>gb|AC122460.4| Mus musculus BAC clone RP24-283I1 from chromosome 19, complete sequence
          Length = 173119

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 83     acagatgctaaaatatcacat 103
              |||||||||||||||||||||
Sbjct: 122101 acagatgctaaaatatcacat 122121

>emb|AL354833.9| Human DNA sequence from clone RP11-157L14 on chromosome 13 Contains an
             olfactory receptor pseudogene,  a novel gene (RGC32), the
             3' end of a novel gene (contains KIAA0564 and FLJ21779)
             possible ortholog of RIKEN cDNA 1300010F03 gene, and 2 CpG
             islands, complete sequence
          Length = 158871

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 76    caaaaacacagatgctaaaatatca 100
             ||||||||| |||||||||||||||
Sbjct: 88163 caaaaacactgatgctaaaatatca 88187

>emb|AL136379.19| Human DNA sequence from clone RP5-881P19 on chromosome 1q42.11-42.3
             Contains the WNT3A gene for wingless-type MMTV integration
             site family member 3A protein, a novel protein, the ARF1
             gene for ADP-ribosylation factor 1 protein, a C1orf35 gene
             for chromosome 1 open reading frame 35, the MRPL55 gene
             for  mitochondrial ribosomal protein L55, a novel
             processed pseudogene and six CpG islands, complete
             sequence
          Length = 127816

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 104   gttcatttcctactgtagcttctct 128
             |||| ||||||||||||||||||||
Sbjct: 67311 gttcttttcctactgtagcttctct 67335

>emb|AL603662.11| Mouse DNA sequence from clone RP23-396M19 on chromosome 11 Contains the
              3' end of the Myh10 gene for non-muscle myosin heavy chain
              10, the Ndel1 gene for nuclear distribution gene E-like
              homolog 1 (A. nidulans), three genes for novel proteins
              (9930039A11Rik, 1810012H11Rik and D130071N09), the Rpl26
              gene for ribosomal protein L26, gene Oppo1-pending (oppo
              1), gene RAN guanine nucleotide release factor
              (Rangnrf-pending) and three CpG islands, complete sequence
          Length = 201275

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 2      gtttgaatgttctcaacagag 22
              |||||||||||||||||||||
Sbjct: 104535 gtttgaatgttctcaacagag 104515

>gb|AC155101.19| Medicago truncatula clone mth2-139j13, complete sequence
          Length = 124152

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 91    taaaatatcacatgttcattt 111
             |||||||||||||||||||||
Sbjct: 57588 taaaatatcacatgttcattt 57568

>gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p22, complete sequence
          Length = 129014

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 104  gttcatttcctactgtagcttctct 128
            |||| ||||||||||||||||||||
Sbjct: 2517 gttcttttcctactgtagcttctct 2541

>dbj|AB007650.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA22
          Length = 65465

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 72    gtgccaaaaacacagatgctaaaatatca 100
             |||||||||||| ||||| ||||||||||
Sbjct: 30574 gtgccaaaaacaaagatgataaaatatca 30602

>dbj|AP000722.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-675M1, complete
              sequence
          Length = 177882

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 85     agatgctaaaatatcacatgt 105
              |||||||||||||||||||||
Sbjct: 138320 agatgctaaaatatcacatgt 138340

>gb|AC151413.2| Mus musculus BAC clone RP23-103N6 from 19, complete sequence
          Length = 230420

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    acagatgctaaaatatcacat 103
             |||||||||||||||||||||
Sbjct: 32447 acagatgctaaaatatcacat 32467

>gb|AC117837.4| Mus musculus BAC clone RP24-196P11 from 10, complete sequence
          Length = 145990

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 92    aaaatatcacatgttcatttccta 115
             |||||||||||| |||||||||||
Sbjct: 37716 aaaatatcacattttcatttccta 37739

>gb|AC117671.8| Mus musculus chromosome 10, clone RP23-389G8, complete sequence
          Length = 189341

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 92    aaaatatcacatgttcatttccta 115
             |||||||||||| |||||||||||
Sbjct: 68537 aaaatatcacattttcatttccta 68514

>gb|AC159646.2| Mus musculus BAC clone RP23-192K23 from chromosome 12, complete sequence
          Length = 194901

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 7      aatgttctcaacagagcagtcatt 30
              |||| |||||||||||||||||||
Sbjct: 162349 aatggtctcaacagagcagtcatt 162372

>gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9, complete sequence
          Length = 185444

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 151    catctgtgtttgctttgtccaata 174
              |||||| |||||||||||||||||
Sbjct: 153241 catctgagtttgctttgtccaata 153264

>gb|AC154549.2| Mus musculus BAC clone RP23-443L15 from chromosome 17, complete sequence
          Length = 191523

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     aaatatcacatgttcatttc 112
              ||||||||||||||||||||
Sbjct: 171138 aaatatcacatgttcatttc 171119

>gb|AC154676.2| Mus musculus BAC clone RP23-146O19 from 17, complete sequence
          Length = 180352

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     aaatatcacatgttcatttc 112
              ||||||||||||||||||||
Sbjct: 102786 aaatatcacatgttcatttc 102767

>gb|AC126669.4| Mus musculus BAC clone RP24-457D15 from 9, complete sequence
          Length = 180081

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 151   catctgtgtttgctttgtccaata 174
             |||||| |||||||||||||||||
Sbjct: 74321 catctgagtttgctttgtccaata 74344

>gb|AC131902.6| Homo sapiens chromosome 8, clone RP11-1081M5, complete sequence
          Length = 130200

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   ctgtagcttctcttccttga 135
             ||||||||||||||||||||
Sbjct: 78947 ctgtagcttctcttccttga 78966

>gb|AC087587.14| Homo sapiens 12 BAC CTC-465D4 (CalTech Human BAC Library C) complete
              sequence
          Length = 198842

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     tgagtgccaaaaacacagat 88
              ||||||||||||||||||||
Sbjct: 185717 tgagtgccaaaaacacagat 185736


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,314,615
Number of Sequences: 3902068
Number of extensions: 2314615
Number of successful extensions: 158157
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 158101
Number of HSP's gapped (non-prelim): 56
length of query: 222
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 200
effective length of database: 17,147,199,772
effective search space: 3429439954400
effective search space used: 3429439954400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)