ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3o08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL357139.11| Human DNA sequence from clone RP11-793L10 on ch... 38 1.6
2gb|AC117497.3| Homo sapiens 12 BAC RP11-422O21 (Roswell Park Can... 38 1.6
3emb|BX640404.2| Chicken DNA sequence from clone WAG-36O23, compl... 36 6.2
4emb|AL513187.6| Human DNA sequence from clone RP11-436H6 on chro... 36 6.2
5emb|AL645913.12| Mouse DNA sequence from clone RP23-194G14 on ch... 36 6.2
6gb|AC108698.3| Homo sapiens 3 BAC RP11-12A13 (Roswell Park Cance... 36 6.2
7gb|AC108715.2| Homo sapiens 3 BAC RP11-184F3 (Roswell Park Cance... 36 6.2
8dbj|AP003796.2| Gallus gallus genomic DNA, chromosome 5, clone:2... 36 6.2

>emb|AL357139.11| Human DNA sequence from clone RP11-793L10 on chromosome 6 Contains a
              pseudogene similar to part of heterogeneous nuclear
              ribonucleoprotein D (37 kD AU-rich element RNA binding
              protein 1) (HNRPD) (P37 AUF1 AUF1A hnRNP D0), complete
              sequence
          Length = 128422

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     catgttaacttcccctttg 40
              |||||||||||||||||||
Sbjct: 107008 catgttaacttcccctttg 106990



to top

>gb|AC117497.3| Homo sapiens 12 BAC RP11-422O21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 87243

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 20    gacatgttaacttcccctttgct 42
             |||||||| ||||||||||||||
Sbjct: 36569 gacatgtttacttcccctttgct 36547



to top

>emb|BX640404.2| Chicken DNA sequence from clone WAG-36O23, complete sequence
          Length = 136520

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 27    taacttcccctttgctgt 44
             ||||||||||||||||||
Sbjct: 85233 taacttcccctttgctgt 85250



to top

>emb|AL513187.6| Human DNA sequence from clone RP11-436H6 on chromosome 1 Contains part of
              the NTNG1 gene for netrin G1, complete sequence
          Length = 122032

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 20     gacatgttaacttcccctttgc 41
              ||||||| ||||||||||||||
Sbjct: 101086 gacatgtcaacttcccctttgc 101065



to top

>emb|AL645913.12| Mouse DNA sequence from clone RP23-194G14 on chromosome 11 Contains the
              3' end of gene 9130006A14Rik, the 5' end of the Rnf130 gene
              for ring finger protein 130 and a CpG island, complete
              sequence
          Length = 131007

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 23     atgttaacttcccctttgctgt 44
              |||||| |||||||||||||||
Sbjct: 107380 atgttatcttcccctttgctgt 107359



to top

>gb|AC108698.3| Homo sapiens 3 BAC RP11-12A13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 73477

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 20    gacatgttaacttcccctttgc 41
             ||||||||| ||||||||||||
Sbjct: 64396 gacatgttagcttcccctttgc 64375



to top

>gb|AC108715.2| Homo sapiens 3 BAC RP11-184F3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 176462

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 20     gacatgttaacttcccctttgc 41
              ||||||||| ||||||||||||
Sbjct: 132235 gacatgttagcttcccctttgc 132256



to top

>dbj|AP003796.2| Gallus gallus genomic DNA, chromosome 5, clone:26D12, complete
            sequence
          Length = 156014

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 27   taacttcccctttgctgt 44
            ||||||||||||||||||
Sbjct: 5533 taacttcccctttgctgt 5516


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 153,456
Number of Sequences: 3902068
Number of extensions: 153456
Number of successful extensions: 39337
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39323
Number of HSP's gapped (non-prelim): 14
length of query: 48
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 28
effective length of database: 17,155,003,908
effective search space: 480340109424
effective search space used: 480340109424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top