ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags4c23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clon... 739 0.0
2ref|XM_466485.1| Oryza sativa (japonica cultivar-group), mRNA 733 0.0
3gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, comp... 674 0.0
4ref|XM_472843.1| Oryza sativa (japonica cultivar-group), predic... 533 e-148
5dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 533 e-148
6gb|AY103559.1| Zea mays PCO112591 mRNA sequence 492 e-136
7dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 200 4e-48
8dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic D... 200 4e-48
9dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic D... 200 4e-48
10emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4,... 159 1e-35
11dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
12emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16 103 7e-19
13dbj|AB167080.1| Curculigo latifolia NAS-2 mRNA for neoculin acid... 82 3e-12
14gb|DQ226579.1| Boechera divaricarpa isolate SLW-2-D10 mRNA sequence 74 7e-10
15ref|NM_106066.3| Arabidopsis thaliana structural constituent of ... 68 4e-08
16gb|AY062622.1| Arabidopsis thaliana putative 60S ribosomal prote... 68 4e-08
17emb|BX814470.1|CNS0ADLC Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
18gb|BT002588.1| Arabidopsis thaliana putative 60S ribosomal prote... 68 4e-08
19ref|NM_106064.2| Arabidopsis thaliana structural constituent of ... 66 2e-07
20ref|XM_571207.1| Cryptococcus neoformans var. neoformans JEC21 s... 66 2e-07
21gb|AY114641.1| Arabidopsis thaliana putative 60S ribosomal prote... 66 2e-07
22gb|AY081305.1| Arabidopsis thaliana putative 60S ribosomal prote... 66 2e-07
23gb|AY054573.1| Arabidopsis thaliana putative 60S ribosomal prote... 66 2e-07
24gb|AY087325.1| Arabidopsis thaliana clone 3418 mRNA, complete se... 66 2e-07
25gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 64 6e-07
26gb|AC016662.7|AC016662 Arabidopsis thaliana chromosome 1 BAC F2P... 62 2e-06
27emb|BX814105.1|CNS0ADRY Arabidopsis thaliana Full-length cDNA Co... 56 2e-04
28gb|DQ214771.1| Taeniopygia guttata clone 0061P0023H09 ribosomal ... 48 0.037
29gb|DQ214770.1| Taeniopygia guttata clone 0061P0025H04 ribosomal ... 48 0.037
30gb|AC155898.15| Medicago truncatula clone mth2-109f1, complete s... 48 0.037
31dbj|AB035569.1| Chara globularis cgrpl6 mRNA for 60S ribosomal p... 48 0.037
32emb|BX065431.1|CNS09MNF Single read from an extremity of a full-... 46 0.15
33emb|BX065430.1|CNS09MNE Single read from an extremity of a full-... 46 0.15
34emb|BX062222.1|CNS09K6A Single read from an extremity of a full-... 46 0.15
35emb|BX057445.1|CNS09GHL Single read from an extremity of a full-... 46 0.15
36emb|BX048593.1|CNS099NP Single read from an extremity of a full-... 46 0.15
37emb|BX048592.1|CNS099NO Single read from an extremity of a full-... 46 0.15
38emb|BX047227.1|CNS098LR Single read from an extremity of a full-... 46 0.15
39emb|BX047226.1|CNS098LQ Single read from an extremity of a full-... 46 0.15
40emb|BX042740.1|CNS09554 Single read from an extremity of a full-... 46 0.15
41ref|XM_321154.2| Anopheles gambiae str. PEST ENSANGP00000020813 ... 46 0.15
42gb|DQ384529.1| Panax ginseng clone PG6L-6 unknown mRNA 44 0.58
43gb|AY088336.1| Arabidopsis thaliana clone 573 mRNA, complete seq... 44 0.58
44gb|AY674237.1| Ixodes pacificus clone IP_7_60_92_78_CLU ribosoma... 42 2.3
45ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (... 42 2.3
46emb|BX649433.4| Zebrafish DNA sequence from clone DKEY-215P16 in... 42 2.3
47emb|AL928677.6| Zebrafish DNA sequence from clone BUSM1-70B1 in ... 42 2.3
48emb|AL590447.1|CNS07EGE chromosome VII of strain GB-M1 of Enceph... 42 2.3
49dbj|AB109375.1| Tribolodon hakonensis GDH mRNA for glutamate deh... 42 2.3
50dbj|AP002754.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.3
51dbj|AP002380.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.3
52emb|AL929433.10| Mouse DNA sequence from clone RP23-193M23 on ch... 42 2.3
53gb|AC004770.1|AC004770 Homo sapiens chromosome 11, BAC CIT-HSP-3... 42 2.3
54gb|BC076927.1| Xenopus tropicalis matrix metalloproteinase 9 (ge... 40 9.1
55gb|AC145554.2| Mus musculus BAC clone RP23-217E22 from chromosom... 40 9.1
56ref|XM_591972.2| PREDICTED: Bos taurus similar to Sodium/hydroge... 40 9.1
57ref|XM_716459.1| Candida albicans SC5314 putative 26S proteasome... 40 9.1
58ref|XM_716188.1| Candida albicans SC5314 putative 26S proteasome... 40 9.1
59ref|XM_752221.1| Ustilago maydis 521 hypothetical protein (UM011... 40 9.1
60ref|XM_533873.2| PREDICTED: Canis familiaris similar to peptidyl... 40 9.1
61gb|AC117260.3| Mus musculus BAC clone RP24-498G10 from chromosom... 40 9.1
62gb|AC121871.3| Mus musculus BAC clone RP24-121J1 from chromosome... 40 9.1
63gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete se... 40 9.1
64gb|AF517879.1| Griffithsia japonica isolate Gj550 ribosome prote... 40 9.1
65emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 40 9.1
66emb|BX640451.1| Bordetella bronchiseptica strain RB50, complete ... 40 9.1
67gb|AY831461.1| Pseudomonas putida plasmid pKW1 putative porin ge... 40 9.1
68emb|BX640412.1| Bordetella pertussis strain Tohama I, complete g... 40 9.1
69ref|NM_001006842.1| Xenopus tropicalis matrix metalloproteinase ... 40 9.1
70emb|BX321865.1| Nitrosomonas europaea ATCC 19718, complete genom... 40 9.1
71gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthe... 40 9.1
72emb|AL627426.19| Mouse DNA sequence from clone RP23-168D2 on chr... 40 9.1
73emb|AL592215.12| Mouse DNA sequence from clone RP23-172P19 on ch... 40 9.1
74dbj|AB226127.1| Aspergillus oryzae cDNA, contig sequence: AoEST2984 40 9.1
75gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 9.1
76dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 40 9.1
77gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Par... 40 9.1
78gb|AC159625.2| Mus musculus BAC clone RP24-262L7 from chromosome... 40 9.1
79gb|AC067947.6| Homo sapiens BAC clone RP11-492I5 from 2, complet... 40 9.1
80emb|AJ276271.1|CAR276271 Cicer arietinum mRNA for putative 60S r... 40 9.1
81gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 40 9.1
82gb|AC078927.20| Homo sapiens 12 BAC RP11-745O10 (Roswell Park Ca... 40 9.1
83gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 9.1
84emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on ch... 40 9.1
85gb|U93491.1|MUU93491 Meriones unguiculatus NHE-2 mRNA, partial cds 40 9.1
86gb|AY823671.1| Glycine max HDZip I protein mRNA, complete cds 40 9.1

>dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139B06, full
           insert sequence
          Length = 1030

 Score =  739 bits (373), Expect = 0.0
 Identities = 535/589 (90%)
 Strand = Plus / Minus

                                                                       
Query: 79  aacttagaaggtcatctcatggggcttgtcaccgtccctgagagagaaccgggcaccaag 138
           ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 733 aacttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaag 674

                                                                       
Query: 139 atagttcttaaggtcagggacagcatcgatagccttgatcaactcagcatcaatggcctt 198
           ||||   || ||||| |||||| | |||||||||||||||||||||||||| |  |||||
Sbjct: 673 ataggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagcctt 614

                                                                       
Query: 199 ctggtcatcctttttgaagtcaggcaggttcttggttgcctccttctcagtctcaaacag 258
           |||||||||||| |||||||| ||||| |||||||||||||||||||| |||||||| ||
Sbjct: 613 ctggtcatccttcttgaagtcgggcagattcttggttgcctccttctctgtctcaaaaag 554

                                                                       
Query: 259 ctccccttcagtcttctttgccctggccttcttgtccctagcaaagtacttgtcatcaaa 318
            || || || |||||||| ||| | |||||||||||||  ||||||||||||||||||||
Sbjct: 553 ttcaccctcggtcttcttggcctttgccttcttgtcccgggcaaagtacttgtcatcaaa 494

                                                                       
Query: 319 cttctccaccttaacaccagagatgtcaacctttgtggatgtggcaatgacataagcctg 378
           ||| ||||||||||||||||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 493 cttatccaccttaacaccagagatgtcaaccttcgtggatgtggcaatgacgtaggcctg 434

                                                                       
Query: 379 gttcacccggcgaactgggacaccattgatcttgaaaggtccagtgatgaggagcaggcc 438
           |||||| ||||| |  || || ||||||||||| |||||||| |||||||||||||||||
Sbjct: 433 gttcacacggcggatgggcactccattgatcttaaaaggtccggtgatgaggagcaggcc 374

                                                                       
Query: 439 agacttgagctgcttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggat 498
            ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 373 ggacttgagctgcttgaggaacacgacgcgcttccccatgtacctcccggcgagcaggat 314

                                                                       
Query: 499 cagcaccgtgccgggcgtgatggtcgacctgagcttggtaggtttgggcttgcgggtgct 558
           ||||||||| || ||||||||||||||||||||||||||||| |||| ||||||||||||
Sbjct: 313 cagcaccgtccccggcgtgatggtcgacctgagcttggtagggttggccttgcgggtgct 254

                                                                       
Query: 559 ggcggtgcggggcttgacgtcgtcggcggggtagaacttgggctcggcgacggcggctgg 618
           || || ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||
Sbjct: 253 gggggcgcggggcttgacgtcgtcggcggggtagaacttgggctcggcggcggcggcggg 194

                                                            
Query: 619 cttctcggcctttgggaaggctccgccgttcttggccttgatggcccag 667
           |||  ||||||| |||||||  |||||||||||||||||||||||||||
Sbjct: 193 cttgccggccttggggaaggtgccgccgttcttggccttgatggcccag 145



to top

>ref|XM_466485.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 660

 Score =  733 bits (370), Expect = 0.0
 Identities = 532/586 (90%)
 Strand = Plus / Minus

                                                                       
Query: 82  ttagaaggtcatctcatggggcttgtcaccgtccctgagagagaaccgggcaccaagata 141
           |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 660 ttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaagata 601

                                                                       
Query: 142 gttcttaaggtcagggacagcatcgatagccttgatcaactcagcatcaatggccttctg 201
           |   || ||||| |||||| | |||||||||||||||||||||||||| |  ||||||||
Sbjct: 600 ggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagccttctg 541

                                                                       
Query: 202 gtcatcctttttgaagtcaggcaggttcttggttgcctccttctcagtctcaaacagctc 261
           ||||||||| |||||||| ||||| |||||||||||||||||||| |||||||| || ||
Sbjct: 540 gtcatccttcttgaagtcgggcagattcttggttgcctccttctctgtctcaaaaagttc 481

                                                                       
Query: 262 cccttcagtcttctttgccctggccttcttgtccctagcaaagtacttgtcatcaaactt 321
            || || |||||||| ||| | |||||||||||||  |||||||||||||||||||||||
Sbjct: 480 accctcggtcttcttggcctttgccttcttgtcccgggcaaagtacttgtcatcaaactt 421

                                                                       
Query: 322 ctccaccttaacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggtt 381
            ||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 420 atccaccttaacaccagagatgtcaaccttcgtggatgtggcaatgacgtaggcctggtt 361

                                                                       
Query: 382 cacccggcgaactgggacaccattgatcttgaaaggtccagtgatgaggagcaggccaga 441
           ||| ||||| |  || || ||||||||||| |||||||| ||||||||||||||||| ||
Sbjct: 360 cacacggcggatgggcactccattgatcttaaaaggtccggtgatgaggagcaggccgga 301

                                                                       
Query: 442 cttgagctgcttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggatcag 501
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 300 cttgagctgcttgaggaacacgacgcgcttccccatgtacctcccggcgagcaggatcag 241

                                                                       
Query: 502 caccgtgccgggcgtgatggtcgacctgagcttggtaggtttgggcttgcgggtgctggc 561
           |||||| || ||||||||||||||||||||||||||||| |||| |||||||||||||| 
Sbjct: 240 caccgtccccggcgtgatggtcgacctgagcttggtagggttggccttgcgggtgctggg 181

                                                                       
Query: 562 ggtgcggggcttgacgtcgtcggcggggtagaacttgggctcggcgacggcggctggctt 621
           || ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||
Sbjct: 180 ggcgcggggcttgacgtcgtcggcggggtagaacttgggctcggcggcggcggcgggctt 121

                                                         
Query: 622 ctcggcctttgggaaggctccgccgttcttggccttgatggcccag 667
             ||||||| |||||||  |||||||||||||||||||||||||||
Sbjct: 120 gccggccttggggaaggtgccgccgttcttggccttgatggcccag 75



to top

>gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, complete cds
          Length = 686

 Score =  674 bits (340), Expect = 0.0
 Identities = 526/588 (89%)
 Strand = Plus / Minus

                                                                       
Query: 79  aacttagaaggtcatctcatggggcttgtcaccgtccctgagagagaaccgggcaccaag 138
           |||||| |||||||||||||| |||||||| || |||||||| |||||||||||||||||
Sbjct: 682 aacttaaaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaag 623

                                                                       
Query: 139 atagttcttaaggtcagggacagcatcgatagccttgatcaactcagcatcaatggcctt 198
           ||| || |||||||| ||||| |||||||||||||||||||||||||| |||||| ||||
Sbjct: 622 ataatttttaaggtctgggacggcatcgatagccttgatcaactcagcgtcaatgacctt 563

                                                                       
Query: 199 ctggtcatcctttttgaagtcaggcaggttcttggttgcctccttctcagtctcaaacag 258
           |||||||||||| |||||||| ||||  ||||||||||||||||| || | |||||| ||
Sbjct: 562 ctggtcatccttcttgaagtctggcaaattcttggttgcctccttatccgactcaaatag 503

                                                                       
Query: 259 ctccccttcagtcttctttgccctggccttcttgtccctagcaaagtacttgtcatcaaa 318
           ||| || ||||||||||||||||| | |||||| |||||||| |||||||||||||||||
Sbjct: 502 ctcgccctcagtcttctttgccctagtcttcttctccctagcgaagtacttgtcatcaaa 443

                                                                       
Query: 319 cttctccaccttaacaccagagatgtcaacctttgtggatgtggcaatgacataagcctg 378
           ||||| ||| |||||   ||||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 442 cttctgcacattaaccttagagatgtcgacctttgtggatgtggcaatgacgtaagcctg 383

                                                                       
Query: 379 gttcacccggcgaactgggacaccattgatcttgaaaggtccagtgatgaggagcaggcc 438
           |||||| | ||| | ||| || |||||||||||||||||||||||||||||||| |||||
Sbjct: 382 gttcactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagaaggcc 323

                                                                       
Query: 439 agacttgagctgcttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggat 498
            |||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 322 ggactggagctgcttgaggaacaccacgcgctttcccatgtacctccccgcgagcaggat 263

                                                                       
Query: 499 cagcaccgtgccgggcgtgatggtcgacctgagcttggtaggtttgggcttgcgggtgct 558
           |||||||||||| || ||||||||||||||||||||||| || | ||||||||| |||||
Sbjct: 262 cagcaccgtgcccggtgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgct 203

                                                                       
Query: 559 ggcggtgcggggcttgacgtcgtcggcggggtagaacttgggctcggcgacggcggctgg 618
             ||||||| |||||||| || || ||||| ||||||||||||||||||| |||||| ||
Sbjct: 202 cacggtgcgtggcttgacatcatcagcgggatagaacttgggctcggcgatggcggccgg 143

                                                           
Query: 619 cttctcggcctttgggaaggctccgccgttcttggccttgatggccca 666
           |||||||||||| || ||||| ||||||| ||||||||||||||||||
Sbjct: 142 cttctcggccttgggcaaggcgccgccgtgcttggccttgatggccca 95



to top

>ref|XM_472843.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 669

 Score =  533 bits (269), Expect = e-148
 Identities = 505/585 (86%), Gaps = 9/585 (1%)
 Strand = Plus / Minus

                                                                       
Query: 91  catctcatggggcttgtcaccgtccctgagagagaaccgggcaccaagatagttcttaag 150
           |||||| ||||||||||| |||||||||||||| ||||| |||||||| ||  | || ||
Sbjct: 660 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 601

                                                                       
Query: 151 gtcagggacagcatcgatagccttgatcaactcagcatcaatggccttctggtcatcctt 210
            || |||||||| || ||||| ||||||||||| ||||| |   | |||||||| |||||
Sbjct: 600 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 541

                                                                       
Query: 211 tttgaagtcaggcaggttcttggttgcctccttctcagtctcaaacagctccccttcagt 270
           |||||| || ||||||||||||||||||||||||||||||||||| || || || || ||
Sbjct: 540 tttgaactccggcaggttcttggttgcctccttctcagtctcaaaaagttcaccctcggt 481

                                                                       
Query: 271 cttctttgccctggccttcttgtccctagcaaagtacttgtcatcaaacttctccacctt 330
           |||||| ||| |   ||||||||||||||  |||||||||||||||||||||||||| ||
Sbjct: 480 cttcttcgccttctgcttcttgtccctagagaagtacttgtcatcaaacttctccacatt 421

                                                                       
Query: 331 aacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcg 390
           |||||||||||| |||||||||||||| || |||||||| || | ||||||||| |||||
Sbjct: 420 aacaccagagatatcaacctttgtggacgtagcaatgacgtagggctggttcacacggcg 361

                                                                       
Query: 391 aactgggacaccattgatcttgaaaggtccagtgatgaggagcaggccagacttgagctg 450
            |  || || ||||||||||| |||||||| |||| ||| |||||||| || ||||||||
Sbjct: 360 gatcggaactccattgatcttaaaaggtccggtgacgagaagcaggccggatttgagctg 301

                                                                       
Query: 451 cttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggatcagcaccgtgcc 510
           |||||||||||| ||||||||||||||| ||||||| ||||||||||||||||| || ||
Sbjct: 300 cttgaggaacacgacgcgcttccccatgaacctcccggcgagcaggatcagcactgtccc 241

                                                                       
Query: 511 gggcgtgatggtcgacctgagcttggtaggtttgggcttgcgggtgctggcggtgcgggg 570
            |||||||||| |||||||||||||||||| |||||||||||||||||||    ||||||
Sbjct: 240 aggcgtgatggacgacctgagcttggtagggttgggcttgcgggtgctgggctggcgggg 181

                                                                       
Query: 571 cttgacgtcgtcggcggggtagaacttgggctcggcgacggcggct---------ggctt 621
           ||||||||||||||||||||||||||||||| ||||| ||||||||         |||||
Sbjct: 180 cttgacgtcgtcggcggggtagaacttgggcgcggcggcggcggctgcggcggcgggctt 121

                                                        
Query: 622 ctcggcctttgggaaggctccgccgttcttggccttgatggccca 666
           ||||||||| |||||||| ||||||| ||||||||||||||||||
Sbjct: 120 ctcggccttggggaaggcgccgccgtgcttggccttgatggccca 76



to top

>dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123D20, full
           insert sequence
          Length = 933

 Score =  533 bits (269), Expect = e-148
 Identities = 505/585 (86%), Gaps = 9/585 (1%)
 Strand = Plus / Minus

                                                                       
Query: 91  catctcatggggcttgtcaccgtccctgagagagaaccgggcaccaagatagttcttaag 150
           |||||| ||||||||||| |||||||||||||| ||||| |||||||| ||  | || ||
Sbjct: 714 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 655

                                                                       
Query: 151 gtcagggacagcatcgatagccttgatcaactcagcatcaatggccttctggtcatcctt 210
            || |||||||| || ||||| ||||||||||| ||||| |   | |||||||| |||||
Sbjct: 654 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 595

                                                                       
Query: 211 tttgaagtcaggcaggttcttggttgcctccttctcagtctcaaacagctccccttcagt 270
           |||||| || ||||||||||||||||||||||||||||||||||| || || || || ||
Sbjct: 594 tttgaactccggcaggttcttggttgcctccttctcagtctcaaaaagttcaccctcggt 535

                                                                       
Query: 271 cttctttgccctggccttcttgtccctagcaaagtacttgtcatcaaacttctccacctt 330
           |||||| ||| |   ||||||||||||||  |||||||||||||||||||||||||| ||
Sbjct: 534 cttcttcgccttctgcttcttgtccctagagaagtacttgtcatcaaacttctccacatt 475

                                                                       
Query: 331 aacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcg 390
           |||||||||||| |||||||||||||| || |||||||| || | ||||||||| |||||
Sbjct: 474 aacaccagagatatcaacctttgtggacgtagcaatgacgtagggctggttcacacggcg 415

                                                                       
Query: 391 aactgggacaccattgatcttgaaaggtccagtgatgaggagcaggccagacttgagctg 450
            |  || || ||||||||||| |||||||| |||| ||| |||||||| || ||||||||
Sbjct: 414 gatcggaactccattgatcttaaaaggtccggtgacgagaagcaggccggatttgagctg 355

                                                                       
Query: 451 cttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggatcagcaccgtgcc 510
           |||||||||||| ||||||||||||||| ||||||| ||||||||||||||||| || ||
Sbjct: 354 cttgaggaacacgacgcgcttccccatgaacctcccggcgagcaggatcagcactgtccc 295

                                                                       
Query: 511 gggcgtgatggtcgacctgagcttggtaggtttgggcttgcgggtgctggcggtgcgggg 570
            |||||||||| |||||||||||||||||| |||||||||||||||||||    ||||||
Sbjct: 294 aggcgtgatggacgacctgagcttggtagggttgggcttgcgggtgctgggctggcgggg 235

                                                                       
Query: 571 cttgacgtcgtcggcggggtagaacttgggctcggcgacggcggct---------ggctt 621
           ||||||||||||||||||||||||||||||| ||||| ||||||||         |||||
Sbjct: 234 cttgacgtcgtcggcggggtagaacttgggcgcggcggcggcggctgcggcggcgggctt 175

                                                        
Query: 622 ctcggcctttgggaaggctccgccgttcttggccttgatggccca 666
           ||||||||| |||||||| ||||||| ||||||||||||||||||
Sbjct: 174 ctcggccttggggaaggcgccgccgtgcttggccttgatggccca 130



to top

>gb|AY103559.1| Zea mays PCO112591 mRNA sequence
          Length = 1361

 Score =  492 bits (248), Expect = e-136
 Identities = 494/576 (85%)
 Strand = Plus / Minus

                                                                        
Query: 91   catctcatggggcttgtcaccgtccctgagagagaaccgggcaccaagatagttcttaag 150
            ||||||||||||||||||||| |||||||||||||||||||| ||||||||| | || ||
Sbjct: 1055 catctcatggggcttgtcaccatccctgagagagaaccgggcgccaagataggttttcag 996

                                                                        
Query: 151  gtcagggacagcatcgatagccttgatcaactcagcatcaatggccttctggtcatcctt 210
             ||  ||||||| ||||||||||||||||   ||| ||| |  |||||||||||||||||
Sbjct: 995  ctccaggacagcctcgatagccttgatcagagcagaatccacagccttctggtcatcctt 936

                                                                        
Query: 211  tttgaagtcaggcaggttcttggttgcctccttctcagtctcaaacagctccccttcagt 270
             ||||||||||||||   ||||| ||||||||| || |||||||| ||||| || || ||
Sbjct: 935  cttgaagtcaggcagtgacttggatgcctccttttctgtctcaaaaagctcgccctcggt 876

                                                                        
Query: 271  cttctttgccctggccttcttgtccctagcaaagtacttgtcatcaaacttctccacctt 330
            ||||||  || |   |||||| ||||| |||||||||||||||||||||||  | || | 
Sbjct: 875  cttcttcaccttctgcttcttctccctggcaaagtacttgtcatcaaacttggcgacatc 816

                                                                        
Query: 331  aacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcg 390
            |||||||||||||||||| || || ||||| ||||||||||| | ||||||||| |||||
Sbjct: 815  aacaccagagatgtcaactttggttgatgtagcaatgacataggtctggttcacacggcg 756

                                                                        
Query: 391  aactgggacaccattgatcttgaaaggtccagtgatgaggagcaggccagacttgagctg 450
             |  || || ||||||||||||||||| |||| ||| |||||||||||||||||||||||
Sbjct: 755  gatcggtactccattgatcttgaaaggcccagagataaggagcaggccagacttgagctg 696

                                                                        
Query: 451  cttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggatcagcaccgtgcc 510
            |||||| |||||||| | |||||||||| | | ||| ||||| |||||||||||||| ||
Sbjct: 695  cttgagaaacaccactctcttccccatgaagcgccctgcgaggaggatcagcaccgtccc 636

                                                                        
Query: 511  gggcgtgatggtcgacctgagcttggtaggtttgggcttgcgggtgctggcggtgcgggg 570
             ||||||||| ||||||||||||||||||| || ||||||||||||||||    ||||||
Sbjct: 635  aggcgtgatgctcgacctgagcttggtaggcttaggcttgcgggtgctgggaacgcgggg 576

                                                                        
Query: 571  cttgacgtcgtcggcggggtagaacttgggctcggcgacggcggctggcttctcggcctt 630
            ||||||||||||||| |||||||||||||| ||  || ||||||| | ||| ||||||||
Sbjct: 575  cttgacgtcgtcggcagggtagaacttgggttccacggcggcggcggccttgtcggcctt 516

                                                
Query: 631  tgggaaggctccgccgttcttggccttgatggccca 666
             |||||||| ||||||||||||||||||||||||||
Sbjct: 515  ggggaaggcgccgccgttcttggccttgatggccca 480



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  200 bits (101), Expect = 4e-48
 Identities = 146/161 (90%)
 Strand = Plus / Plus

                                                                            
Query: 79       aacttagaaggtcatctcatggggcttgtcaccgtccctgagagagaaccgggcaccaag 138
                ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 22901790 aacttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaag 22901849

                                                                            
Query: 139      atagttcttaaggtcagggacagcatcgatagccttgatcaactcagcatcaatggcctt 198
                ||||   || ||||| |||||| | |||||||||||||||||||||||||| |  |||||
Sbjct: 22901850 ataggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagcctt 22901909

                                                         
Query: 199      ctggtcatcctttttgaagtcaggcaggttcttggttgcct 239
                |||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 22901910 ctggtcatccttcttgaagtcgggcagattcttggttgcct 22901950



 Score =  198 bits (100), Expect = 2e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                            
Query: 524      gacctgagcttggtaggtttgggcttgcgggtgctggcggtgcggggcttgacgtcgtcg 583
                ||||||||||||||||| |||| |||||||||||||| || |||||||||||||||||||
Sbjct: 22903263 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 22903322

                                                                            
Query: 584      gcggggtagaacttgggctcggcgacggcggctggcttctcggcctttgggaaggctccg 643
                |||||||||||||||||||||||| ||||||| |||||  ||||||| |||||||  |||
Sbjct: 22903323 gcggggtagaacttgggctcggcggcggcggcgggcttgccggccttggggaaggtgccg 22903382

                                        
Query: 644      ccgttcttggccttgatggcccag 667
                ||||||||||||||||||||||||
Sbjct: 22903383 ccgttcttggccttgatggcccag 22903406



 Score =  190 bits (96), Expect = 4e-45
 Identities = 162/184 (88%)
 Strand = Plus / Plus

                                                                            
Query: 237      cctccttctcagtctcaaacagctccccttcagtcttctttgccctggccttcttgtccc 296
                |||||||||| |||||||| || || || || |||||||| ||| | |||||||||||||
Sbjct: 22902042 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 22902101

                                                                            
Query: 297      tagcaaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtgg 356
                  ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 22902102 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 22902161

                                                                            
Query: 357      atgtggcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaag 416
                ||||||||||||| || ||||||||||| ||||| |  || || ||||||||||| ||||
Sbjct: 22902162 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 22902221

                    
Query: 417      gtcc 420
                ||||
Sbjct: 22902222 gtcc 22902225



 Score =  174 bits (88), Expect = 2e-40
 Identities = 103/108 (95%)
 Strand = Plus / Plus

                                                                            
Query: 422      gtgatgaggagcaggccagacttgagctgcttgaggaacaccacgcgcttccccatgtac 481
                ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 22903064 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 22903123

                                                                
Query: 482      ctcccagcgagcaggatcagcaccgtgccgggcgtgatggtcgacctg 529
                ||||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 22903124 ctcccggcgagcaggatcagcaccgtccccggcgtgatggtcgacctg 22903171



to top

>dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0016G10
          Length = 143211

 Score =  200 bits (101), Expect = 4e-48
 Identities = 146/161 (90%)
 Strand = Plus / Plus

                                                                         
Query: 79    aacttagaaggtcatctcatggggcttgtcaccgtccctgagagagaaccgggcaccaag 138
             ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 21592 aacttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaag 21651

                                                                         
Query: 139   atagttcttaaggtcagggacagcatcgatagccttgatcaactcagcatcaatggcctt 198
             ||||   || ||||| |||||| | |||||||||||||||||||||||||| |  |||||
Sbjct: 21652 ataggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagcctt 21711

                                                      
Query: 199   ctggtcatcctttttgaagtcaggcaggttcttggttgcct 239
             |||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 21712 ctggtcatccttcttgaagtcgggcagattcttggttgcct 21752



 Score =  198 bits (100), Expect = 2e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                         
Query: 524   gacctgagcttggtaggtttgggcttgcgggtgctggcggtgcggggcttgacgtcgtcg 583
             ||||||||||||||||| |||| |||||||||||||| || |||||||||||||||||||
Sbjct: 23065 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 23124

                                                                         
Query: 584   gcggggtagaacttgggctcggcgacggcggctggcttctcggcctttgggaaggctccg 643
             |||||||||||||||||||||||| ||||||| |||||  ||||||| |||||||  |||
Sbjct: 23125 gcggggtagaacttgggctcggcggcggcggcgggcttgccggccttggggaaggtgccg 23184

                                     
Query: 644   ccgttcttggccttgatggcccag 667
             ||||||||||||||||||||||||
Sbjct: 23185 ccgttcttggccttgatggcccag 23208



 Score =  190 bits (96), Expect = 4e-45
 Identities = 162/184 (88%)
 Strand = Plus / Plus

                                                                         
Query: 237   cctccttctcagtctcaaacagctccccttcagtcttctttgccctggccttcttgtccc 296
             |||||||||| |||||||| || || || || |||||||| ||| | |||||||||||||
Sbjct: 21844 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 21903

                                                                         
Query: 297   tagcaaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtgg 356
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 21904 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 21963

                                                                         
Query: 357   atgtggcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaag 416
             ||||||||||||| || ||||||||||| ||||| |  || || ||||||||||| ||||
Sbjct: 21964 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 22023

                 
Query: 417   gtcc 420
             ||||
Sbjct: 22024 gtcc 22027



 Score =  174 bits (88), Expect = 2e-40
 Identities = 103/108 (95%)
 Strand = Plus / Plus

                                                                         
Query: 422   gtgatgaggagcaggccagacttgagctgcttgaggaacaccacgcgcttccccatgtac 481
             ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 22866 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 22925

                                                             
Query: 482   ctcccagcgagcaggatcagcaccgtgccgggcgtgatggtcgacctg 529
             ||||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 22926 ctcccggcgagcaggatcagcaccgtccccggcgtgatggtcgacctg 22973



to top

>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0006O15
          Length = 139723

 Score =  200 bits (101), Expect = 4e-48
 Identities = 146/161 (90%)
 Strand = Plus / Plus

                                                                          
Query: 79     aacttagaaggtcatctcatggggcttgtcaccgtccctgagagagaaccgggcaccaag 138
              ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 135128 aacttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaag 135187

                                                                          
Query: 139    atagttcttaaggtcagggacagcatcgatagccttgatcaactcagcatcaatggcctt 198
              ||||   || ||||| |||||| | |||||||||||||||||||||||||| |  |||||
Sbjct: 135188 ataggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagcctt 135247

                                                       
Query: 199    ctggtcatcctttttgaagtcaggcaggttcttggttgcct 239
              |||||||||||| |||||||| ||||| |||||||||||||
Sbjct: 135248 ctggtcatccttcttgaagtcgggcagattcttggttgcct 135288



 Score =  198 bits (100), Expect = 2e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                          
Query: 524    gacctgagcttggtaggtttgggcttgcgggtgctggcggtgcggggcttgacgtcgtcg 583
              ||||||||||||||||| |||| |||||||||||||| || |||||||||||||||||||
Sbjct: 136601 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 136660

                                                                          
Query: 584    gcggggtagaacttgggctcggcgacggcggctggcttctcggcctttgggaaggctccg 643
              |||||||||||||||||||||||| ||||||| |||||  ||||||| |||||||  |||
Sbjct: 136661 gcggggtagaacttgggctcggcggcggcggcgggcttgccggccttggggaaggtgccg 136720

                                      
Query: 644    ccgttcttggccttgatggcccag 667
              ||||||||||||||||||||||||
Sbjct: 136721 ccgttcttggccttgatggcccag 136744



 Score =  190 bits (96), Expect = 4e-45
 Identities = 162/184 (88%)
 Strand = Plus / Plus

                                                                          
Query: 237    cctccttctcagtctcaaacagctccccttcagtcttctttgccctggccttcttgtccc 296
              |||||||||| |||||||| || || || || |||||||| ||| | |||||||||||||
Sbjct: 135380 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 135439

                                                                          
Query: 297    tagcaaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtgg 356
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||
Sbjct: 135440 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 135499

                                                                          
Query: 357    atgtggcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaag 416
              ||||||||||||| || ||||||||||| ||||| |  || || ||||||||||| ||||
Sbjct: 135500 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 135559

                  
Query: 417    gtcc 420
              ||||
Sbjct: 135560 gtcc 135563



 Score =  174 bits (88), Expect = 2e-40
 Identities = 103/108 (95%)
 Strand = Plus / Plus

                                                                          
Query: 422    gtgatgaggagcaggccagacttgagctgcttgaggaacaccacgcgcttccccatgtac 481
              ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 136402 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 136461

                                                              
Query: 482    ctcccagcgagcaggatcagcaccgtgccgggcgtgatggtcgacctg 529
              ||||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 136462 ctcccggcgagcaggatcagcaccgtccccggcgtgatggtcgacctg 136509



to top

>emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23,
             complete sequence
          Length = 130273

 Score =  159 bits (80), Expect = 1e-35
 Identities = 133/152 (87%), Gaps = 9/152 (5%)
 Strand = Plus / Plus

                                                                         
Query: 524   gacctgagcttggtaggtttgggcttgcgggtgctggcggtgcggggcttgacgtcgtcg 583
             ||||||||||||||||| |||||||||||||||||||    |||||||||||||||||||
Sbjct: 80735 gacctgagcttggtagggttgggcttgcgggtgctgggctggcggggcttgacgtcgtcg 80794

                                                                         
Query: 584   gcggggtagaacttgggctcggcgacggcggct---------ggcttctcggcctttggg 634
             |||||||||||||||||| ||||| ||||||||         |||||||||||||| |||
Sbjct: 80795 gcggggtagaacttgggcgcggcggcggcggctgcggcggcgggcttctcggccttgggg 80854

                                             
Query: 635   aaggctccgccgttcttggccttgatggccca 666
             ||||| ||||||| ||||||||||||||||||
Sbjct: 80855 aaggcgccgccgtgcttggccttgatggccca 80886



 Score =  159 bits (80), Expect = 1e-35
 Identities = 158/184 (85%)
 Strand = Plus / Plus

                                                                         
Query: 237   cctccttctcagtctcaaacagctccccttcagtcttctttgccctggccttcttgtccc 296
             ||||||||||||||||||| || || || || |||||||| ||| |   |||||||||||
Sbjct: 79304 cctccttctcagtctcaaaaagttcaccctcggtcttcttcgccttctgcttcttgtccc 79363

                                                                         
Query: 297   tagcaaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtgg 356
             |||  |||||||||||||||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 79364 tagagaagtacttgtcatcaaacttctccacattaacaccagagatatcaacctttgtgg 79423

                                                                         
Query: 357   atgtggcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaag 416
             | || |||||||| || | ||||||||| ||||| |  || || ||||||||||| ||||
Sbjct: 79424 acgtagcaatgacgtagggctggttcacacggcggatcggaactccattgatcttaaaag 79483

                 
Query: 417   gtcc 420
             ||||
Sbjct: 79484 gtcc 79487



 Score =  127 bits (64), Expect = 5e-26
 Identities = 97/108 (89%)
 Strand = Plus / Plus

                                                                         
Query: 422   gtgatgaggagcaggccagacttgagctgcttgaggaacaccacgcgcttccccatgtac 481
             |||| ||| |||||||| || |||||||||||||||||||| ||||||||||||||| ||
Sbjct: 80536 gtgacgagaagcaggccggatttgagctgcttgaggaacacgacgcgcttccccatgaac 80595

                                                             
Query: 482   ctcccagcgagcaggatcagcaccgtgccgggcgtgatggtcgacctg 529
             ||||| ||||||||||||||||| || || |||||||||| |||||||
Sbjct: 80596 ctcccggcgagcaggatcagcactgtcccaggcgtgatggacgacctg 80643



 Score =  113 bits (57), Expect = 8e-22
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                         
Query: 91    catctcatggggcttgtcaccgtccctgagagagaaccgggcaccaagatagttcttaag 150
             |||||| ||||||||||| |||||||||||||| ||||| |||||||| ||  | || ||
Sbjct: 79067 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 79126

                                                                         
Query: 151   gtcagggacagcatcgatagccttgatcaactcagcatcaatggccttctggtcatcctt 210
              || |||||||| || ||||| ||||||||||| ||||| |   | |||||||| |||||
Sbjct: 79127 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 79186

                                          
Query: 211   tttgaagtcaggcaggttcttggttgcct 239
             |||||| || |||||||||||||||||||
Sbjct: 79187 tttgaactccggcaggttcttggttgcct 79215



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  159 bits (80), Expect = 1e-35
 Identities = 133/152 (87%), Gaps = 9/152 (5%)
 Strand = Plus / Plus

                                                                            
Query: 524      gacctgagcttggtaggtttgggcttgcgggtgctggcggtgcggggcttgacgtcgtcg 583
                ||||||||||||||||| |||||||||||||||||||    |||||||||||||||||||
Sbjct: 23638054 gacctgagcttggtagggttgggcttgcgggtgctgggctggcggggcttgacgtcgtcg 23638113

                                                                            
Query: 584      gcggggtagaacttgggctcggcgacggcggct---------ggcttctcggcctttggg 634
                |||||||||||||||||| ||||| ||||||||         |||||||||||||| |||
Sbjct: 23638114 gcggggtagaacttgggcgcggcggcggcggctgcggcggcgggcttctcggccttgggg 23638173

                                                
Query: 635      aaggctccgccgttcttggccttgatggccca 666
                ||||| ||||||| ||||||||||||||||||
Sbjct: 23638174 aaggcgccgccgtgcttggccttgatggccca 23638205



 Score =  159 bits (80), Expect = 1e-35
 Identities = 158/184 (85%)
 Strand = Plus / Plus

                                                                            
Query: 237      cctccttctcagtctcaaacagctccccttcagtcttctttgccctggccttcttgtccc 296
                ||||||||||||||||||| || || || || |||||||| ||| |   |||||||||||
Sbjct: 23636623 cctccttctcagtctcaaaaagttcaccctcggtcttcttcgccttctgcttcttgtccc 23636682

                                                                            
Query: 297      tagcaaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtgg 356
                |||  |||||||||||||||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 23636683 tagagaagtacttgtcatcaaacttctccacattaacaccagagatatcaacctttgtgg 23636742

                                                                            
Query: 357      atgtggcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaag 416
                | || |||||||| || | ||||||||| ||||| |  || || ||||||||||| ||||
Sbjct: 23636743 acgtagcaatgacgtagggctggttcacacggcggatcggaactccattgatcttaaaag 23636802

                    
Query: 417      gtcc 420
                ||||
Sbjct: 23636803 gtcc 23636806



 Score =  127 bits (64), Expect = 5e-26
 Identities = 97/108 (89%)
 Strand = Plus / Plus

                                                                            
Query: 422      gtgatgaggagcaggccagacttgagctgcttgaggaacaccacgcgcttccccatgtac 481
                |||| ||| |||||||| || |||||||||||||||||||| ||||||||||||||| ||
Sbjct: 23637855 gtgacgagaagcaggccggatttgagctgcttgaggaacacgacgcgcttccccatgaac 23637914

                                                                
Query: 482      ctcccagcgagcaggatcagcaccgtgccgggcgtgatggtcgacctg 529
                ||||| ||||||||||||||||| || || |||||||||| |||||||
Sbjct: 23637915 ctcccggcgagcaggatcagcactgtcccaggcgtgatggacgacctg 23637962



 Score =  113 bits (57), Expect = 8e-22
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                            
Query: 91       catctcatggggcttgtcaccgtccctgagagagaaccgggcaccaagatagttcttaag 150
                |||||| ||||||||||| |||||||||||||| ||||| |||||||| ||  | || ||
Sbjct: 23636386 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 23636445

                                                                            
Query: 151      gtcagggacagcatcgatagccttgatcaactcagcatcaatggccttctggtcatcctt 210
                 || |||||||| || ||||| ||||||||||| ||||| |   | |||||||| |||||
Sbjct: 23636446 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 23636505

                                             
Query: 211      tttgaagtcaggcaggttcttggttgcct 239
                |||||| || |||||||||||||||||||
Sbjct: 23636506 tttgaactccggcaggttcttggttgcct 23636534



to top

>emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16
          Length = 1015

 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                       
Query: 302 aagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtggatgtg 361
           |||||||||||||||||||||||||| || |||||||| ||||||||||| || || |||
Sbjct: 541 aagtacttgtcatcaaacttctccacattgacaccagaaatgtcaaccttggttgaggtg 482

                                                                       
Query: 362 gcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaaggtcca 421
           ||||| ||||| || |||||||| || |  |  ||||||||||||| ||| ||||| |||
Sbjct: 481 gcaataacataggcttggttcacacgcctcagagggacaccattgaccttaaaaggacca 422

               
Query: 422 gtga 425
           ||||
Sbjct: 421 gtga 418



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 571 cttgacgtcgtcggcggggtagaacttggg 600
           |||||| |||||||| ||||||||||||||
Sbjct: 272 cttgacatcgtcggcagggtagaacttggg 243



to top

>dbj|AB167080.1| Curculigo latifolia NAS-2 mRNA for neoculin acid subunit, complete
           cds
          Length = 655

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 446 agctgcttgaggaacaccacgcgcttccccatgtacctcccagcgagcaggatcagcacc 505
           |||||||| ||||| || || | |||||||||| ||||||| ||||| ||||||||||||
Sbjct: 1   agctgcttcaggaaaacgaccctcttccccatgaacctcccggcgagaaggatcagcacc 60

                                                        
Query: 506 gtgccgggcgtgatggtcgacctgagcttggtaggtttgggcttg 550
           || || || || ||| ||| |||||||||||| || |||||||||
Sbjct: 61  gtccccggagtaatgctcggcctgagcttggtgggcttgggcttg 105



to top

>gb|DQ226579.1| Boechera divaricarpa isolate SLW-2-D10 mRNA sequence
          Length = 693

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 100/121 (82%)
 Strand = Plus / Plus

                                                                       
Query: 300 caaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtggatg 359
           |||| ||||||||||| || ||||| |  || || ||||||||||||||||||||||| |
Sbjct: 309 caaaatacttgtcatcgaatttctcaatgttgactccagagatgtcaacctttgtggaag 368

                                                                       
Query: 360 tggcaatgacataagcctggttcacccggcgaactgggacaccattgatcttgaaaggtc 419
           |  |||| ||||| |||||||| || || |  | ||| ||||||||||||||||| ||||
Sbjct: 369 ttccaatcacataggcctggttaacacgtctcaatggaacaccattgatcttgaatggtc 428

            
Query: 420 c 420
           |
Sbjct: 429 c 429



to top

>ref|NM_106066.3| Arabidopsis thaliana structural constituent of ribosome AT1G74060
           mRNA, complete cds
          Length = 967

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 taacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggc 389
           |||| ||||| ||||||||||||||||| ||  |||||||||| |||||||| || || |
Sbjct: 522 taactccagaaatgtcaacctttgtggaagtaccaatgacataggcctggttaacacgtc 463

                                             
Query: 390 gaactgggacaccattgatcttgaaaggtccagt 423
             |  || ||||||||||||||||| ||||||||
Sbjct: 462 tcagaggaacaccattgatcttgaatggtccagt 429



to top

>gb|AY062622.1| Arabidopsis thaliana putative 60S ribosomal protein L6 (F2P9.7)
           mRNA, complete cds
          Length = 942

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 taacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggc 389
           |||| ||||| ||||||||||||||||| ||  |||||||||| |||||||| || || |
Sbjct: 517 taactccagaaatgtcaacctttgtggaagtaccaatgacataggcctggttaacacgtc 458

                                             
Query: 390 gaactgggacaccattgatcttgaaaggtccagt 423
             |  || ||||||||||||||||| ||||||||
Sbjct: 457 tcagaggaacaccattgatcttgaatggtccagt 424



to top

>emb|BX814470.1|CNS0ADLC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 942

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 taacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggc 389
           |||| ||||| ||||||||||||||||| ||  |||||||||| |||||||| || || |
Sbjct: 514 taactccagaaatgtcaacctttgtggaagtaccaatgacataggcctggttaacacgtc 455

                                             
Query: 390 gaactgggacaccattgatcttgaaaggtccagt 423
             |  || ||||||||||||||||| ||||||||
Sbjct: 454 tcagaggaacaccattgatcttgaatggtccagt 421



to top

>gb|BT002588.1| Arabidopsis thaliana putative 60S ribosomal protein L6 (At1g74060)
           mRNA, complete cds
          Length = 789

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 taacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggc 389
           |||| ||||| ||||||||||||||||| ||  |||||||||| |||||||| || || |
Sbjct: 454 taactccagaaatgtcaacctttgtggaagtaccaatgacataggcctggttaacacgtc 395

                                             
Query: 390 gaactgggacaccattgatcttgaaaggtccagt 423
             |  || ||||||||||||||||| ||||||||
Sbjct: 394 tcagaggaacaccattgatcttgaatggtccagt 361



to top

>ref|NM_106064.2| Arabidopsis thaliana structural constituent of ribosome AT1G74050
           mRNA, complete cds
          Length = 1035

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
           ||||| ||||||||||||||||| ||| |||| ||||| |||||||| || || |  |  
Sbjct: 575 ccagaaatgtcaacctttgtggaagtgccaatcacataggcctggttaacacgtctcaaa 516

                                        
Query: 395 gggacaccattgatcttgaaaggtccagt 423
           || ||||||||||||||||| ||||||||
Sbjct: 515 ggaacaccattgatcttgaatggtccagt 487



to top

>ref|XM_571207.1| Cryptococcus neoformans var. neoformans JEC21 structural
           constituent of ribosome (CNE03060) partial mRNA
          Length = 764

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 332 acaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcga 391
           ||||| |||||||| ||||| ||||| |||||||||||||| |||||| |||| || |||
Sbjct: 480 acaccggagatgtcgaccttggtggaagtggcaatgacataggcctggctcactcgacga 421

                                
Query: 392 actgggacaccattgatcttg 412
           |  |||||||| |||| ||||
Sbjct: 420 agagggacaccgttgagcttg 400



to top

>gb|AY114641.1| Arabidopsis thaliana putative 60S ribosomal protein L6 (At1g74050)
           mRNA, complete cds
          Length = 891

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
           ||||| ||||||||||||||||| ||| |||| ||||| |||||||| || || |  |  
Sbjct: 449 ccagaaatgtcaacctttgtggaagtgccaatcacataggcctggttaacacgtctcaaa 390

                                        
Query: 395 gggacaccattgatcttgaaaggtccagt 423
           || ||||||||||||||||| ||||||||
Sbjct: 389 ggaacaccattgatcttgaatggtccagt 361



to top

>gb|AY081305.1| Arabidopsis thaliana putative 60S ribosomal protein L6 (At1g74050)
           mRNA, complete cds
          Length = 960

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
           ||||| ||||||||||||||||| ||| |||| ||||| |||||||| || || |  |  
Sbjct: 501 ccagaaatgtcaacctttgtggaagtgccaatcacataggcctggttaacacgtctcaaa 442

                                        
Query: 395 gggacaccattgatcttgaaaggtccagt 423
           || ||||||||||||||||| ||||||||
Sbjct: 441 ggaacaccattgatcttgaatggtccagt 413



to top

>gb|AY054573.1| Arabidopsis thaliana putative 60S ribosomal protein L6 (At1g74050;
           F2P9.8) mRNA, complete cds
          Length = 892

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
           ||||| ||||||||||||||||| ||| |||| ||||| |||||||| || || |  |  
Sbjct: 505 ccagaaatgtcaacctttgtggaagtgccaatcacataggcctggttaacacgtctcaaa 446

                                        
Query: 395 gggacaccattgatcttgaaaggtccagt 423
           || ||||||||||||||||| ||||||||
Sbjct: 445 ggaacaccattgatcttgaatggtccagt 417



to top

>gb|AY087325.1| Arabidopsis thaliana clone 3418 mRNA, complete sequence
          Length = 985

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
           ||||| ||||||||||||||||| ||| |||| ||||| |||||||| || || |  |  
Sbjct: 575 ccagaaatgtcaacctttgtggaagtgccaatcacataggcctggttaacacgtctcaaa 516

                                        
Query: 395 gggacaccattgatcttgaaaggtccagt 423
           || ||||||||||||||||| ||||||||
Sbjct: 515 ggaacaccattgatcttgaatggtccagt 487



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                          
Query: 332    acaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcga 391
              ||||| |||||||| ||||| ||||| |||||||||||||| |||||| |||| || |||
Sbjct: 868852 acaccggagatgtcgaccttggtggaagtggcaatgacataggcctggctcactcgacga 868793

                              
Query: 392    actgggacaccattga 407
              |  |||||||| ||||
Sbjct: 868792 agagggacaccgttga 868777



to top

>gb|AC016662.7|AC016662 Arabidopsis thaliana chromosome 1 BAC F2P9 genomic sequence, complete
             sequence
          Length = 108387

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                         
Query: 330   taacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggc 389
             |||| ||||| ||||||||||||||||| ||  |||||||||| |||||||| || || |
Sbjct: 22757 taactccagaaatgtcaacctttgtggaagtaccaatgacataggcctggttaacacgtc 22698

                                            
Query: 390   gaactgggacaccattgatcttgaaaggtcc 420
               |  || ||||||||||||||||| |||||
Sbjct: 22697 tcagaggaacaccattgatcttgaatggtcc 22667



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                         
Query: 335   ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
             ||||| ||||||||||||||||| ||| |||| ||||| |||||||| || || |  |  
Sbjct: 25490 ccagaaatgtcaacctttgtggaagtgccaatcacataggcctggttaacacgtctcaaa 25431

                                       
Query: 395   gggacaccattgatcttgaaaggtcc 420
             || ||||||||||||||||| |||||
Sbjct: 25430 ggaacaccattgatcttgaatggtcc 25405



to top

>emb|BX814105.1|CNS0ADRY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB57ZF05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 440

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 330 taacaccagagatgtcaacctttgtggatgtggcaatgacataagcctggtt 381
           |||| ||||| ||||||||||||||||| ||| |||| ||||| ||||||||
Sbjct: 63  taactccagaaatgtcaacctttgtggaagtgccaatcacataggcctggtt 12



to top

>gb|DQ214771.1| Taeniopygia guttata clone 0061P0023H09 ribosomal protein L6
           internal polyA variant-like mRNA, complete sequence
          Length = 950

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 490 gagcaggatcagcaccgtgccgggcgtgatgg 521
           ||||||||| |||||||||||||| |||||||
Sbjct: 493 gagcaggatgagcaccgtgccgggggtgatgg 462



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 347 acctttgtggatgtggcaat 366
           ||||||||||||||||||||
Sbjct: 636 acctttgtggatgtggcaat 617



to top

>gb|DQ214770.1| Taeniopygia guttata clone 0061P0025H04 ribosomal protein L6
           internal polyA variant-like mRNA, complete sequence
          Length = 959

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 490 gagcaggatcagcaccgtgccgggcgtgatgg 521
           ||||||||| |||||||||||||| |||||||
Sbjct: 503 gagcaggatgagcaccgtgccgggggtgatgg 472



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 347 acctttgtggatgtggcaat 366
           ||||||||||||||||||||
Sbjct: 646 acctttgtggatgtggcaat 627



to top

>gb|AC155898.15| Medicago truncatula clone mth2-109f1, complete sequence
          Length = 93173

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 aaagtacttgtcatcaaacttctccaccttaacaccagagatgtcaacctttgtggatgt 360
           |||||||||||||||||  || ||||| |||||||| ||||| || || || || |||||
Sbjct: 486 aaagtacttgtcatcaaggttatccacattaacaccggagatatcgactttggttgatgt 427

                                   
Query: 361 ggcaatgacataagcctggttcac 384
             |||| ||||| ||||| |||||
Sbjct: 426 accaatcacataggcctgattcac 403



to top

>dbj|AB035569.1| Chara globularis cgrpl6 mRNA for 60S ribosomal protein L6 CgRPL6,
           partial cds
          Length = 609

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 440 gacttgagctgcttgaggaacaccacgcgctt 471
           |||| ||||||||||||||| |||||||||||
Sbjct: 224 gactcgagctgcttgaggaataccacgcgctt 193



to top

>emb|BX065431.1|CNS09MNF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 505 gcgagcaggatcagcaccttgccgggc 531



to top

>emb|BX065430.1|CNS09MNE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 440 gcgagcaggatcagcaccttgccgggc 414



to top

>emb|BX062222.1|CNS09K6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 378 gcgagcaggatcagcaccttgccgggc 352



to top

>emb|BX057445.1|CNS09GHL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 430 gcgagcaggatcagcaccttgccgggc 404



to top

>emb|BX048593.1|CNS099NP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 598 gcgagcaggatcagcaccttgccgggc 624



to top

>emb|BX048592.1|CNS099NO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 434 gcgagcaggatcagcaccttgccgggc 408



to top

>emb|BX047227.1|CNS098LR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 390 gcgagcaggatcagcaccttgccgggc 416



to top

>emb|BX047226.1|CNS098LQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 437 gcgagcaggatcagcaccttgccgggc 411



to top

>emb|BX042740.1|CNS09554 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 442 gcgagcaggatcagcaccttgccgggc 416



to top

>ref|XM_321154.2| Anopheles gambiae str. PEST ENSANGP00000020813
           (ENSANGG00000018324), partial mRNA
          Length = 946

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 488 gcgagcaggatcagcaccgtgccgggc 514
           |||||||||||||||||| ||||||||
Sbjct: 362 gcgagcaggatcagcaccttgccgggc 336



to top

>gb|DQ384529.1| Panax ginseng clone PG6L-6 unknown mRNA
          Length = 624

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 571 cttgacgtcgtcggcggggtagaacttggg 600
           |||||||||||| || ||||||||||||||
Sbjct: 288 cttgacgtcgtcagctgggtagaacttggg 259



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 299 gcaaagtacttgtcatcaaacttctcca 326
           |||||||||||||| ||| |||||||||
Sbjct: 560 gcaaagtacttgtcgtcatacttctcca 533



to top

>gb|AY088336.1| Arabidopsis thaliana clone 573 mRNA, complete sequence
          Length = 832

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 335 ccagagatgtcaacctttgtggatgtggcaatgacataagcctggttcacccggcgaact 394
           ||||| ||||||||||||||||| ||  |||| ||||| || ||||| || || |  | |
Sbjct: 477 ccagaaatgtcaacctttgtggaggttccaatcacataggcttggttaacacgtctcaat 418

                                     
Query: 395 gggacaccattgatcttgaaaggtcc 420
           || |||||||| |||||||| |||||
Sbjct: 417 ggaacaccattaatcttgaatggtcc 392



to top

>gb|AY674237.1| Ixodes pacificus clone IP_7_60_92_78_CLU ribosomal protein L6 mRNA,
           complete cds
          Length = 807

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 431 agcaggccagacttgagctgcttgaggaacaccacgcgctt 471
           |||||||| | ||| |||||||| ||||||||||| |||||
Sbjct: 446 agcaggcccgtcttcagctgcttcaggaacaccacacgctt 406



to top

>ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (MG01745.4) partial
           mRNA
          Length = 1389

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 295 cctagcaaagtacttgtcatc 315
           |||||||||||||||||||||
Sbjct: 798 cctagcaaagtacttgtcatc 778



to top

>emb|BX649433.4| Zebrafish DNA sequence from clone DKEY-215P16 in linkage group 7,
             complete sequence
          Length = 77241

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 134   ccaagatagttcttaaggtca 154
             |||||||||||||||||||||
Sbjct: 51238 ccaagatagttcttaaggtca 51258



to top

>emb|AL928677.6| Zebrafish DNA sequence from clone BUSM1-70B1 in linkage group 7
             Contains a novel gene similar to mouse and rodent CHRNA7
             (cholinergic receptor, nicotinic, alpha polypeptide 7), a
             novel gene and two CpG islands, complete sequence
          Length = 144076

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 134   ccaagatagttcttaaggtca 154
             |||||||||||||||||||||
Sbjct: 62863 ccaagatagttcttaaggtca 62843



to top

>emb|AL590447.1|CNS07EGE chromosome VII of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 226576

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 270    tcttctttgccctggccttct 290
              |||||||||||||||||||||
Sbjct: 139403 tcttctttgccctggccttct 139383



to top

>dbj|AB109375.1| Tribolodon hakonensis GDH mRNA for glutamate dehydrogenase, complete
            cds
          Length = 3540

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 446  agctgcttgaggaacaccacgcgcttccc 474
            |||||||||||||| ||||| ||||||||
Sbjct: 3081 agctgcttgaggaagaccacacgcttccc 3109



to top

>dbj|AP002754.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-855O10, complete
              sequence
          Length = 185766

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 617    ggcttctcggcctttgggaag 637
              |||||||||||||||||||||
Sbjct: 152737 ggcttctcggcctttgggaag 152757



to top

>dbj|AP002380.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-467L20, complete
             sequence
          Length = 188788

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 617   ggcttctcggcctttgggaag 637
             |||||||||||||||||||||
Sbjct: 49824 ggcttctcggcctttgggaag 49844



to top

>emb|AL929433.10| Mouse DNA sequence from clone RP23-193M23 on chromosome 4, complete
              sequence
          Length = 198426

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 421    agtgatgaggagcaggccaga 441
              |||||||||||||||||||||
Sbjct: 165237 agtgatgaggagcaggccaga 165257



to top

>gb|AC004770.1|AC004770 Homo sapiens chromosome 11, BAC CIT-HSP-311e8 (BC269730) containing the
              hFEN1 gene, complete sequence
          Length = 185035

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 617    ggcttctcggcctttgggaag 637
              |||||||||||||||||||||
Sbjct: 151494 ggcttctcggcctttgggaag 151474



to top

>gb|BC076927.1| Xenopus tropicalis matrix metalloproteinase 9 (gelatinase B, 92kDa
            gelatinase, 92kDa type IV collagenase), mRNA (cDNA clone
            MGC:89173 IMAGE:7016488), complete cds
          Length = 2746

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 312  catcaaacttctccacctta 331
            ||||||||||||||||||||
Sbjct: 1513 catcaaacttctccacctta 1494



to top

>gb|AC145554.2| Mus musculus BAC clone RP23-217E22 from chromosome 18, complete
             sequence
          Length = 214489

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 421   agtgatgaggagcaggccag 440
             ||||||||||||||||||||
Sbjct: 40024 agtgatgaggagcaggccag 40005



to top

>ref|XM_591972.2| PREDICTED: Bos taurus similar to Sodium/hydrogen exchanger 2
           (Na(+)/H(+) exchanger 2) (NHE-2) (Solute carrier family
           9 member 2) (H7) (LOC514166), partial mRNA
          Length = 959

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 304 gtacttgtcatcaaacttct 323
           ||||||||||||||||||||
Sbjct: 25  gtacttgtcatcaaacttct 6



to top

>ref|XM_716459.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
            subunit Rpn3p (CaO19_3054), mRNA
          Length = 1446

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 202  gtcatcctttttgaagtcag 221
            ||||||||||||||||||||
Sbjct: 1020 gtcatcctttttgaagtcag 1001



to top

>ref|XM_716188.1| Candida albicans SC5314 putative 26S proteasome regulatory particle
            subunit Rpn3p (CaO19_10572), mRNA
          Length = 1446

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 202  gtcatcctttttgaagtcag 221
            ||||||||||||||||||||
Sbjct: 1020 gtcatcctttttgaagtcag 1001



to top

>ref|XM_752221.1| Ustilago maydis 521 hypothetical protein (UM01167.1) partial mRNA
          Length = 3945

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   agaaggtcatctcatggggc 103
            ||||||||||||||||||||
Sbjct: 2466 agaaggtcatctcatggggc 2485



to top

>ref|XM_533873.2| PREDICTED: Canis familiaris similar to peptidylprolyl isomerase A
           isoform 1 (LOC609903), mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 302 aagtacttgtcatcaaacttctcc 325
           |||| |||||||||||||||||||
Sbjct: 286 aagttcttgtcatcaaacttctcc 263



to top

>gb|AC117260.3| Mus musculus BAC clone RP24-498G10 from chromosome 18, complete
             sequence
          Length = 211919

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 421   agtgatgaggagcaggccag 440
             ||||||||||||||||||||
Sbjct: 71898 agtgatgaggagcaggccag 71917



to top

>gb|AC121871.3| Mus musculus BAC clone RP24-121J1 from chromosome 10, complete sequence
          Length = 214405

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 191    atggccttctggtcatcctt 210
              ||||||||||||||||||||
Sbjct: 125642 atggccttctggtcatcctt 125623



to top

>gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete sequence
          Length = 113744

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 302   aagtacttgtcatcaaactt 321
             ||||||||||||||||||||
Sbjct: 68034 aagtacttgtcatcaaactt 68015



to top

>gb|AF517879.1| Griffithsia japonica isolate Gj550 ribosome protein L6 mRNA,
           complete cds
          Length = 764

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 446 agctgcttgaggaacaccacgcgc 469
           ||||||||||||| ||||||||||
Sbjct: 329 agctgcttgaggaccaccacgcgc 306



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 172     cttgatcaactcagcatcaa 191
               ||||||||||||||||||||
Sbjct: 3482500 cttgatcaactcagcatcaa 3482519



to top

>emb|BX640451.1| Bordetella bronchiseptica strain RB50, complete genome; segment 15/16
          Length = 343473

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 499    cagcaccgtgccgggcgtga 518
              ||||||||||||||||||||
Sbjct: 143942 cagcaccgtgccgggcgtga 143923



to top

>gb|AY831461.1| Pseudomonas putida plasmid pKW1 putative porin gene, partial cds;
            ORF2 gene, complete cds; meta operon, complete sequence;
            and ORF3, and ORF4 genes, complete cds
          Length = 9632

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 360  tggcaatgacataagcctggttca 383
            |||||||| |||||||||||||||
Sbjct: 5022 tggcaatggcataagcctggttca 5045



to top

>emb|BX640412.1| Bordetella pertussis strain Tohama I, complete genome; segment 2/12
          Length = 348171

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 499    cagcaccgtgccgggcgtga 518
              ||||||||||||||||||||
Sbjct: 299732 cagcaccgtgccgggcgtga 299713



to top

>ref|NM_001006842.1| Xenopus tropicalis matrix metalloproteinase 9 (gelatinase B, 92kDa
            gelatinase, 92kDa type IV collagenase) (mmp9), mRNA
          Length = 2746

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 312  catcaaacttctccacctta 331
            ||||||||||||||||||||
Sbjct: 1513 catcaaacttctccacctta 1494



to top

>emb|BX321865.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 10/10
          Length = 66094

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 504   ccgtgccgggcgtgatggtc 523
             ||||||||||||||||||||
Sbjct: 57135 ccgtgccgggcgtgatggtc 57116



to top

>gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthetic gene cluster and
             flanking regions
          Length = 116831

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 419   ccagtgatgaggagcaggcc 438
             ||||||||||||||||||||
Sbjct: 39372 ccagtgatgaggagcaggcc 39353



to top

>emb|AL627426.19| Mouse DNA sequence from clone RP23-168D2 on chromosome 11 Contains the
             5' end of a novel gene, complete sequence
          Length = 96727

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 648   tcttggccttgatggcccag 667
             ||||||||||||||||||||
Sbjct: 28543 tcttggccttgatggcccag 28562



to top

>emb|AL592215.12| Mouse DNA sequence from clone RP23-172P19 on chromosome 11 Contains two
             novel genes (4930452L02Rik and B430319H21Rik), the 3' end
             of the gene for a novel protein (1700019I23Rik), the gene
             for a novel protein (4933407G07Rik), the Pmp22 gene for
             peripheral myelin protein and a CpG island, complete
             sequence
          Length = 219468

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 421   agtgatgaggagcaggccag 440
             ||||||||||||||||||||
Sbjct: 90411 agtgatgaggagcaggccag 90430



to top

>dbj|AB226127.1| Aspergillus oryzae cDNA, contig sequence: AoEST2984
          Length = 929

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 90  tcatctcatggggcttgtcaccgt 113
           ||||||| ||||||||||||||||
Sbjct: 658 tcatctcgtggggcttgtcaccgt 635



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 600     gctcggcgacggcggctggcttct 623
               ||||||||||| ||||||||||||
Sbjct: 4556380 gctcggcgacgccggctggcttct 4556403



to top

>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 90     tcatctcatggggcttgtcaccgt 113
              ||||||| ||||||||||||||||
Sbjct: 769646 tcatctcgtggggcttgtcaccgt 769669



to top

>gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 141266

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   aaagtacttgtcatcaaact 320
             ||||||||||||||||||||
Sbjct: 99726 aaagtacttgtcatcaaact 99707



to top

>gb|AC159625.2| Mus musculus BAC clone RP24-262L7 from chromosome 12, complete sequence
          Length = 189979

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ggtcatctcatggggcttgt 107
             ||||||||||||||||||||
Sbjct: 31984 ggtcatctcatggggcttgt 31965



to top

>gb|AC067947.6| Homo sapiens BAC clone RP11-492I5 from 2, complete sequence
          Length = 137457

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 648   tcttggccttgatggcccag 667
             ||||||||||||||||||||
Sbjct: 45590 tcttggccttgatggcccag 45609



to top

>emb|AJ276271.1|CAR276271 Cicer arietinum mRNA for putative 60S ribosomal protein L6 (ORF1)
          Length = 905

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 632 gggaaggctccgccgttcttggccttgatggcccag 667
           ||||| || |||||||  ||||||||||||||||||
Sbjct: 158 gggaaagcgccgccgtgtttggccttgatggcccag 123



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 559     ggcggtgcggggcttgacgtcgtcggcg 586
               |||| |||||||||||||| ||||||||
Sbjct: 2406503 ggcgatgcggggcttgacgccgtcggcg 2406476



to top

>gb|AC078927.20| Homo sapiens 12 BAC RP11-745O10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 125777

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     tcatctcatggggcttgtca 109
              ||||||||||||||||||||
Sbjct: 108030 tcatctcatggggcttgtca 108049



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 270    tcttctttgccctggccttc 289
              ||||||||||||||||||||
Sbjct: 381469 tcttctttgccctggccttc 381488



to top

>emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on chromosome 17, complete
              sequence
          Length = 122522

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 444    tgagctgcttgaggaacaccacgc 467
              |||||||| |||||||||||||||
Sbjct: 100732 tgagctgcctgaggaacaccacgc 100709



to top

>gb|U93491.1|MUU93491 Meriones unguiculatus NHE-2 mRNA, partial cds
          Length = 317

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 304 gtacttgtcatcaaacttct 323
           ||||||||||||||||||||
Sbjct: 83  gtacttgtcatcaaacttct 64



to top

>gb|AY823671.1| Glycine max HDZip I protein mRNA, complete cds
          Length = 1747

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 644 ccgttcttggccttgatggcccag 667
           ||||| ||||||||||||||||||
Sbjct: 71  ccgtttttggccttgatggcccag 94


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,552,391
Number of Sequences: 3902068
Number of extensions: 5552391
Number of successful extensions: 121892
Number of sequences better than 10.0: 86
Number of HSP's better than 10.0 without gapping: 85
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 121453
Number of HSP's gapped (non-prelim): 423
length of query: 667
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 644
effective length of database: 17,143,297,704
effective search space: 11040283721376
effective search space used: 11040283721376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top