaataaaa 24990



to top

>emb|AL445584.16| Human DNA sequence from clone RP11-366N18 on chromosome 9 Contains the
              gene for a novel protein similar to chromosome 9 open
              reading frame 36 (C9orf36), a 6-pyruvoyltetrahydropterin
              synthase (PTS) pseudogene and a CpG island, complete
              sequence
          Length = 184313

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 174    aaaaatagttctcatataatataaaa 199
              ||||||||||||||||||| ||||||
Sbjct: 136106 aaaaatagttctcatataaaataaaa 136131



to top

>emb|BX664609.6| Human DNA sequence from clone RP11-111O3 on chromosome 9 Contains a
             S-phase kinase-associated protein 1A (p19A) (SKP1A)
             pseudogene and a pseduogene similar to part of a novel
             protein, complete sequence
          Length = 157893

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 174   aaaaatagttctcatataatataaaa 199
             ||||||||||||||||||| ||||||
Sbjct: 69211 aaaaatagttctcatataaaataaaa 69186



to top

>gb|AC127365.4| Mus musculus BAC clone RP23-8K10 from 3, complete sequence
          Length = 191217

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 185    tcatataatataaaataggatacca 209
              |||||||||||||||||| ||||||
Sbjct: 160042 tcatataatataaaatagaatacca 160066



to top

>emb|CR855371.13| Chicken DNA sequence from clone WAG-45A21, complete sequence
          Length = 104062

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 214   ttgttttctccttctgaaaaa 234
             |||||||||||||||||||||
Sbjct: 87187 ttgttttctccttctgaaaaa 87207



to top

>gb|AC107806.10| Mus musculus chromosome 3, clone RP23-55C1, complete sequence
          Length = 214411

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 185    tcatataatataaaataggatacca 209
              |||||||||||||||||| ||||||
Sbjct: 117979 tcatataatataaaatagaatacca 117955



to top

>gb|AC087283.10| Homo sapiens chromosome 15, clone RP11-597G23, complete sequence
          Length = 207548

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 188  tataatataaaataggatacc 208
            |||||||||||||||||||||
Sbjct: 8142 tataatataaaataggatacc 8122



to top

>gb|AC068875.5| Homo sapiens chromosome 15, clone RP11-720L8, complete sequence
          Length = 166706

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 188  tataatataaaataggatacc 208
            |||||||||||||||||||||
Sbjct: 5806 tataatataaaataggatacc 5826



to top

>gb|AC035247.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-108D4, complete
             sequence
          Length = 204935

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   tttgttttctccttctgaaa 232
             ||||||||||||||||||||
Sbjct: 75364 tttgttttctccttctgaaa 75345



to top

>gb|AC115890.8| Mus musculus chromosome 6, clone RP24-421B23, complete sequence
          Length = 191709

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    tttgttttctccttctgaaa 232
              ||||||||||||||||||||
Sbjct: 163331 tttgttttctccttctgaaa 163312



to top

>gb|AC149162.3| Xenopus tropicalis clone ISB-362P17, complete sequence
          Length = 90513

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 558   actgcagggaaaagtgcggt 577
             ||||||||||||||||||||
Sbjct: 84960 actgcagggaaaagtgcggt 84941



to top

>gb|AC132371.2| Mus musculus BAC clone RP23-477D20 from chromosome 5, complete sequence
          Length = 193291

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 252    ctaaagcagtgttcctttct 271
              ||||||||||||||||||||
Sbjct: 100463 ctaaagcagtgttcctttct 100444



to top

>emb|BX908777.15| Zebrafish DNA sequence from clone CH211-133H13 in linkage group 11,
             complete sequence
          Length = 88152

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   aatagttctcatataatata 196
             ||||||||||||||||||||
Sbjct: 39897 aatagttctcatataatata 39916



to top

>emb|AL731669.8| Human DNA sequence from clone RP11-20I18 on chromosome 10, complete
             sequence
          Length = 33406

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 142   tgcaccaagttaggaaacaattca 165
             ||||||||||||||||| ||||||
Sbjct: 24117 tgcaccaagttaggaaaaaattca 24094



to top

>gb|AF186621.2| Porcine adenovirus 5 HNF-61 pVIII, ORF2, ORF3, ORF4, and fiber genes,
            complete cds
          Length = 4199

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 390  aggataattaccaggatatacata 413
            ||||||||||||| ||||||||||
Sbjct: 2551 aggataattaccatgatatacata 2528



to top

>emb|AL353751.13| Human DNA sequence from clone RP11-149I23 on chromosome 10 Contains the
             5' end of the LIPA gene for lipase A lysosomal acid
             cholesterol esterase (Wolman disease), a novel gene, the
             IFIT2 gene for interferon-induced protein with
             tetratricopeptide repeats 2, the IFIT4 gene for
             interferon-induced protein with tetratricopeptide repeats
             4, an interferon-induced protein with tetratricopeptide
             repeats 1 (IFIT1) pseudogene, the gene for a novel protein
             similar to interferon-induced protein with
             tetratricopeptide repeats 1 (IFIT1) and a CpG island,
             complete sequence
          Length = 169404

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   tctggaaaaatagttctcat 188
             ||||||||||||||||||||
Sbjct: 16249 tctggaaaaatagttctcat 16230



to top

>emb|AL157758.10| Human DNA sequence from clone RP11-106H11 on chromosome 13 Contains the
             5' end of a novel gene (contains FLJ31860 and KIAA0853),
             possible ortholog of mouse 3110050K21Rik protein, the 3'
             end of the CPB2 gene for carboxypeptidase B2 (plasma,
             carboxypeptidase U) and a CpG island, complete sequence
          Length = 58097

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 76    aggcatgtgtatacaagaaa 95
             ||||||||||||||||||||
Sbjct: 29220 aggcatgtgtatacaagaaa 29201



to top

>emb|AL035633.18|HS1046G13 Human DNA sequence from clone RP5-1046G13 on chromosome 6q12-13,
             complete sequence
          Length = 129040

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   gttaggaaacaattcatttt 169
             ||||||||||||||||||||
Sbjct: 72571 gttaggaaacaattcatttt 72590



to top

>gb|AC158386.4| Mus musculus chromosome 3, clone RP24-281K23, complete sequence
          Length = 177594

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   tcatataatataaaatagga 204
             ||||||||||||||||||||
Sbjct: 78624 tcatataatataaaatagga 78643



to top

>emb|BX842622.1| Neurospora crassa DNA linkage group I BAC clone B15B3
          Length = 76690

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 554   atatactgcagggaaaagtg 573
             ||||||||||||||||||||
Sbjct: 63918 atatactgcagggaaaagtg 63899



to top

>emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig B1D14
          Length = 138898

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   atataatataaaataggata 206
             ||||||||||||||||||||
Sbjct: 11730 atataatataaaataggata 11749



to top

>gb|AC131068.11| Mus musculus chromosome 15, clone RP23-383I12, complete sequence
          Length = 183651

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     tgtgaacaaagtggatcaca 71
              ||||||||||||||||||||
Sbjct: 102572 tgtgaacaaagtggatcaca 102591



to top

>gb|AC149150.3| Xenopus tropicalis clone ISB-186B10, complete sequence
          Length = 53356

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 558   actgcagggaaaagtgcggt 577
             ||||||||||||||||||||
Sbjct: 39421 actgcagggaaaagtgcggt 39440



to top

>gb|AC099509.2| Homo sapiens chromosome 5 clone RP11-254I22, complete sequence
          Length = 145514

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 402   aggatatacataatgttacc 421
             ||||||||||||||||||||
Sbjct: 70661 aggatatacataatgttacc 70680



to top

>gb|AC105445.3| Homo sapiens BAC clone RP11-350B19 from 4, complete sequence
          Length = 128907

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   aggaaacaattcattttctg 172
             ||||||||||||||||||||
Sbjct: 67015 aggaaacaattcattttctg 66996



to top

>gb|AC010345.6| Homo sapiens chromosome 5 clone CTD-2017K17, complete sequence
          Length = 102001

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   caattcattttctggaaaaa 178
             ||||||||||||||||||||
Sbjct: 48186 caattcattttctggaaaaa 48205



to top

>dbj|BA000023.2| Sulfolobus tokodaii str. 7 DNA, complete genome
          Length = 2694756

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    tttgttttctccttctgaaa 232
              ||||||||||||||||||||
Sbjct: 241209 tttgttttctccttctgaaa 241190



to top

>gb|AC092353.2| Homo sapiens chromosome 5 clone RP11-305P14, complete sequence
          Length = 208660

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    caattcattttctggaaaaa 178
              ||||||||||||||||||||
Sbjct: 165301 caattcattttctggaaaaa 165320



to top

>gb|AC157328.2| Mus musculus BAC clone RP23-230P11 from chromosome 9, complete sequence
          Length = 206694

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     tgctgtgtgaacaaagtgga 66
              ||||||||||||||||||||
Sbjct: 100134 tgctgtgtgaacaaagtgga 100115



to top

>dbj|AK083735.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030073F24
            product:unclassifiable, full insert sequence
          Length = 1700

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   tgctgtgtgaacaaagtgga 66
            ||||||||||||||||||||
Sbjct: 1140 tgctgtgtgaacaaagtgga 1121



to top

>dbj|AK041930.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A630047H14 product:unclassifiable, full
            insert sequence
          Length = 2173

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   tgctgtgtgaacaaagtgga 66
            ||||||||||||||||||||
Sbjct: 1608 tgctgtgtgaacaaagtgga 1589



to top

>gb|AC009315.5| Homo sapiens BAC clone RP11-466K9 from 2, complete sequence
          Length = 143794

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 231   aaaaatatgatgtcgttttt 250
             ||||||||||||||||||||
Sbjct: 75443 aaaaatatgatgtcgttttt 75424



to top

>gb|AC079631.16| Homo sapiens 12 BAC RP11-389G16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 154907

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   tttgttttctccttctgaaa 232
             ||||||||||||||||||||
Sbjct: 32001 tttgttttctccttctgaaa 32020



to top

>gb|AC149165.3| Xenopus tropicalis clone ISB-5C15, complete sequence
          Length = 51842

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 558   actgcagggaaaagtgcggt 577
             ||||||||||||||||||||
Sbjct: 36138 actgcagggaaaagtgcggt 36157



to top

>gb|BC093492.1| Xenopus laevis cDNA clone IMAGE:5506661, partial cds
          Length = 5954

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 303  attttagtacacagtataaa 322
            ||||||||||||||||||||
Sbjct: 1546 attttagtacacagtataaa 1565



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 301    atattttagtacacagtataaata 324
              ||||||||||||| ||||||||||
Sbjct: 642820 atattttagtacatagtataaata 642797



to top

>emb|BX927072.10| Zebrafish DNA sequence from clone CH211-227D19 in linkage group 18,
              complete sequence
          Length = 157662

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     cacacataaggcatgtgtat 87
              ||||||||||||||||||||
Sbjct: 117421 cacacataaggcatgtgtat 117402



to top

>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 424     aatggtgtgatataatccat 443
               ||||||||||||||||||||
Sbjct: 1547273 aatggtgtgatataatccat 1547292



to top

>gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome
          Length = 1992676

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 231     aaaaatatgatgtcgttttt 250
               ||||||||||||||||||||
Sbjct: 1251832 aaaaatatgatgtcgttttt 1251813



to top

>emb|X66796.1|HSD5S63 H.sapiens DNA for CA repeat (locus D5S63)
          Length = 1019

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 159 caattcattttctggaaaaa 178
           ||||||||||||||||||||
Sbjct: 947 caattcattttctggaaaaa 966


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,984,448
Number of Sequences: 3902068
Number of extensions: 6984448
Number of successful extensions: 155007
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 154789
Number of HSP's gapped (non-prelim): 218
length of query: 602
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 579
effective length of database: 17,143,297,704
effective search space: 9925969370616
effective search space used: 9925969370616
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top