| Clone Name | rbags4g23 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|AF212298.1| Xenopus laevis septin A (XlSeptA) mRNA, complete cds | 38 | 1.6 | 2 | gb|AC080158.4| Mus musculus strain C57BL6/J chromosome 5 clone R... | 36 | 6.4 | 3 | gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R... | 36 | 6.4 | 4 | gb|AC135464.13| Medicago truncatula clone mth2-17k21, complete s... | 36 | 6.4 |
|---|
>gb|AF212298.1| Xenopus laevis septin A (XlSeptA) mRNA, complete cds Length = 2479 Score = 38.2 bits (19), Expect = 1.6 Identities = 25/27 (92%) Strand = Plus / Minus Query: 1 aaaaaagatacacgcttgtcataatgt 27 ||||||||||||||||| ||| ||||| Sbjct: 2230 aaaaaagatacacgcttatcaaaatgt 2204
>gb|AC080158.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-311J12, complete sequence Length = 163722 Score = 36.2 bits (18), Expect = 6.4 Identities = 18/18 (100%) Strand = Plus / Plus Query: 7 gatacacgcttgtcataa 24 |||||||||||||||||| Sbjct: 1808 gatacacgcttgtcataa 1825
>gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-284P20, complete sequence Length = 203967 Score = 36.2 bits (18), Expect = 6.4 Identities = 18/18 (100%) Strand = Plus / Plus Query: 7 gatacacgcttgtcataa 24 |||||||||||||||||| Sbjct: 177532 gatacacgcttgtcataa 177549
>gb|AC135464.13| Medicago truncatula clone mth2-17k21, complete sequence Length = 105376 Score = 36.2 bits (18), Expect = 6.4 Identities = 18/18 (100%) Strand = Plus / Plus Query: 3 aaaagatacacgcttgtc 20 |||||||||||||||||| Sbjct: 85751 aaaagatacacgcttgtc 85768 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 128,056 Number of Sequences: 3902068 Number of extensions: 128056 Number of successful extensions: 36228 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 36223 Number of HSP's gapped (non-prelim): 5 length of query: 49 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 29 effective length of database: 17,155,003,908 effective search space: 497495113332 effective search space used: 497495113332 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)