ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3m01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 731 0.0
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 335 9e-89
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 327 2e-86
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 319 5e-84
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 311 1e-81
6gb|AY109332.1| Zea mays CL502_5 mRNA sequence 311 1e-81
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 283 3e-73
8ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 276 7e-71
9ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 276 7e-71
10ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 276 7e-71
11dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 7e-71
12dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 7e-71
13dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 7e-71
14dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 7e-71
15dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
16gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 228 1e-56
17dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 228 1e-56
18gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 224 2e-55
19ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 216 6e-53
20dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 216 6e-53
21gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 200 3e-48
22gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 192 8e-46
23ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 186 5e-44
24dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 5e-44
25ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 182 8e-43
26ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 182 8e-43
27dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 8e-43
28dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 176 5e-41
29gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 172 7e-40
30gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 172 7e-40
31dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 170 3e-39
32dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 170 3e-39
33emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 167 5e-38
34ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 157 4e-35
35dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
36dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
37dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 153 7e-34
38dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 153 7e-34
39gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 151 3e-33
40gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 151 3e-33
41dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 151 3e-33
42gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 149 1e-32
43dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 149 1e-32
44gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 145 2e-31
45ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 143 7e-31
46gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 143 7e-31
47dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
48dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
49dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
50dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
51emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 137 4e-29
52dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 4e-29
53dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 4e-29
54dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 4e-29
55gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 137 4e-29
56dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 137 4e-29
57ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 135 2e-28
58emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 135 2e-28
59gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 135 2e-28
60dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
61dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
62dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
63dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
64gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 131 3e-27
65gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 131 3e-27
66gb|AY103580.1| Zea mays PCO072544 mRNA sequence 131 3e-27
67gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 129 1e-26
68ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 129 1e-26
69dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-26
70gb|AY107589.1| Zea mays PCO085320 mRNA sequence 129 1e-26
71emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 127 4e-26
72emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 127 4e-26
73dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 127 4e-26
74gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 127 4e-26
75dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 127 4e-26
76gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 121 2e-24
77dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-23
78dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-23
79gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 115 2e-22
80gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 113 6e-22
81gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 113 6e-22
82emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 113 6e-22
83gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 111 2e-21
84gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 111 2e-21
85gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 111 2e-21
86gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 111 2e-21
87emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 109 9e-21
88gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 109 9e-21
89gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 107 4e-20
90gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 107 4e-20
91dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
92gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 107 4e-20
93gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 107 4e-20
94ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 105 1e-19
95emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 105 1e-19
96dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
97dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-19
98gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 105 1e-19
99emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 101 2e-18
100gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 101 2e-18
101gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 101 2e-18
102gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 101 2e-18
103dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 101 2e-18
104emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 100 9e-18
105emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 100 9e-18
106gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 100 9e-18
107gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 98 4e-17
108gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 98 4e-17
109gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 98 4e-17
110gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 98 4e-17
111gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 96 1e-16
112gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 96 1e-16
113emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ... 94 6e-16
114dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 94 6e-16
115dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ... 94 6e-16
116dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 94 6e-16
117dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 94 6e-16
118ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 92 2e-15
119gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 92 2e-15
120gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 92 2e-15
121gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 92 2e-15
122gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 92 2e-15
123emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 92 2e-15
124emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protei... 88 3e-14
125gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 88 3e-14
126emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 88 3e-14
127dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
128gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 88 3e-14
129dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
130dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
131dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
132dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
133dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
134gb|AY107675.1| Zea mays PCO112712 mRNA sequence 88 3e-14
135dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
136gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 86 1e-13
137gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 86 1e-13
138dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 86 1e-13
139gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 86 1e-13
140dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 86 1e-13
141emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 84 5e-13
142emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 84 5e-13
143dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 84 5e-13
144ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3... 82 2e-12
145ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 82 2e-12
146gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 82 2e-12
147gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 82 2e-12
148gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 82 2e-12
149emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
150emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
151emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
152emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
153emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
154emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
155emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
156emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
157emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
158emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
159emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
160gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 82 2e-12
161gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s... 82 2e-12
162dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 82 2e-12
163gb|AY333929.1| Pringlea antiscorbutica putative transmembrane pr... 78 3e-11
164emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 78 3e-11
165gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 78 3e-11
166gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 78 3e-11
167gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 78 3e-11
168gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 78 3e-11
169emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic... 76 1e-10
170emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 76 1e-10
171dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 76 1e-10
172dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in... 76 1e-10
173dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 76 1e-10
174ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5... 74 5e-10
175ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)... 74 5e-10
176ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37... 74 5e-10
177emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 74 5e-10
178gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (... 74 5e-10
179emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins... 74 5e-10
180emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins... 74 5e-10
181gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m... 74 5e-10
182gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr... 74 5e-10
183gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ... 74 5e-10
184gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ... 74 5e-10
185gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 74 5e-10
186gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr... 74 5e-10
187gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co... 74 5e-10
188emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
189emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
190emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
191emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
192gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s... 74 5e-10
193gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s... 74 5e-10
194dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran... 74 5e-10
195gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 74 5e-10
196ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 72 2e-09
197ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 72 2e-09
198gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 72 2e-09
199emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 72 2e-09
200emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major ... 72 2e-09
201gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 72 2e-09
202gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 72 2e-09
203dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 72 2e-09
204gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 72 2e-09
205emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
206emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
207dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 72 2e-09
208dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 72 2e-09
209dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 72 2e-09
210gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 72 2e-09
211gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence 70 8e-09
212emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 70 8e-09
213emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb... 70 8e-09
214emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb... 70 8e-09
215emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 70 8e-09
216emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 70 8e-09
217gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map... 68 3e-08
218emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BA... 68 3e-08
219gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel... 68 3e-08
220gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 68 3e-08
221gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins... 68 3e-08
222dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 68 3e-08
223ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe... 66 1e-07
224gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence 66 1e-07
225gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 66 1e-07
226gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro... 66 1e-07
227gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN... 66 1e-07
228gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 66 1e-07
229gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s... 66 1e-07
230gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA 64 5e-07
231gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 64 5e-07
232emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c... 64 5e-07
233emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 64 5e-07
234emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for... 64 5e-07
235gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 64 5e-07
236emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 64 5e-07
237gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10 64 5e-07
238gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10 64 5e-07
239ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 62 2e-06
240gb|DQ226558.1| Boechera divaricarpa isolate SLW-1-E08 mRNA sequence 62 2e-06
241emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 62 2e-06
242gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 62 2e-06
243emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
244gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic ... 62 2e-06
245gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 62 2e-06
246gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 62 2e-06
247dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo... 62 2e-06
248ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6... 60 8e-06
249gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin... 60 8e-06
250emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene) 60 8e-06
251gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 60 8e-06
252gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 60 8e-06
253gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com... 60 8e-06
254emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co... 60 8e-06
255gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se... 60 8e-06
256gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA... 60 8e-06
257ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 58 3e-05
258gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 58 3e-05
259emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1 58 3e-05
260gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 58 3e-05
261emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 58 3e-05
262emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA... 58 3e-05
263emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 58 3e-05
264emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 58 3e-05
265gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 58 3e-05
266gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 58 3e-05
267dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 58 3e-05
268dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in... 58 3e-05
269gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 58 3e-05
270dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 3e-05
271dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
272gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl... 58 3e-05
273dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 58 3e-05
274gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 56 1e-04
275gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 56 1e-04
276emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
277emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 56 1e-04
278dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 56 1e-04
279emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1... 56 1e-04
280gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 56 1e-04
281gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 56 1e-04
282gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia... 54 5e-04
283emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial 54 5e-04
284gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 54 5e-04
285gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 54 5e-04
286gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 54 5e-04
287gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 54 5e-04
288dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote... 54 5e-04
289emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins... 52 0.002
290gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.002
291gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 52 0.002
292dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 52 0.002
293gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.002
294ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 50 0.007
295gb|DQ018114.1| Physcomitrella patens plasma membrane aquaporin (... 50 0.007
296gb|AF499725.1| Thellungiella halophila plasma membrane intrinsic... 50 0.007
297gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquapori... 50 0.007
298gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 50 0.007
299gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 50 0.007
300gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.007
301gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.007
302emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 50 0.007
303emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 50 0.007
304gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 50 0.007
305emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.007
306emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 50 0.007
307gb|U60147.1|BVU60147 Beta vulgaris plasma membrane major intrins... 50 0.007
308emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein 48 0.029
309gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P... 48 0.029
310emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co... 48 0.029
311gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thali... 48 0.029
312gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 48 0.029
313gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 48 0.029
314emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 48 0.029
315gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic ... 48 0.029
316gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds 48 0.029
317ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 46 0.12
318ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 46 0.12
319gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 46 0.12
320gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 46 0.12
321emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1 46 0.12
322emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 46 0.12
323emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 46 0.12
324gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 46 0.12
325emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 46 0.12
326gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 46 0.12
327gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.12
328gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.12
329gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 46 0.12
330gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 46 0.12
331gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 46 0.12
332emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 46 0.12
333emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 46 0.12
334emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 46 0.12
335emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 46 0.12
336emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 46 0.12
337emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 46 0.12
338emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 46 0.12
339emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 46 0.12
340dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.12
341gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 46 0.12
342gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 46 0.12
343gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 46 0.12
344dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 46 0.12
345emb|AJ457188.2|PEU457188 Populus euramericana partial mRNA for p... 46 0.12
346gb|AF051202.1|AF051202 Picea mariana probable aquaporin (Sb01) m... 46 0.12
347gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 46 0.12
348gb|AY961920.1| Picea abies probable aquaporin (Aqp) mRNA, comple... 44 0.46
349emb|AJ515031.1|CAR515031 Cicer arietinum partial mRNA for aquopo... 44 0.46
350emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.46
351gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.46
352gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.46
353gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.8
354gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.8
355gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.8
356ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.8
357emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.8
358emb|AJ243307.1|PSA243307 Pisum sativum mRNA for putative plasma ... 42 1.8
359gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 42 1.8
360gb|DQ354110.1| Streptomyces violaceusniger strain DSM 4137 polye... 42 1.8
361gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch... 42 1.8
362dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.8
363gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.8
364gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 42 1.8
365emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 42 1.8
366gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.8
367gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.8
368gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.8
369gb|AE000657.1| Aquifex aeolicus VF5, complete genome 42 1.8
370gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 42 1.8
371dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 42 1.8
372gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 7.2
373gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 7.2
374gb|AC016250.5| Homo sapiens chromosome 8 clone RP11-516P9, compl... 40 7.2
375gb|AE014075.1| Escherichia coli CFT073, complete genome 40 7.2
376gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 7.2
377emb|BX545848.23| Zebrafish DNA sequence from clone DKEY-8O19 in ... 40 7.2
378emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 7.2
379emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 7.2
380gb|AC025207.5| Homo sapiens chromosome 8, clone RP11-193J8, comp... 40 7.2
381emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 7.2
382gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 7.2
383gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 40 7.2
384gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 7.2
385dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in... 40 7.2
386gb|AC153905.5| Mus musculus 6 BAC RP23-215A7 (Roswell Park Cance... 40 7.2
387gb|AF487998.1| Saccharopolyspora erythraea NRRL 2338 eryCI flank... 40 7.2
388dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
389dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 7.2
390dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
391emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 7.2
392emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 7.2
393emb|BX248523.8| Zebrafish DNA sequence from clone CH211-257G8 in... 40 7.2
394emb|AJ875019.1| Streptoalloteichus hindustanus partial apramycin... 40 7.2
395gb|AC153601.6| Mus musculus 6 BAC RP23-405O6 (Roswell Park Cance... 40 7.2
396gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 40 7.2
397dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 40 7.2
398dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo... 40 7.2
399dbj|AP003548.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 7.2

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  731 bits (369), Expect = 0.0
 Identities = 505/544 (92%), Gaps = 16/544 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1    cgttgggtcgatc-tacatatggtcgctaaattaaaaca------ggaaaaggaatgcgg 53
            |||||| |||||| ||||||||||||||||||| ||| |      ||||||| |||||||
Sbjct: 1233 cgttggatcgatcatacatatggtcgctaaatttaaatacaagtaggaaaagcaatgcgg 1174

                                                                        
Query: 54   gctaattaagacaagcgatcccatggaccgaattacaacacacggcacgcatgactgggc 113
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
Sbjct: 1173 gctaattaagacaagcgatcccatggaccgaattacaagacacggcacgcatgaccggac 1114

                                                                        
Query: 114  -acatac---gcatatgcagctgccgacacataaataacacgaccattgcagcggcc-aa 168
             || |||   |||||||||||||||||||||||| ||||||||||||||| |||||| ||
Sbjct: 1113 cacgtactacgcatatgcagctgccgacacataa-taacacgaccattgcggcggccgaa 1055

                                                                        
Query: 169  ctgaactgtcgagaagttgcaaaagcggctttctctttggatggatggacacagcacagg 228
            |||||||||||||||||||||||||||  ||||||| |||||||||||||||| ||| ||
Sbjct: 1054 ctgaactgtcgagaagttgcaaaagcgcatttctctctggatggatggacacaacacggg 995

                                                                        
Query: 229  tcgccattgcttcaatcttgcatgcacatcacatggat---aactcgttacgcgttgctc 285
            |||||||||||||| |||||||| || || ||||||||   |||| ||||||||||||||
Sbjct: 994  tcgccattgcttcagtcttgcatacagatgacatggatgataacttgttacgcgttgctc 935

                                                                        
Query: 286  ctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtagaaggcc 345
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 934  ctgaaggagccgagggccttgatggcgccggccctgaggatgtactggtggtagaaggcc 875

                                                                        
Query: 346  gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 405
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 874  gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 815

                                                                        
Query: 406  tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 465
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 814  tccttgttgtagatgacggcggcccccaggctccgggccgggttgatgccggtgccggtg 755

                                                                        
Query: 466  atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 525
            || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 754  atggggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccagc 695

                
Query: 526  accg 529
            ||||
Sbjct: 694  accg 691



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  335 bits (169), Expect = 9e-89
 Identities = 229/249 (91%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 745

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||  ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 744 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 685

                    
Query: 515 ggggcgcca 523
           |||| ||||
Sbjct: 684 ggggagcca 676



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  327 bits (165), Expect = 2e-86
 Identities = 228/249 (91%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 693

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||  ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 692 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 633

                    
Query: 515 ggggcgcca 523
           |||| ||||
Sbjct: 632 ggggagcca 624



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  319 bits (161), Expect = 5e-84
 Identities = 227/249 (91%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
           |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacggcggcgcccaggctcctggccgggttgatgc 764

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||  ||||||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 763 cggtgccggtgacggggatggtggccaggtgcaccatgaacacggcgaagccgatgggga 704

                    
Query: 515 ggggcgcca 523
           |||| ||||
Sbjct: 703 ggggagcca 695



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  311 bits (157), Expect = 1e-81
 Identities = 226/249 (90%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
           |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 817

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 816 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 757

                    
Query: 515 ggggcgcca 523
           |||| ||||
Sbjct: 756 ggggagcca 748



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  311 bits (157), Expect = 1e-81
 Identities = 226/249 (90%)
 Strand = Plus / Minus

                                                                        
Query: 275  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 335  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                                                        
Query: 395  cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            |||| | ||||||||||||||||| ||||||||| |||||||||||||||||||||||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacggcggcgcccaggctcctggccgggttgatgc 1467

                                                                        
Query: 455  cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
            ||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1466 cggtgccggtgacggggatggtggccaggtggaccatgaacacggcgaagccgatgggga 1407

                     
Query: 515  ggggcgcca 523
            |||| ||||
Sbjct: 1406 ggggagcca 1398



 Score =  228 bits (115), Expect = 1e-56
 Identities = 181/203 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 386
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                                                       
Query: 387 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 446
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 202

                                                                       
Query: 447 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 506
           ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||
Sbjct: 201 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 142

                                  
Query: 507 gatcgggaggggcgccaacaccg 529
            ||||| || || ||||||||||
Sbjct: 141 aatcggaagaggggccaacaccg 119



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  283 bits (143), Expect = 3e-73
 Identities = 227/255 (89%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 789

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 788 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 729

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 728 gcggcgccaagaccg 714



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 738 gcggcgccaagaccg 724



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 740 gcggcgccaagaccg 726



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 741 gcggcgccaagaccg 727



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 738 gcggcgccaagaccg 724



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 393

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 392 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 333

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 332 gcggcgccaagaccg 318



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 799

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 798 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 739

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 738 gcggcgccaagaccg 724



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  276 bits (139), Expect = 7e-71
 Identities = 226/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 802

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 801 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 742

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 741 gcggcgccaagaccg 727



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  268 bits (135), Expect = 2e-68
 Identities = 225/255 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||| ||||| || |||||| |||||||||| || || | ||||||||||||||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgc 801

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || |||||||||||||||||||||||||||||||| || |
Sbjct: 800 cggtgccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggca 741

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 740 gcggcgccaagaccg 726



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  228 bits (115), Expect = 1e-56
 Identities = 181/203 (89%)
 Strand = Plus / Minus

                                                                       
Query: 327 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 386
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                                                       
Query: 387 ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 446
            || || ||||||||||||||||||||||||||||| ||||| |||| |||||| |||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgaccgcggctcccaagctcctcgccgg 774

                                                                       
Query: 447 gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 506
           ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||
Sbjct: 773 gttgatgccggtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaaccc 714

                                  
Query: 507 gatcgggaggggcgccaacaccg 529
            ||||| || || ||||||||||
Sbjct: 713 aatcggaagaggggccaacaccg 691



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  228 bits (115), Expect = 1e-56
 Identities = 220/255 (86%)
 Strand = Plus / Minus

                                                                       
Query: 275 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 335 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 394
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                                                       
Query: 395 cccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgc 454
            ||||||||| || |||||| |||||||||| |  ||   | ||||||||||||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacggccggtccggtggtcctggccgggttgatgc 365

                                                                       
Query: 455 cggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggga 514
           ||||||||||||||||||| || ||||| ||||||||||||   ||||||||||| || |
Sbjct: 364 cggtgccggtgatcgggatcgtcgccagttggaccatgaaccacgcgaagccgattggca 305

                          
Query: 515 ggggcgccaacaccg 529
           | |||||||| ||||
Sbjct: 304 gcggcgccaagaccg 290



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  224 bits (113), Expect = 2e-55
 Identities = 179/201 (89%)
 Strand = Plus / Minus

                                                                       
Query: 303 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 362
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 363 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 422
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808

                                                                       
Query: 423 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
            ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 807 cgcggctcccaggctcctcgccgggttgatgccggtgccggtgatggggatggtggccag 748

                                
Query: 483 gtggaccatgaacacggcgaa 503
           ||| |||||||||||||||||
Sbjct: 747 gtgcaccatgaacacggcgaa 727



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  216 bits (109), Expect = 6e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 369 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 428
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                                       
Query: 429 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 488
            |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722

                                                    
Query: 489 catgaacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||||||| ||||| || || ||||| || ||||||||||
Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacaccg 681



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  216 bits (109), Expect = 6e-53
 Identities = 193/221 (87%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                                       
Query: 369 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 428
           ||| |||||||||||||| || ||||||||||||||||||||||||||||| || |||| 
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagataaccgcggt 782

                                                                       
Query: 429 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 488
            |||| |||||| |||||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 781 tcccaagctcctcgccgggttaatgccggtgccggtgatggggatggtggccagatggac 722

                                                    
Query: 489 catgaacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||||||| ||||| || || ||||| || ||||||||||
Sbjct: 721 catgaacaccgcgaatccaattgggagaggagccaacaccg 681



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  200 bits (101), Expect = 3e-48
 Identities = 192/221 (86%), Gaps = 1/221 (0%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
           ||||| |||||| || | |||||||||||||  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                       
Query: 369 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 428
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgacagcagc 756

                                                                       
Query: 429 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 488
            |||| ||| || |||||||||||||||||||||||||| |||||||||| |||||||||
Sbjct: 755 tcccaagcttctcgccgggttgatgccggtgccggtgatggggatggtgg-caggtggac 697

                                                    
Query: 489 catgaacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||||||||||||| ||||| ||||| || |||| |||||
Sbjct: 696 catgaacacggcgaatccgattgggagaggagccagcaccg 656



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  192 bits (97), Expect = 8e-46
 Identities = 175/201 (87%)
 Strand = Plus / Minus

                                                                       
Query: 303 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 362
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 363 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 422
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816

                                                                       
Query: 423 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
            ||||| |||||| |||| ||||||||||||||||||||||||||  |||||||| ||||
Sbjct: 815 cgcggctcccaggatcctcgccgggttgatgccggtgccggtgatgcggatggtgtccag 756

                                
Query: 483 gtggaccatgaacacggcgaa 503
           ||| |||||||||||||||||
Sbjct: 755 gtgcaccatgaacacggcgaa 735



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  186 bits (94), Expect = 5e-44
 Identities = 172/198 (86%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                                                       
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
           |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| |||||
Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722

                             
Query: 510 cgggaggggcgccaacac 527
            || || || ||||||||
Sbjct: 721 tggcagcggagccaacac 704



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 274 tacgcgttgctcctgaaggagccg 297
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  186 bits (94), Expect = 5e-44
 Identities = 172/198 (86%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
           ||||  |||||||||||  ||||||||||  |||||| | || |||||||||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggtt 782

                                                                       
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
           |||||||||||||||||||||||| || |||||||| ||||||||||| ||||| |||||
Sbjct: 781 gatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaacccgat 722

                             
Query: 510 cgggaggggcgccaacac 527
            || || || ||||||||
Sbjct: 721 tggcagcggagccaacac 704



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 274 tacgcgttgctcctgaaggagccg 297
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score =  182 bits (92), Expect = 8e-43
 Identities = 161/184 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 405
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                                                                       
Query: 406 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 465
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 722 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 663

                                                                       
Query: 466 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 525
           |  |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||
Sbjct: 662 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 603

               
Query: 526 accg 529
           ||||
Sbjct: 602 accg 599



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score =  182 bits (92), Expect = 8e-43
 Identities = 161/184 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 405
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                                                                       
Query: 406 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 465
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 280 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 221

                                                                       
Query: 466 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 525
           |  |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||
Sbjct: 220 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 161

               
Query: 526 accg 529
           ||||
Sbjct: 160 accg 157



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score =  182 bits (92), Expect = 8e-43
 Identities = 161/184 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 405
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                                                                       
Query: 406 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 465
              |||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||
Sbjct: 279 ctgttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtg 220

                                                                       
Query: 466 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 525
           |  |||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||
Sbjct: 219 acggggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaac 160

               
Query: 526 accg 529
           ||||
Sbjct: 159 accg 156



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  176 bits (89), Expect = 5e-41
 Identities = 188/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 303 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 362
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                       
Query: 363 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 422
            |  || || |||||||| ||||| || |||||||||||||| || ||||||||||| ||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagatcac 794

                                                                       
Query: 423 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
           ||| || || | |||||| |||||||||||||||||||||||||||||||| ||||||| 
Sbjct: 793 ggcagctccgaagctcctcgccgggttgatgccggtgccggtgatcgggatagtggccaa 734

                                                    
Query: 483 gtggaccatgaacacggcgaagccgatcgggaggggcgcca 523
           ||| ||||||||||| ||||||||||| || ||||| ||||
Sbjct: 733 gtgcaccatgaacaccgcgaagccgattggcaggggagcca 693



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  172 bits (87), Expect = 7e-40
 Identities = 177/207 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766

                                                                       
Query: 369 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 428
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 706

                                                                       
Query: 429 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 488
            |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||
Sbjct: 705 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 646

                                      
Query: 489 catgaacacggcgaagccgatcgggag 515
           ||||||||| || || ||||| |||||
Sbjct: 645 catgaacaccgcaaacccgatggggag 619



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  172 bits (87), Expect = 7e-40
 Identities = 177/207 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821

                                                                       
Query: 369 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 428
            || |||||||||||||| || ||||||||||||||||| |||||||||||||| || ||
Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgacagcagc 761

                                                                       
Query: 429 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 488
            |||| ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||
Sbjct: 760 gcccaagctcctggccgggttgatgccggtgccggtgatggggatcgtggccagatggac 701

                                      
Query: 489 catgaacacggcgaagccgatcgggag 515
           ||||||||| || || ||||| |||||
Sbjct: 700 catgaacaccgcaaacccgatggggag 674



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  170 bits (86), Expect = 3e-39
 Identities = 173/202 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 387
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                                                       
Query: 388 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 447
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 825

                                                                       
Query: 448 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 507
           |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |||
Sbjct: 824 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 765

                                 
Query: 508 atcgggaggggcgccaacaccg 529
           || ||||| || |||| |||||
Sbjct: 764 attgggagaggagccagcaccg 743



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  170 bits (86), Expect = 3e-39
 Identities = 173/202 (85%)
 Strand = Plus / Minus

                                                                       
Query: 328 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 387
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                                                       
Query: 388 tgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccggg 447
           || |||||||||||||||||  ||||||||||||| || || |||| ||| || || |||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgacagcagctcccaagcttctcgcgggg 745

                                                                       
Query: 448 ttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccg 507
           |||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |||
Sbjct: 744 ttgatgccggtgccggtgatggggatggtggccaagtggaccatgaacacagcgaatccg 685

                                 
Query: 508 atcgggaggggcgccaacaccg 529
           || ||||| || |||| |||||
Sbjct: 684 attgggagaggagccagcaccg 663



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  167 bits (84), Expect = 5e-38
 Identities = 156/180 (86%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||   |||||| |  ||| |||||||||||| ||| || || |||||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                                                                       
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
           |||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||
Sbjct: 778 gatgccggtgccggtgatggggatggtggccaggtggaccaggaacacggcgaacccgat 719



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  157 bits (79), Expect = 4e-35
 Identities = 166/195 (85%)
 Strand = Plus / Minus

                                                                       
Query: 309 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                                       
Query: 369 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggc 428
            || |||||||||||||| || |||| ||| ||||||| || ||||||||| || || ||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagatcaccgcagc 718

                                                                       
Query: 429 ccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggac 488
            |||| |||||| |||||||||||||||||||||||||||||||| ||||||| ||| ||
Sbjct: 717 tcccaagctccttgccgggttgatgccggtgccggtgatcgggatcgtggccaagtgaac 658

                          
Query: 489 catgaacacggcgaa 503
           ||||||||| |||||
Sbjct: 657 catgaacaccgcgaa 643



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  155 bits (78), Expect = 2e-34
 Identities = 123/138 (89%)
 Strand = Plus / Minus

                                                                            
Query: 391      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
                ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 25183979

                                                                            
Query: 451      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 510
                ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || 
Sbjct: 25183978 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 25183919

                                  
Query: 511      gggaggggcgccaacacc 528
                ||||| || |||||||||
Sbjct: 25183918 gggagaggagccaacacc 25183901



 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                            
Query: 391      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
                |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 27065064 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 27065005

                                                               
Query: 451      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
                ||||| || |||||||| |||||||||||||||||||||| ||||||
Sbjct: 27065004 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 27064958



 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 423      ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
                |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 35369049 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 35368990

                                                         
Query: 483      gtggaccatgaacacggcgaagccgatcgggaggggcgcca 523
                |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 35368989 gtggacgaggaagacggcgaagccgatggggagcggcgcca 35368949



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                            
Query: 309      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 369      gccgacccagaagatccactga 390
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     aaattaaaacaggaaaagga 47
              ||||||||||||||||||||
Sbjct: 751943 aaattaaaacaggaaaagga 751962



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score =  155 bits (78), Expect = 2e-34
 Identities = 123/138 (89%)
 Strand = Plus / Minus

                                                                         
Query: 391   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
             ||||||||||||||||||||||||||||| || ||||  |||| |||||| |||||||| 
Sbjct: 84431 tcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccgggtta 84372

                                                                         
Query: 451   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 510
             ||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || 
Sbjct: 84371 atgccggtgccggtgatggggatggtggccagatggaccatgaacaccgcgaatccaatt 84312

                               
Query: 511   gggaggggcgccaacacc 528
             ||||| || |||||||||
Sbjct: 84311 gggagaggagccaacacc 84294



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                         
Query: 309   ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
             ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 369   gccgacccagaagatccactga 390
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  153 bits (77), Expect = 7e-34
 Identities = 113/125 (90%)
 Strand = Plus / Minus

                                                                            
Query: 400      gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 459
                ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                                                                            
Query: 460      ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 519
                |||||||||||||| || |||||||||||||||||||||||||||||||| || || |||
Sbjct: 15355543 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 15355484

                     
Query: 520      gccaa 524
                |||||
Sbjct: 15355483 gccaa 15355479



 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                            
Query: 409      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
                |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 15324236 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 15324177

                                                                            
Query: 469      gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
                |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 15324176 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 15324117



 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                            
Query: 409      ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
                |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 15316356 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 15316297

                                                                            
Query: 469      gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
                ||||| || |||||||| ||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 15316296 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 15316237



 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 275      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 335      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                            
Query: 387      ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 446
                |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 15306327 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 15306268

                                                                            
Query: 447      gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 506
                ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||
Sbjct: 15306267 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 15306208

                                      
Query: 507      gatcgggaggggcgccaacacc 528
                ||| || || || |||||||||
Sbjct: 15306207 gattggcagcggagccaacacc 15306186



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 330      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 330      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 346      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 274      tacgcgttgctcctgaaggagccg 297
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  153 bits (77), Expect = 7e-34
 Identities = 113/125 (90%)
 Strand = Plus / Minus

                                                                         
Query: 400   gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 459
             ||||| || |||||| |||||||||| || || | |||||||||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                                                                         
Query: 460   ccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggc 519
             |||||||||||||| || |||||||||||||||||||||||||||||||| || || |||
Sbjct: 62542 ccggtgatcgggatcgtcgccaggtggaccatgaacacggcgaagccgattggcagcggc 62483

                  
Query: 520   gccaa 524
             |||||
Sbjct: 62482 gccaa 62478



 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                         
Query: 409   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
             |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 31235 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 31176

                                                                         
Query: 469   gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
             |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 31175 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 31116



 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                         
Query: 409   ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
             |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 23355 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 23296

                                                                         
Query: 469   gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
             ||||| || |||||||| ||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 23295 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 23236



 Score =  149 bits (75), Expect = 1e-32
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                         
Query: 275   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 334
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 335   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                         
Query: 387   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 446
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 13326 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 13267

                                                                         
Query: 447   gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 506
             ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||
Sbjct: 13266 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 13207

                                   
Query: 507   gatcgggaggggcgccaacacc 528
             ||| || || || |||||||||
Sbjct: 13206 gattggcagcggagccaacacc 13185



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 330   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 330   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 346   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 274   tacgcgttgctcctgaaggagccg 297
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score =  151 bits (76), Expect = 3e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 337 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 278

                                                                       
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
           |||||||||||||||||| |||||||||||||||||||| | ||||||||| || |||||
Sbjct: 277 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 218



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  151 bits (76), Expect = 3e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 768 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 709

                                                                       
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
           |||||||||||||||||| |||||||||||||||||||| | ||||||||| || |||||
Sbjct: 708 gatgccggtgccggtgatagggatggtggccaggtggacgaggaacacggcaaacccgat 649



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                          
Query: 409    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
              |||||||||| ||||||||| || |||||||| |||||||||||||||||||||||||  
Sbjct: 110249 ttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgacg 110190

                                                                          
Query: 469    gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
              |||||||| |||||||| ||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 110189 gggatggtcgccaggtgcaccatgaacacggcgaacccgatcggcagcggcgccaacacc 110130



 Score =  151 bits (76), Expect = 3e-33
 Identities = 109/120 (90%)
 Strand = Plus / Minus

                                                                          
Query: 409    ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
              |||||||| ||||||||||| || |||||||| |||||||||||||||||||||||||||
Sbjct: 102369 ttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgatc 102310

                                                                          
Query: 469    gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
              ||||| || |||||||| ||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 102309 gggatcgtcgccaggtgcaccatgaacaccgcgaacccgatcggcagcggcgccaacacc 102250



 Score =  139 bits (70), Expect = 1e-29
 Identities = 124/142 (87%)
 Strand = Plus / Minus

                                                                         
Query: 387   ctgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgg 446
             |||||||  |||||||||||  ||||||||||  |||||| | || ||||||||||||||
Sbjct: 92340 ctgatcactccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgg 92281

                                                                         
Query: 447   gttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagcc 506
             ||||||||||||||||||||||||||| || |||||||| ||||||||||| ||||| ||
Sbjct: 92280 gttgatgccggtgccggtgatcgggatcgtcgccaggtgcaccatgaacaccgcgaaccc 92221

                                   
Query: 507   gatcgggaggggcgccaacacc 528
             ||| || || || |||||||||
Sbjct: 92220 gattggcagcggagccaacacc 92199



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 330    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 330   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 346    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 274   tacgcgttgctcctgaaggagccg 297
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score =  149 bits (75), Expect = 1e-32
 Identities = 123/139 (88%)
 Strand = Plus / Minus

                                                                       
Query: 391 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
           |||| ||||||| |||| |||||||||||||| || || |||| ||| || |||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccgggttg 348

                                                                       
Query: 451 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 510
           ||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 347 atgccggtgccggtgatggggatggtggctaggtggaccatgaacacggcgaatccgatt 288

                              
Query: 511 gggaggggcgccaacaccg 529
           ||||| || |||| |||||
Sbjct: 287 gggagaggagccagcaccg 269



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  149 bits (75), Expect = 1e-32
 Identities = 129/147 (87%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| |||||||||||||| || |||| |||||| | |||| |||||||||||| |||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatgatggc 818

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            ||||| |||||||| || ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 817 agccccaaggctcctagctgggttgatgccggtgccggtgatgggaatggtggccaggtg 758

                                      
Query: 486 gaccatgaacacggcgaagccgatcgg 512
           ||||| |||||| ||||| || |||||
Sbjct: 757 gaccaggaacaccgcgaacccaatcgg 731



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score =  145 bits (73), Expect = 2e-31
 Identities = 112/125 (89%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           |||||||||||||||||||| || |||||  | || || |||||||||||||||||||| 
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacggcggcg 728

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || | ||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 727 ccgaagctcctggcggggttgatgccggtgccggtgatggggatggtggcaaggtggacc 668

                
Query: 490 atgaa 494
           |||||
Sbjct: 667 atgaa 663



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  143 bits (72), Expect = 7e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 683

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 682 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 623

                           
Query: 494 acacggcgaagccgat 509
           |||||||||| |||||
Sbjct: 622 acacggcgaacccgat 607



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 279 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score =  143 bits (72), Expect = 7e-31
 Identities = 156/184 (84%)
 Strand = Plus / Minus

                                                                       
Query: 346 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 405
           ||||||||||| ||||| |  ||||| ||||||||||||||||| ||   |||||| |||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactggtcgctccaggctttg 825

                                                                       
Query: 406 tccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtg 465
              |||||||| | ||||||||| || |||||||| ||||||||||| |||||||| |||
Sbjct: 824 ctgttgttgtacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtg 765

                                                                       
Query: 466 atcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaac 525
           |||||||| || |||||||| ||||||||||| ||||| |||||||| || ||||||| |
Sbjct: 764 atcgggatcgtcgccaggtgcaccatgaacacagcgaacccgatcggaagcggcgccagc 705

               
Query: 526 accg 529
           ||||
Sbjct: 704 accg 701



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score =  143 bits (72), Expect = 7e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 669

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 668 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 609

                           
Query: 494 acacggcgaagccgat 509
           |||||||||| |||||
Sbjct: 608 acacggcgaacccgat 593



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 281 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score =  143 bits (72), Expect = 7e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 782

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 781 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 722

                           
Query: 494 acacggcgaagccgat 509
           |||||||||| |||||
Sbjct: 721 acacggcgaacccgat 706



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 279 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score =  143 bits (72), Expect = 7e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 776

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 775 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 716

                           
Query: 494 acacggcgaagccgat 509
           |||||||||| |||||
Sbjct: 715 acacggcgaacccgat 700



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 279 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score =  143 bits (72), Expect = 7e-31
 Identities = 120/136 (88%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||||||||| || || ||||| ||||| | || |||||||||||||||||| || |
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacggcggcgccga 770

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||
Sbjct: 769 tgctccgggcagggttgatgcccgtgccggtgatggggatggtggccaggtgcaccatga 710

                           
Query: 494 acacggcgaagccgat 509
           |||||||||| |||||
Sbjct: 709 acacggcgaacccgat 694



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 279 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 693

                
Query: 493 aacac 497
           |||||
Sbjct: 692 aacac 688



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726

                
Query: 493 aacac 497
           |||||
Sbjct: 725 aacac 721



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 781

                
Query: 493 aacac 497
           |||||
Sbjct: 780 aacac 776



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 726

                
Query: 493 aacac 497
           |||||
Sbjct: 725 aacac 721



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 721

                
Query: 493 aacac 497
           |||||
Sbjct: 720 aacac 716



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  137 bits (69), Expect = 4e-29
 Identities = 111/125 (88%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| |||||| | ||||||||||||||||| ||| || || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||||||| ||||||||||| || |||||||| |||||||||||||||||||||| |
Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatggggatggtggccaggtggaccagg 724

                
Query: 493 aacac 497
           |||||
Sbjct: 723 aacac 719



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 715

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 714 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 655

                       
Query: 486 gaccatgaacac 497
            |||| ||||||
Sbjct: 654 aaccaagaacac 643



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score =  135 bits (68), Expect = 2e-28
 Identities = 92/100 (92%)
 Strand = Plus / Minus

                                                                       
Query: 410 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 469
           |||||||||||| ||| || || |||||||| |||||||||||||||||||||||||| |
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598

                                                   
Query: 470 ggatggtggccaggtggaccatgaacacggcgaagccgat 509
           ||||||||||||||||||||| |||||||||||| |||||
Sbjct: 597 ggatggtggccaggtggaccaggaacacggcgaacccgat 558



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 330  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score =  135 bits (68), Expect = 2e-28
 Identities = 182/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 281 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 340
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 341 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 400
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                                                                       
Query: 401 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 460
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| |||||||
Sbjct: 792 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtgc 733

                                                   
Query: 461 cggtgatcgggatggtggccaggtggaccatgaacacggc 500
           | ||||| || || ||||||| ||| ||||||||||||||
Sbjct: 732 cagtgataggaatagtggccaagtgaaccatgaacacggc 693



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 792

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 791 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 732

                       
Query: 486 gaccatgaacac 497
            |||| ||||||
Sbjct: 731 aaccaagaacac 720



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  135 bits (68), Expect = 2e-28
 Identities = 143/168 (85%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||||||||||| | | || |||||||||||| ||| || || |||||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

                                                           
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
           |||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 768 gatgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 721



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 795

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 794 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 735

                       
Query: 486 gaccatgaacac 497
            |||| ||||||
Sbjct: 734 aaccaagaacac 723



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                        
Query: 366  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
            |||||| |||||||||||||| || ||||||||||| | | || |||||||||||| |||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatgatggc 1091

                                                                        
Query: 426  ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
             || || |||||||| || ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1090 agcgccaaggctcctcgctgggttgatgccggtgccggtgatggggatggtggccaggtg 1031

                        
Query: 486  gaccatgaacac 497
             |||| ||||||
Sbjct: 1030 aaccaagaacac 1019



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  131 bits (66), Expect = 3e-27
 Identities = 147/174 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

                                                                 
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
           |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 820 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 767



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  131 bits (66), Expect = 3e-27
 Identities = 147/174 (84%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

                                                                 
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
           |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 815 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 762



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  131 bits (66), Expect = 3e-27
 Identities = 147/174 (84%)
 Strand = Plus / Minus

                                                                        
Query: 330  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
            ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 390  atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
             ||   ||| || |  |||  ||||||||||| |||||| || |||||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

                                                                  
Query: 450  gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
            |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 1144 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 1091



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score =  129 bits (65), Expect = 1e-26
 Identities = 149/177 (84%)
 Strand = Plus / Minus

                                                                       
Query: 324 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 383
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                                                       
Query: 384 ccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggc 443
           |||||| |||||||||||||| || ||||||||||| || || |||||||  ||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggc 754

                                                                    
Query: 444 cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggc 500
            |||||||| |||||||| ||||| || || ||||||| ||| ||||||||||||||
Sbjct: 753 agggttgataccggtgccagtgataggaatagtggccaagtgaaccatgaacacggc 697



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score =  129 bits (65), Expect = 1e-26
 Identities = 134/157 (85%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 626 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 567

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| |
Sbjct: 566 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 507

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| ||||| ||||| || |  |||||||||||||
Sbjct: 506 aacaccgcgaaaccgatgggcaatggcgccaacaccg 470



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score =  129 bits (65), Expect = 1e-26
 Identities = 134/157 (85%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||||||||| | ||| || |||  || |||||||| ||||||||| || 
Sbjct: 808 acccagaagatccactgatcgtgccaagcattgggctggttgtagacgacggcggcgccg 749

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | |||||| ||||| |||||||| ||||||||||||||||||||||| ||||| |||| |
Sbjct: 748 aagctcctcgccggattgatgcccgtgccggtgatcgggatggtggcgaggtgcaccacg 689

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| ||||| ||||| || |  |||||||||||||
Sbjct: 688 aacaccgcgaaaccgatgggcaatggcgccaacaccg 652



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score =  129 bits (65), Expect = 1e-26
 Identities = 134/157 (85%)
 Strand = Plus / Minus

                                                                       
Query: 367 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 426
           |||||||||||||| ||||| ||||| ||||| |||||   || |||||| |  ||||| 
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctttcgctggttgtacacaacggcc 135

                                                                       
Query: 427 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 486
           | |||||||||||| |||||||||||||| ||||||||||  ||||||||||||||||| 
Sbjct: 134 ggccccaggctccttgccgggttgatgcccgtgccggtgacggggatggtggccaggtgc 75

                                                
Query: 487 accatgaacacggcgaagccgatcgggaggggcgcca 523
           ||||||||||| ||||| ||||| || || |||||||
Sbjct: 74  accatgaacaccgcgaatccgatgggcagcggcgcca 38



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  127 bits (64), Expect = 4e-26
 Identities = 151/180 (83%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||| ||||||| | || || |||||| || |||||||| || |||||||  || |||||
Sbjct: 825 gtcagcccaggcatggtgctggttgtaaattacggcggcgccaaggctccgcgcggggtt 766

                                                                       
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
           ||||||||||||||||||    ||||||||||||||||| | ||||||||| || |||||
Sbjct: 765 gatgccggtgccggtgatacccatggtggccaggtggacgaggaacacggcaaacccgat 706



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score =  127 bits (64), Expect = 4e-26
 Identities = 103/116 (88%)
 Strand = Plus / Plus

                                                                         
Query: 394   tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 453
             ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 91210 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 91269

                                                                     
Query: 454   ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
             || ||||||||||| ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 91270 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 91325



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 279   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score =  127 bits (64), Expect = 4e-26
 Identities = 103/116 (88%)
 Strand = Plus / Plus

                                                                           
Query: 394     tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 453
               ||||| ||||| | || |||||||||||||||||| || | ||||| ||| |||||||||
Sbjct: 8906901 tcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagggttgatg 8906960

                                                                       
Query: 454     ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgat 509
               || ||||||||||| ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 8906961 cccgtgccggtgatggggatggtggccaggtgcaccatgaacacggcgaacccgat 8907016



 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                            
Query: 391      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
                |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 26074238 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 26074179

                                                                     
Query: 451      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
                ||||||||||||||||||||||| ||||||| ||| ||||||||||| |||||
Sbjct: 26074178 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 26074126



 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                            
Query: 391      tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
                ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28020793 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 28020734

                                                               
Query: 451      atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
                ||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 28020733 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 28020687



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 309      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 369      gccgacccagaagatccact 388
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 279     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 335
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 366      ggggccgacccagaagatccactg 389
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score =  127 bits (64), Expect = 4e-26
 Identities = 181/220 (82%)
 Strand = Plus / Minus

                                                                       
Query: 281 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 340
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 341 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 400
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                                                                       
Query: 401 ccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgc 460
           |||| || ||||||||||| || || |||||||  |||||||| |||||||| ||||| |
Sbjct: 346 ccttctcattgttgtagataacagcagcccccaaactcctggcagggttgataccggtac 287

                                                   
Query: 461 cggtgatcgggatggtggccaggtggaccatgaacacggc 500
           | ||||| || || ||||||| ||| ||||||||||||||
Sbjct: 286 cagtgataggaatagtggccaagtgaaccatgaacacggc 247



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  127 bits (64), Expect = 4e-26
 Identities = 160/192 (83%)
 Strand = Plus / Minus

                                                                       
Query: 333 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 392
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                                                       
Query: 393 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 452
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 795

                                                                       
Query: 453 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 512
           ||||||||| ||||| ||||| || |||||||| |||| |||||| ||||| ||||||||
Sbjct: 794 gccggtgcccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatcgg 735

                       
Query: 513 gaggggcgccaa 524
            || ||||||||
Sbjct: 734 aagcggcgccaa 723



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score =  121 bits (61), Expect = 2e-24
 Identities = 91/101 (90%)
 Strand = Plus / Minus

                                                                       
Query: 409 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
           |||| |||||||| |||||| || ||||||||||| ||||||||||||||||||||||| 
Sbjct: 968 ttgtcgtagatgatggcggcgccgaggctcctggcggggttgatgccggtgccggtgatg 909

                                                    
Query: 469 gggatggtggccaggtggaccatgaacacggcgaagccgat 509
           ||||||||||| ||||| |||| ||| ||||||||||||||
Sbjct: 908 gggatggtggcgaggtgcaccaggaatacggcgaagccgat 868



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                         
Query: 391   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
             |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 36713 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 36654

                                                            
Query: 451   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
             ||||| || |||||||| |||||||||||||||||||||| ||||||
Sbjct: 36653 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 36607



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score =  117 bits (59), Expect = 4e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                          
Query: 391    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
              |||| |||||| | ||||||||||||||||| ||| || || ||||||||||| ||||||
Sbjct: 118266 tcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctgggttg 118207

                                                             
Query: 451    atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
              ||||| || |||||||| |||||||||||||||||||||| ||||||
Sbjct: 118206 atgccagtaccggtgatggggatggtggccaggtggaccaggaacac 118160



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score =  115 bits (58), Expect = 2e-22
 Identities = 145/174 (83%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            |||| |||||| |  ||| |||||||||||| ||| || || |||||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                                                                 
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
           |||||| ||||| || || ||||||||||| |||||||||| |||||| |||||
Sbjct: 264 gatgccagtgccagtaatggggatggtggcaaggtggaccaagaacaccgcgaa 211



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score =  113 bits (57), Expect = 6e-22
 Identities = 117/137 (85%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || || ||||| || | ||||||||||||||||| ||| || |||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatgatggccgcaccc 751

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |||||||  || |||||||||||||| ||||| || ||||||||||||| ||| |||| |
Sbjct: 750 aggctccgagctgggttgatgccggttccggttatggggatggtggccaagtgcaccaag 691

                            
Query: 493 aacacggcgaagccgat 509
           ||||| ||||| |||||
Sbjct: 690 aacactgcgaacccgat 674



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score =  113 bits (57), Expect = 6e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||||||||||||||| |||||||| ||||||||||||||||| || || || || || 
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgtaaattacagcagctccg 687

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  |||||||| |||||||| ||||||||||| || ||||| ||||||| ||| ||||||
Sbjct: 686 aaactcctggctgggttgataccggtgccggtaattgggatagtggccaagtgaaccatg 627

                
Query: 493 aacac 497
           |||||
Sbjct: 626 aacac 622



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 280 ttgctcctgaaggagccgagggccttgatggc 311
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                          
Query: 391    tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
              |||| ||| ||||||| || ||||||||| || || || |||| |||||| |||||||||
Sbjct: 108565 tcatgccatgccttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttg 108506

                                                                   
Query: 451    atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
              ||||||||||||||||||||||| ||||||| ||| ||||||||||| |||||
Sbjct: 108505 atgccggtgccggtgatcgggatcgtggccaagtgaaccatgaacaccgcgaa 108453



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 309    ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 368
              ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 369    gccgacccagaagatccact 388
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || ||||||||||||||||| ||||| |||||||| || || 
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgacagcagct 712

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || | ||| || ||||||||||| |||||||||||||| || || || |||||||| |||
Sbjct: 711 ccgaagcttctagccgggttgataccggtgccggtgatgggaattgttgccaggtgaacc 652

                   
Query: 490 atgaacac 497
           ||||||||
Sbjct: 651 atgaacac 644



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| || 
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | ||| ||||| ||||| || ||||||||||||||||| |||||||| | ||| ||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccggtgatcggaatggtggctaagtgaaccatg 627

                   
Query: 493 aacacggc 500
           || |||||
Sbjct: 626 aagacggc 619



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Minus

                                                                       
Query: 325 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 384
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                                                       
Query: 385 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 444
           ||||||||||||||||||||||  ||||||||||| || || || || || || |  || 
Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagatcacagcagcaccaagactacgagca 771

                                                                   
Query: 445 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggc 500
           |||||||| || |||||||| || ||||||||||||| ||| ||||||||||||||
Sbjct: 770 gggttgatacctgtgccggtaattgggatggtggccaagtgaaccatgaacacggc 715



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  111 bits (56), Expect = 2e-21
 Identities = 158/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 333 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 392
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                                                       
Query: 393 atcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgat 452
            ||||| ||||  | |||||||||||||| |||||| || |||  ||| |||||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgat 780

                                                                       
Query: 453 gccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgg 512
           |||||| || ||||| ||||| || |||||||| |||| |||||| ||||| ||||| ||
Sbjct: 779 gccggtccccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgatggg 720

                       
Query: 513 gaggggcgccaa 524
            || ||||||||
Sbjct: 719 aagcggcgccaa 708



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  109 bits (55), Expect = 9e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                         
Query: 391   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
             ||||||||||| | | || |||||||||||| ||| || || |||||||| || ||||||
Sbjct: 28019 tcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggttg 27960

                                                            
Query: 451   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
             ||||||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 27959 atgccggtgccggtgatggggatggtggccaggtgaaccaagaacac 27913



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 366   ggggccgacccagaagatccactg 389
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score =  109 bits (55), Expect = 9e-21
 Identities = 130/155 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           |||||||| || ||||| |||||||||||||||||    ||||||||||| || || || 
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggccttagaattgttgtagataaccgcagct 757

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || | ||| || || |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 756 ccgaagcttctagcggggttgattccggtgcctgtgattgggatggtggccaggtgaacc 697

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           ||||| |||||||| ||||| ||||| || |||||
Sbjct: 696 atgaatacggcgaatccgattgggagcggagccaa 662



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  107 bits (54), Expect = 4e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 330 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 389
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||| ||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 731

                                                                       
Query: 390 atcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggtt 449
            ||   ||| || |  |||  ||||||||||| |||||| || ||||||||    |||||
Sbjct: 730 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctaaaggggtt 671

                                                                 
Query: 450 gatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
           |||||||||||||||||| ||||||||||| |||||||||| |||||| |||||
Sbjct: 670 gatgccggtgccggtgatggggatggtggcaaggtggaccaggaacaccgcgaa 617



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score =  107 bits (54), Expect = 4e-20
 Identities = 102/118 (86%)
 Strand = Plus / Plus

                                                                         
Query: 411   gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 470
             |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

                                                                       
Query: 471   gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
             ||||||||| ||||| |||| |||||| ||||| ||||| || |  ||||||||||||
Sbjct: 47713 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 47770



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  107 bits (54), Expect = 4e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                            
Query: 411      gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 470
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                                                                          
Query: 471      gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
                ||||||||| ||||| |||| |||||| ||||| ||||| || |  ||||||||||||
Sbjct: 17626918 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 17626861



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 338      agaaggccgcgatcgccgcg 357
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  107 bits (54), Expect = 4e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                            
Query: 411      gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 470
                |||||||| ||||||||| || | |||||| ||||| |||||||| ||||||||||||||
Sbjct: 17636018 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17635959

                                                                          
Query: 471      gatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaacacc 528
                ||||||||| ||||| |||| |||||| ||||| ||||| || |  ||||||||||||
Sbjct: 17635958 gatggtggcgaggtgcaccacgaacaccgcgaaaccgatgggcaatggcgccaacacc 17635901



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 338      agaaggccgcgatcgccgcg 357
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  107 bits (54), Expect = 4e-20
 Identities = 117/138 (84%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           ||||||||||||||||||||| || || | |||||| |  ||| |||||||||||| |||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatgatggc 796

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || |||||||| || ||||||||||| ||||| || || ||||||||||| |||||
Sbjct: 795 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 736

                             
Query: 486 gaccatgaacacggcgaa 503
           ||||| |||||| |||||
Sbjct: 735 gaccaggaacaccgcgaa 718



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 423 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
           |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 887 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 828

                                                    
Query: 483 gtggaccatgaacacggcgaagccgatcgggaggggcgcca 523
           |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 827 gtggacgaggaagacggcgaagccgatggggagcggcgcca 787



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |  |||||||||||||| | ||||||||| || ||||| |||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || ||||| || ||||||||||| || || ||||| ||||||||||||| ||| ||||||
Sbjct: 711 agactcctagcagggttgatgccagttccagtgatggggatggtggccaagtgaaccatg 652

                
Query: 493 aacac 497
           |||||
Sbjct: 651 aacac 647



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                         
Query: 423   ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
             |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 29597 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 29538

                                                      
Query: 483   gtggaccatgaacacggcgaagccgatcgggaggggcgcca 523
             |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 29537 gtggacgaggaagacggcgaagccgatggggagcggcgcca 29497



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                       
Query: 423 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
           |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 886 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 827

                                                    
Query: 483 gtggaccatgaacacggcgaagccgatcgggaggggcgcca 523
           |||||| | ||| |||||||||||||| ||||| |||||||
Sbjct: 826 gtggacgaggaagacggcgaagccgatggggagcggcgcca 786



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || ||||||||||| || |  | |||| |||| || || || || 
Sbjct: 814 acccagaagatccaatggtcatcccaggctttctgttggttgaagataacagcagctccg 755

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||||||||||||||||||||||||||  ||||||||||||| ||| ||||||
Sbjct: 754 agactcctggccgggttgatgccggtgccggtgactgggatggtggccaagtgaaccatg 695

                
Query: 493 aacac 497
           |||||
Sbjct: 694 aacac 690



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score =  101 bits (51), Expect = 2e-18
 Identities = 129/155 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| |||||||||||||| || || |||||| ||||||| || || || 
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgacagcagcgcca 767

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | ||||||||| ||||||||||| || || || || ||||| ||||||| ||| ||||||
Sbjct: 766 aagctcctggcagggttgatgccagttccagttatagggattgtggccaagtgtaccatg 707

                                              
Query: 493 aacacggcgaagccgatcgggaggggcgccaacac 527
           ||||| ||||| ||||| || || || ||||||||
Sbjct: 706 aacacagcgaacccgattggaagaggagccaacac 672



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||| ||||||||||||||||| | ||| |  ||||||||||| || ||||| ||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagatcacagcggctccca 422

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| |
Sbjct: 421 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 362

                  
Query: 494 acacggc 500
           | |||||
Sbjct: 361 aaacggc 355



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 838 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 779

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  || || || ||||||||||| ||||||||||| ||||||||||||| ||| ||||||
Sbjct: 778 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 719

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 718 aacaccgcgaa 708



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| ||||||||||||||||| |  | ||||||||| ||||| || || 
Sbjct: 354 acccagaaaatccaatgatcatcccaggccttctgttggttgtagatcacggcagctccg 295

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  || || || ||||||||||| ||||||||||| ||||||||||||| ||| ||||||
Sbjct: 294 aaacttctagctgggttgatgccagtgccggtgattgggatggtggccaagtgaaccatg 235

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 234 aacaccgcgaa 224



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Minus

                                                                       
Query: 331 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 390
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 391 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
           |||||||| |||||||| ||||||||||| || || || || || || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                                                          
Query: 451 atgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
           ||||| ||||| ||||| ||||||||||||| |||||| ||||||||
Sbjct: 754 atgccagtgccagtgattgggatggtggccaagtggacaatgaacac 708



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 131/158 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| |||||||| | |||||| || || || || 
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgtatatcacagcagct 750

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || | |||||| ||||||||||| || || |||||||| ||||| ||||||||||| |||
Sbjct: 749 ccaaagctcctagccgggttgataccagttccggtgattgggatagtggccaggtgaacc 690

                                                 
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaacac 527
           ||||| || || || ||||| || || || ||||||||
Sbjct: 689 atgaagacagcaaatccgatgggaagtggtgccaacac 652



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 110/130 (84%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 760

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| |||||||| || |||||||| ||||| || || ||||| |  || |||
Sbjct: 759 ccaaaactcctagccgggtttattccggtgccagtgattggaattgtggctaaatgaacc 700

                     
Query: 490 atgaacacgg 499
           ||||||||||
Sbjct: 699 atgaacacgg 690



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 116/138 (84%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           ||||||||||||||||||||| || ||   |||||| |  ||| |||||||||||| |||
Sbjct: 280 ggggccgacccagaagatccaatggtcgctccaggcatgatccctgttgtagatgatggc 221

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || |||||||| || ||||||||||| ||||| || || ||||||||||| |||||
Sbjct: 220 agcgccaaggctcctagctgggttgatgccagtgccagtaatggggatggtggcaaggtg 161

                             
Query: 486 gaccatgaacacggcgaa 503
           ||||| |||||| |||||
Sbjct: 160 gaccaggaacaccgcgaa 143



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||||| |||||| | |||||||||||| || || || 
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgacagcagctcca 784

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | |||||| || ||||||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 783 aagctcctagcagggttgatgccagttccggtgatggggatggtggcaaggtgaaccatg 724

                
Query: 493 aacac 497
           |||||
Sbjct: 723 aacac 719



 Score = 40.1 bits (20), Expect = 7.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 301 gccttgatggcgccggccctgagtatgtactggtggtaga 340
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 94/109 (86%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 399

                                                            
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 481
           ||||||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 398 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 350



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 94/109 (86%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||  ||||| || 
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatgattgcggcacca 729

                                                            
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 481
           ||||||||||| |||||||| ||||| || ||||| |||||||||||||
Sbjct: 728 aggctcctggcggggttgataccggtacctgtgattgggatggtggcca 680



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||||   ||||||||||| |  ||  |||||||||||| ||||||||||
Sbjct: 833 acccagaaaatccacatgtcatcccaggcatgctctctgttgtagatgatggcggccccc 774

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || ||||| || |||||||||||||| |||||||| |||||||| ||||| || |||| |
Sbjct: 773 agactcctagcagggttgatgccggttccggtgatggggatggttgccagatgaaccaag 714

                
Query: 493 aacac 497
           |||||
Sbjct: 713 aacac 709



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 126/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||||   ||||||||||| |  || |||||||||| || ||||||||||
Sbjct: 841 acccagaaaatccacatgtcatcccaggcatgctctttgttgtagacgatggcggccccc 782

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || ||||| || |||||||||||||| || ||||| |||||||| ||||| || |||| |
Sbjct: 781 agactcctagcagggttgatgccggttccagtgatggggatggttgccagatgaaccaag 722

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || || |||||||| || |||||
Sbjct: 721 aacactgcaaacccaatcgggagaggagccaa 690



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 78/88 (88%)
 Strand = Plus / Minus

                                                                       
Query: 410 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 469
           |||||||||||| ||| || ||||||||||| || |||||||||||||||||||||||||
Sbjct: 830 tgttgtagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcg 771

                                       
Query: 470 ggatggtggccaggtggaccatgaacac 497
           |||| || |||| ||| |||| ||||||
Sbjct: 770 ggatcgtcgccaagtgcaccaagaacac 743



to top

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| || ||  | |||||| |||| |||||||| || 
Sbjct: 501 acccagaaaatccaatggtcatcccaagcttttccgttgttgaagatcacggcggcgccg 442

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | |||||| |||||||| || ||||||||||||||||| || || |||| ||| ||||||
Sbjct: 441 aagctcctcgccgggttaatcccggtgccggtgatcggaatagttgccaagtgtaccatg 382

                                              
Query: 493 aacacggcgaagccgatcgggaggggcgccaacac 527
           ||||| || || || || ||||| |||||||||||
Sbjct: 381 aacaccgcaaaacctattgggagaggcgccaacac 347



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || ||||||||||| |    |||||||||||||| ||| || || 
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| ||||||||||| || |||||||  ||||||||||||| ||| |||| |
Sbjct: 814 agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 755

                      
Query: 493 aacacggcgaa 503
           |||||||||||
Sbjct: 754 aacacggcgaa 744



to top

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 128/155 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 788 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcggctccg 729

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  |||||||||||||| || ||||| ||||||||||| || ||||||| ||| ||||||
Sbjct: 728 aaactcctggccgggttaataccggttccggtgatcggaatagtggccaagtgaaccatg 669

                                              
Query: 493 aacacggcgaagccgatcgggaggggcgccaacac 527
           ||||| || || || ||||| || |||||||||||
Sbjct: 668 aacaccgcaaatccaatcggaagtggcgccaacac 634



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||  || || || 
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatgatagcagctcca 756

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||| ||| |||||||||||||| || ||||| |||||||||||||  || |||| |
Sbjct: 755 aggctccgggcggggttgatgccggttccagtgatagggatggtggccaaatgaaccaag 696

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 695 aacaccgcgaa 685



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
            1-1, complete cds
          Length = 1351

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                        
Query: 373  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
            |||||||| | ||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 1015 acccagaaaacccagtggtcatcccaggcatgctgcttgttgtagatgatggcagcgcca 956

                                                                        
Query: 433  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
            || |||||||| ||||||||||| || |||||||  ||||||||||||| ||| |||| |
Sbjct: 955  agactcctggctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 896

                       
Query: 493  aacacggcgaa 503
            |||||||||||
Sbjct: 895  aacacggcgaa 885



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 786

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 785 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 726

                     
Query: 490 atgaacacgg 499
           ||||||||||
Sbjct: 725 atgaacacgg 716



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || |||||||| ||||||||   |||| | || ||||| |||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtcgccgttgaaaatcacggccgcc 769

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| |||
Sbjct: 768 ccgaaactcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaacc 709

                         
Query: 490 atgaacacggcgaa 503
           ||||| ||||||||
Sbjct: 708 atgaatacggcgaa 695



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 781

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 780 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 721

                     
Query: 490 atgaacacgg 499
           ||||||||||
Sbjct: 720 atgaacacgg 711



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 699

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 698 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 639

                     
Query: 490 atgaacacgg 499
           ||||||||||
Sbjct: 638 atgaacacgg 629



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 783

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 782 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 723

                     
Query: 490 atgaacacgg 499
           ||||||||||
Sbjct: 722 atgaacacgg 713



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 109/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||||||||||||||| ||||| |  ||||||||||||||||| || 
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacggcagct 770

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| |||||||| || |||||||| || || || || ||||| |  || |||
Sbjct: 769 ccaaaactcctagccgggtttattccggtgccagtaattggaattgtggctaaatgaacc 710

                     
Query: 490 atgaacacgg 499
           ||||||||||
Sbjct: 709 atgaacacgg 700



to top

>emb|AJ249384.1|SOL249384 Spinacia oleracea mRNA for PM28B protein (pm28b gene)
          Length = 913

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 125/152 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| |||| |||||| || | |||||||||| |||| |  || || |||
Sbjct: 809 acccagaaaatccaatgatgatcccaagcatggtccttgttgaagataatagcagcaccc 750

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| |||||||| ||||| || ||||| ||||||||||||| ||| |||| |
Sbjct: 749 agactcctggctgggttgattccggtacctgtgatggggatggtggccaagtgaaccagg 690

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| || || ||||||||
Sbjct: 689 aacaccgcaaatccgataggcagtggcgccaa 658



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 409 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
           |||||||||||||  ||||  || || ||||| || |||||||| ||||||||||| || 
Sbjct: 785 ttgttgtagatgatagcggtaccaagactcctagcagggttgataccggtgccggtaatg 726

                                                                   
Query: 469 gggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 524
           ||||||||||||| ||| |||| |||||| ||||| ||||| |||||||| |||||
Sbjct: 725 gggatggtggccaagtgaaccaagaacacagcgaacccgattgggaggggtgccaa 670



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 410 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 469
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 829 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 770

                                                               
Query: 470 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgc 521
           ||||||| |||||||| || | ||| ||||||||||| || ||||| |||||
Sbjct: 769 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgc 718



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                            
Query: 421      acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
                |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 21009488 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 21009429

                                                
Query: 481      aggtggaccatgaacacggcgaagccgatcgg 512
                ||||| || | |||||| ||||| ||||||||
Sbjct: 21009428 aggtgcacgacgaacaccgcgaacccgatcgg 21009397



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 410 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 469
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 820 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 761

                                                               
Query: 470 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgc 521
           ||||||| |||||||| || | ||| ||||||||||| || ||||| |||||
Sbjct: 760 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgc 709



to top

>dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1274F11
          Length = 171257

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                          
Query: 421    acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
              |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 101577 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 101518

                                              
Query: 481    aggtggaccatgaacacggcgaagccgatcgg 512
              ||||| || | |||||| ||||| ||||||||
Sbjct: 101517 aggtgcacgacgaacaccgcgaacccgatcgg 101486



to top

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 750 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 691

                                           
Query: 481 aggtggaccatgaacacggcgaagccgatcgg 512
           ||||| || | |||||| ||||| ||||||||
Sbjct: 690 aggtgcacgacgaacaccgcgaacccgatcgg 659



to top

>dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-G06, full
           insert sequence
          Length = 1066

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 648 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 589

                                           
Query: 481 aggtggaccatgaacacggcgaagccgatcgg 512
           ||||| || | |||||| ||||| ||||||||
Sbjct: 588 aggtgcacgacgaacaccgcgaacccgatcgg 557



to top

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 748 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 689

                                           
Query: 481 aggtggaccatgaacacggcgaagccgatcgg 512
           ||||| || | |||||| ||||| ||||||||
Sbjct: 688 aggtgcacgacgaacaccgcgaacccgatcgg 657



to top

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
           |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 743 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 684

                                           
Query: 481 aggtggaccatgaacacggcgaagccgatcgg 512
           ||||| || | |||||| ||||| ||||||||
Sbjct: 683 aggtgcacgacgaacaccgcgaacccgatcgg 652



to top

>gb|AY107675.1| Zea mays PCO112712 mRNA sequence
          Length = 791

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 95/112 (84%)
 Strand = Plus / Minus

                                                                       
Query: 410 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 469
           ||||||||| || |||||| || ||||| |  || ||||||||||||||||||||||| |
Sbjct: 253 tgttgtagacgatggcggcgccgaggctgcgcgcggggttgatgccggtgccggtgatgg 194

                                                               
Query: 470 ggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgc 521
           ||||||| |||||||| || | ||| ||||||||||| || ||||| |||||
Sbjct: 193 ggatggtcgccaggtgcacgaggaagacggcgaagcctatggggagcggcgc 142



to top

>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone: P0478E02
          Length = 140715

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                         
Query: 421   acggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcc 480
             |||||||| || |||||||| |||||||||||||| |||||||||||||| || || |||
Sbjct: 30788 acggcggcgccgaggctcctcgccgggttgatgcccgtgccggtgatcggaatcgtcgcc 30729

                                             
Query: 481   aggtggaccatgaacacggcgaagccgatcgg 512
             ||||| || | |||||| ||||| ||||||||
Sbjct: 30728 aggtgcacgacgaacaccgcgaacccgatcgg 30697



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| |||||||| || || |||||||| |||||||||||||  || |||| |
Sbjct: 755 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 696

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 695 aacaccgcgaa 685



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 374 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccca 433
           ||||||| ||||||||||||||||| | ||| |  |||  |||||| || ||||| ||||
Sbjct: 754 cccagaaaatccactgatcatcccatgtcttttttttgccgtagatcacagcggctccca 695

                                                                       
Query: 434 ggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatga 493
            ||| | ||||||||| ||||| || |||||||||||||| ||||||| ||||||||| |
Sbjct: 694 agctacgggccgggttaatgccagttccggtgatcgggatcgtggccaagtggaccataa 635

                  
Query: 494 acacggc 500
           | |||||
Sbjct: 634 aaacggc 628



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || ||||||||||| |  | |||||||||||||| ||| || || 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || ||||||||||| || |||||||  ||||||||||||| ||| |||| |
Sbjct: 818 agacttcttgctgggttgatgccagttccggtgacggggatggtggccaagtgcaccaag 759

                      
Query: 493 aacacggcgaa 503
           |||||||||||
Sbjct: 758 aacacggcgaa 748



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 766

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| |||||||| || || |||||||| |||||||||||||  || |||| |
Sbjct: 765 agactcctggcagggttgataccagttccggtgattgggatggtggccaaatgaaccaag 706

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 705 aacaccgcgaa 695



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || ||||| || 
Sbjct: 789 acccagaaaatccagtggtcatcccacggcttggactcgttgtagataaccgcggctcca 730

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  |||||||||||||| || ||||| |||||||| || || ||||||| ||| ||||||
Sbjct: 729 aaactcctggccgggttaatcccggttccggtgattggaatagtggccaagtgaaccatg 670

                                              
Query: 493 aacacggcgaagccgatcgggaggggcgccaacac 527
           |||||||| || || || || || |||||||||||
Sbjct: 669 aacacggcaaatccaattggaagtggcgccaacac 635



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | |||||| || |||||||| || || |||||||| || |||||||||| ||| ||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681

             
Query: 493 aa 494
           ||
Sbjct: 680 aa 679



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| ||||| |||||||||||||| || || || || 
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           | |||||| || |||||||| || || |||||||| || |||||||||| ||| ||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattggaatggtggccaagtgaaccatg 681

             
Query: 493 aa 494
           ||
Sbjct: 680 aa 679



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                        
Query: 423  ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
            |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 4551 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 4492

                                  
Query: 483  gtggaccatgaacacggcgaag 504
            |||||| | ||| |||||||||
Sbjct: 4491 gtggacgaggaagacggcgaag 4470



to top

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 815 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 756

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 755 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 696

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 695 aacaccgcaaacccaatcggaagtggcgccaaaaccg 659



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715

            
Query: 490 a 490
           |
Sbjct: 714 a 714



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||  || || || 
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatgattgctgcacca 740

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| ||||| || || || ||||| || |||||||| |||| ||| |||| |
Sbjct: 739 agactcctggcggggttaatacctgtaccggtaatagggatggttgccaagtgcaccaag 680

                
Query: 493 aacac 497
           |||||
Sbjct: 679 aacac 675



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 726

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 725 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 666

            
Query: 490 a 490
           |
Sbjct: 665 a 665



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 775

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 774 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 715

            
Query: 490 a 490
           |
Sbjct: 714 a 714



to top

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccg 644



to top

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccg 644



to top

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 791 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 732

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 731 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 672

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 671 aacaccgcaaacccaatcggaagtggcgccaaaaccg 635



to top

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccg 644



to top

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 800 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 740 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 681

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 680 aacaccgcaaacccaatcggaagtggcgccaaaaccg 644



to top

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 492 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 433

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 432 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 373

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 372 aacaccgcaaacccaatcggaagtggcgccaaaaccg 336



to top

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 801 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 742

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 741 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 682

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 681 aacaccgcaaacccaatcggaagtggcgccaaaaccg 645



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 99

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 98  ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 39

            
Query: 490 a 490
           |
Sbjct: 38  a 38



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 358

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 357 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 298

            
Query: 490 a 490
           |
Sbjct: 297 a 297



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 764

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 763 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 704

            
Query: 490 a 490
           |
Sbjct: 703 a 703



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 739

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 738 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 679

            
Query: 490 a 490
           |
Sbjct: 678 a 678



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 773

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || |||||||||||||| ||||| || || || || |||||||| |||| ||| |||
Sbjct: 772 ccgagactcctggccgggttaatgccagttccagtaattgggatggtagccaagtgcacc 713

            
Query: 490 a 490
           |
Sbjct: 712 a 712



to top

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 128/157 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||| || || 
Sbjct: 816 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggcagctccg 757

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 756 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 697

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 696 aacaccgcaaacccaatcggaagtggcgccaaaaccg 660



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 423 ggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccag 482
           |||||| || ||||| | ||| ||||||||||||||||||||||| ||||||||||| ||
Sbjct: 864 ggcggcgccgaggctgcgggcggggttgatgccggtgccggtgatggggatggtggcgag 805

                                
Query: 483 gtggaccatgaacacggcgaa 503
           |||||| | ||| ||||||||
Sbjct: 804 gtggacgaggaagacggcgaa 784



to top

>gb|AY333929.1| Pringlea antiscorbutica putative transmembrane protein mRNA,
           partial cds
          Length = 380

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 126/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| |  | ||||||||||||||| | |||||| 
Sbjct: 219 ccgacccagaaaatccaatggtcgtcccaagagtggtccttgttgtagataatggcggct 160

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || ||||| || || |||||||| || || ||||| ||||| || || |||||||| |||
Sbjct: 159 ccaaggcttctagctgggttgattccagttccggttatcggaattgtcgccaggtgtacc 100

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           | |||||| || || ||||| ||||| ||||||||
Sbjct: 99  aagaacactgcaaacccgattgggagtggcgccaa 65



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 126/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 755

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || ||||| || |||||||| || || |||||||| |||||| | |||| ||| |||
Sbjct: 754 ccaagactcctagctgggttgattcctgttccggtgattgggatgctcgccaagtgaacc 695

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 694 aagaacaccgcgaatccgattgggagtggtgccaa 660



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagcacca 756

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| || || || ||||| |||||||| |||| |||||||| |
Sbjct: 755 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 696

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 695 aacacagcgaa 685



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| ||||||| ||| || |  || ||||||||||||| ||| || || 
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatgatggctgcaccg 808

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || | ||||||||| || || |||||||||||||| ||||| |||| ||| |||| |
Sbjct: 807 agacttcgggccgggttaatacccgtgccggtgatcggaatggtagccaagtgcaccaag 748

                      
Query: 493 aacacggcgaa 503
           || ||||||||
Sbjct: 747 aagacggcgaa 737



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| ||||||||||| |||  ||| | |||| ||||||  || || || 
Sbjct: 797 acccagaagatccagtgatcatcccatgcccggtcttggttgaagatgatagcagctcca 738

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           ||||||| ||| ||| |||| ||||| |||||||| |||||||||||||  || |||| |
Sbjct: 737 aggctccgggcgggggtgataccggttccggtgattgggatggtggccaaatgaaccaag 678

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 677 aacaccgcgaa 667



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||  || || || 
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatgatagcagcaccg 746

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || ||||| || |||||||||||||| || ||||| |||||||| |||| ||| |||| |
Sbjct: 745 agactccttgctgggttgatgccggttccagtgattgggatggttgccaagtgaaccaag 686

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 685 aacactgcgaa 675



to top

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| ||||||||   |||| | || ||||| |||
Sbjct: 794 ccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttgaaaatcacggccgcc 735

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || |  ||||| ||||||||||| ||||| |||||||| || || ||||| ||||| |||
Sbjct: 734 ccgaaactcctcgccgggttgattccggtaccggtgattggaatagtggcaaggtgaacc 675

                         
Query: 490 atgaacacggcgaa 503
           ||||| ||||||||
Sbjct: 674 atgaatacggcgaa 661



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||  ||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatgattgc 824

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || ||||| ||||  || |||||||| || || || || || ||||| ||||||| |||
Sbjct: 823 agcacccagactccgagctgggttgatcccagttcctgtaattgggattgtggccaagtg 764

                             
Query: 486 gaccatgaacacggcgaa 503
            |||| |||||| |||||
Sbjct: 763 caccaagaacacagcgaa 746



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||||||||| || |||||||| || |  |||||||||||||||| ||| || 
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatgatggcagct 31

                                     
Query: 430 cccaggctcctggccgggttgatgcc 455
           || || |||||||||||||| |||||
Sbjct: 30  ccgagactcctggccgggttaatgcc 5



to top

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 436 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 495
           |||||||||||||| |||||||| |||||||  ||||||||||||| ||| |||||||||
Sbjct: 790 ctcctggccgggttaatgccggtaccggtgactgggatggtggccaagtgaaccatgaac 731

             
Query: 496 ac 497
           ||
Sbjct: 730 ac 729



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 173/218 (79%)
 Strand = Plus / Minus

                                                                       
Query: 280 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 339
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 340 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 399
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                                                       
Query: 400 gccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtg 459
           || ||||||||||| |||||||| || || || |  ||||| || ||||||||||| || 
Sbjct: 787 gctttgtccttgttatagatgacagcagctcctaaactcctagcagggttgatgccagtt 728

                                                 
Query: 460 ccggtgatcgggatggtggccaggtggaccatgaacac 497
           || ||||| || || ||||||| ||| || ||||||||
Sbjct: 727 ccagtgatgggaatagtggccaagtgaacaatgaacac 690



to top

>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A)
            transcript variant AT3G53420.1 mRNA, complete cds
          Length = 1347

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                        
Query: 373  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
            ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 1017 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 958

                                                                        
Query: 433  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
            |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 957  aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 898

                                                 
Query: 493  aacacggcgaagccgatcgggaggggcgccaacaccg 529
            |||||||| || ||||| || || |||||||||||||
Sbjct: 897  aacacggcaaatccgattggaagtggcgccaacaccg 861



to top

>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant
           AT3G53420.2 mRNA, complete cds
          Length = 1278

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 967 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 908

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 907 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 848

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 847 aacacggcaaatccgattggaagtggcgccaacaccg 811



to top

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccg 663



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 445 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
           |||||||| |||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726



to top

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 752 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 693

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 692 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 633

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 632 aacaccgcaaacccaatcggaagtggcgccaaaaccg 596



to top

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  |||||| ||||| ||||  || || 
Sbjct: 767 acccagaatatccagtggtcatcccatggcttgctcttgttatagattacggacgctccg 708

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||||||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 707 aaactcctagccgggttgatgccggttccggtgatcggaatagtggccaaatgtaccata 648

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 647 aacaccgcaaacccaatcggaagtggcgccaaaaccg 611



to top

>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a
          Length = 1112

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacaccg 641



to top

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccg 663



to top

>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (At3g53420) mRNA, complete cds
          Length = 1122

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 809 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 750

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 749 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 690

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 689 aacacggcaaatccgattggaagtggcgccaacaccg 653



to top

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| |||||||| || || | ||| || ||||| | |||| |||| ||||| || || 
Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || ||||| || |||||||||||||||||||| ||||| |||||||| | ||| ||||||
Sbjct: 737 agactccttgctgggttgatgccggtgccggtaatcggaatggtggctaagtgaaccatg 678

                
Query: 493 aacac 497
           |||||
Sbjct: 677 aacac 673



to top

>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1112

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacaccg 661



to top

>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 864

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacaccg 602



to top

>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (F4P12.12) mRNA, complete cds
          Length = 956

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 758 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 699

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 698 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 639

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 638 aacacggcaaatccgattggaagtggcgccaacaccg 602



to top

>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1129

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 817 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 758

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 757 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 698

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 697 aacacggcaaatccgattggaagtggcgccaacaccg 661



to top

>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 800 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 741

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 740 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 681

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 680 aacacggcaaatccgattggaagtggcgccaacaccg 644



to top

>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1035

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 797 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 738

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 737 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 678

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 677 aacacggcaaatccgattggaagtggcgccaacaccg 641



to top

>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1071

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 805 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 746

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 745 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 686

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 685 aacacggcaaatccgattggaagtggcgccaacaccg 649



to top

>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS52ZB11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 801 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 742

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 741 aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 682

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           |||||||| || ||||| || || |||||||||||||
Sbjct: 681 aacacggcaaatccgattggaagtggcgccaacaccg 645



to top

>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence
          Length = 1352

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                        
Query: 373  acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
            ||||| || ||||| || |||||||| | ||||  |||||||||||| ||||| || || 
Sbjct: 1019 acccaaaatatccagtggtcatcccatggcttgctcttgttgtagattacggcagctccg 960

                                                                        
Query: 433  aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
            |  ||||| |||||||| || ||||| ||||| || || ||||| ||||  || ||||||
Sbjct: 959  aaactccttgccgggttaattccggttccggtaatgggaatggtagccaaatgtaccatg 900

                                                 
Query: 493  aacacggcgaagccgatcgggaggggcgccaacaccg 529
            |||||||| || ||||| || || |||||||||||||
Sbjct: 899  aacacggcaaatccgattggaagtggcgccaacaccg 863



to top

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 819 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 760

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 759 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 700

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 699 aacaccgcaaacccaatcggaagtggcgccaaaaccg 663



to top

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 127/157 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  ||||||  |||| |||||||| || 
Sbjct: 802 acccagaatatccagtggtcatcccatggcttgctcttgttaaagattacggcggctccg 743

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| ||||||||||| ||||| ||||||||||| || |||||||  || ||||| 
Sbjct: 742 aaactcctagccgggttgataccggttccggtgatcggaatagtggccaaatgtaccata 683

                                                
Query: 493 aacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||| || || || ||||| || |||||||| ||||
Sbjct: 682 aacaccgcaaacccaatcggaagtggcgccaaaaccg 646



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 445 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacac 497
           |||||||| |||||||||||||| ||||||||||||||||| |||| ||||||
Sbjct: 778 gggttgattccggtgccggtgatggggatggtggccaggtgaaccaagaacac 726



to top

>ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) transcript variant
           AT4G00430.2 mRNA, complete cds
          Length = 1367

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 996 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 937

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 936 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 877

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 876 aacactgcaaatccgattgggagcggcgccaa 845



to top

>ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G00430 (TMP-C)
           transcript variant AT4G00430.1 mRNA, complete cds
          Length = 1643

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 868 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 809

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 808 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 749

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 748 aacactgcaaatccgattgggagcggcgccaa 717



to top

>gb|BT000330.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1331

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 662 aacactgcaaatccgattgggagcggcgccaa 631



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           |||||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || 
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagct 741

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || ||||| || |||||||| || || || || || |||||||| || | |||||||
Sbjct: 740 ccaagactccttgctgggttgattccagttccagtaatggggatggttgctaagtggacc 681

                               
Query: 490 atgaacacggcgaagccgat 509
           | |||||| ||||| |||||
Sbjct: 680 aagaacacagcgaatccgat 661



to top

>emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major intrinsic protein PIPb
          Length = 1179

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| | ||| || |||||||| || |  || |||||||| |||| ||| || 
Sbjct: 843 ccgacccagaaaacccagtggtcatcccaagcatgatctttgttgtaaatgatggctgca 784

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || || | ||| ||||||||||| || || |||||||| ||||| ||||||||||| 
Sbjct: 783 ccaagactacgggcggggttgatgcccgtcccagtgatcggaatggtcgccaggtggact 724

                               
Query: 490 atgaacacggcgaagccgat 509
           | |||||||||||| |||||
Sbjct: 723 aagaacacggcgaatccgat 704



to top

>gb|AY120785.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1083

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 860 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 801

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 800 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 741

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 740 aacactgcaaatccgattgggagcggcgccaa 709



to top

>gb|AY099825.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1631

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 856 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 797

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 796 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 737

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 736 aacactgcaaatccgattgggagcggcgccaa 705



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Minus

                                                                       
Query: 375 ccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccag 434
           |||||||||||| || |||||||| || ||||||||||||||||| || || || || | 
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagatcacagcagctccaaa 709

                                                                       
Query: 435 gctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaa 494
            || || || |||||||| || || || ||||| ||||||||||||||||| || |||||
Sbjct: 708 acttctagcagggttgataccagttccagtgattgggatggtggccaggtgaacgatgaa 649



to top

>gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds
          Length = 864

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 782 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 723

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 722 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 663

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 662 aacactgcaaatccgattgggagcggcgccaa 631



to top

>emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZD01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1155

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 975 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 916

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 915 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 856

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 855 aacactgcaaatccgattgggagcggcgccaa 824



to top

>emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1000

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 843 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 784

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 783 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 724

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 723 aacactgcaaatccgattgggagcggcgccaa 692



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 409 ttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatc 468
           |||||||| ||||| || ||||| | |||||||||||||||||| || ||||| ||||| 
Sbjct: 759 ttgttgtacatgactgcagccccaaagctcctggccgggttgataccagtgccagtgatg 700

                                           
Query: 469 gggatggtggccaggtggaccatgaacacggc 500
           || |||||||  ||||| |||||||| |||||
Sbjct: 699 ggaatggtggttaggtgaaccatgaaaacggc 668



to top

>dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1024

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 819 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 760

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 759 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 700

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 699 aacactgcaaatccgattgggagcggcgccaa 668



to top

>dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1100

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 123/152 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| |  | ||||||||||||||| |  ||||| || 
Sbjct: 915 acccagaaaatccaatggtcatcccaagagtggtccttgttgtagataattgcggctcca 856

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| ||||| ||||||||||| || || |||| ||| |||| |
Sbjct: 855 agacttctagctgggttgattccggtcccggtgatcggtattgttgccaagtgtaccaag 796

                                           
Query: 493 aacacggcgaagccgatcgggaggggcgccaa 524
           ||||| || || ||||| ||||| ||||||||
Sbjct: 795 aacactgcaaatccgattgggagcggcgccaa 764



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 109/132 (82%), Gaps = 1/132 (0%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||  || || || 
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatgatagcagctcca 756

                                                                       
Query: 433 aggctcctggc-cgggttgatgccggtgccggtgatcgggatggtggccaggtggaccat 491
           || ||||||||  |||||||| || || |||||||| |||||||||||||  || |||| 
Sbjct: 755 agactcctggcaggggttgataccagttccggtgattgggatggtggccaaatgaaccaa 696

                       
Query: 492 gaacacggcgaa 503
           |||||| |||||
Sbjct: 695 gaacaccgcgaa 684



to top

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| |
Sbjct: 794 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 735

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 734 aacactgcgaa 724



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||| ||| || |||||||| || |||||||||||  |||||| ||| || || 
Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgttcaagatgatggcagcacca 757

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || || || |||||||| || || || ||||| |||||||| |||| |||||||| |
Sbjct: 756 agacttcttgctgggttgattccagttccagtgatggggatggttgccaagtggaccaag 697

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 696 aacacagcgaa 686



to top

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| |
Sbjct: 734 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 675

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 674 aacactgcgaa 664



to top

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || |||| ||| || |  || | |||||||||||  || || || 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| |
Sbjct: 545 agactcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaag 486

                      
Query: 493 aacacggcgaa 503
           ||||| |||||
Sbjct: 485 aacactgcgaa 475



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 95/115 (82%)
 Strand = Plus / Minus

                                                                       
Query: 367 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 426
           ||||| |||||||||||||| || |||||||| || | ||| |||||| |||||| ||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatgatggcg 807

                                                                  
Query: 427 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 481
           || || || ||||| |||||||| ||||| || || || || |||||||| ||||
Sbjct: 806 gctccaagactccttgccgggttaatgccagttccagttatggggatggtagcca 752



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 107/131 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||||||||| || ||||||||||| | |||| ||||||||||||  ||||| || 
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatgattgcggcacca 711

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || || |  || ||||| || || || |||||||| |||||||| |||| ||| |||| |
Sbjct: 710 agactacgtgcggggttaatacctgtaccggtgattgggatggtagccaagtgcaccaag 651

                      
Query: 493 aacacggcgaa 503
           || ||||||||
Sbjct: 650 aatacggcgaa 640



to top

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                         
Query: 391   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
             |||||||| | ||||  |||||| ||||| ||||| || || |  ||||| |||||||||
Sbjct: 25113 tcatcccatggcttgctcttgttatagattacggcagctccgaaactcctagccgggttg 25054

                                                                         
Query: 451   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 510
             |||||||| ||||||||||| || |||||||  || ||||| ||||| || || || |||
Sbjct: 25053 atgccggttccggtgatcggaatagtggccaaatgtaccataaacaccgcaaacccaatc 24994

                           
Query: 511   gggaggggcgccaa 524
             || || ||||||||
Sbjct: 24993 ggaagtggcgccaa 24980



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                         
Query: 391   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
             |||||||| | ||||  ||||||  |||| |||||||| || |  ||||| |||||||||
Sbjct: 20235 tcatcccatggcttgctcttgttaaagattacggcggctccgaaactcctagccgggttg 20294

                                                                         
Query: 451   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 510
             || ||||| ||||||||||| || |||||||  || ||||| ||||| || || || |||
Sbjct: 20295 ataccggttccggtgatcggaatagtggccaaatgtaccataaacaccgcaaacccaatc 20354

                           
Query: 511   gggaggggcgccaa 524
             || || ||||||||
Sbjct: 20355 ggaagtggcgccaa 20368



to top

>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12
          Length = 144628

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 112/138 (81%)
 Strand = Plus / Plus

                                                                         
Query: 391   tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
             |||||||| | ||||  |||||||||||| ||||| || || |  ||||| |||||||| 
Sbjct: 44790 tcatcccatggcttgctcttgttgtagattacggcagctccgaaactccttgccgggtta 44849

                                                                         
Query: 451   atgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatc 510
             || ||||| ||||| || || ||||| ||||  || |||||||||||||| || ||||| 
Sbjct: 44850 attccggttccggtaatgggaatggtagccaaatgtaccatgaacacggcaaatccgatt 44909

                               
Query: 511   gggaggggcgccaacacc 528
             || || ||||||||||||
Sbjct: 44910 ggaagtggcgccaacacc 44927



to top

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 436 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 495
           ||||| || ||||||||||||||||| ||||| |||||||||||||  || |||||||||
Sbjct: 808 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 749

             
Query: 496 ac 497
           ||
Sbjct: 748 ac 747



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| |||||||| || |||||||||||||| |  | |||||| ||||| || || || 
Sbjct: 848 acccaaaagatccaatggtcatcccaggccttctgttggttgtacatgacagcagctcct 789

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |||||||| || ||||| ||||| ||||| || |  |||||| |||||| ||| ||||||
Sbjct: 788 aggctcctagcagggttaatgccagtgcctgttactgggatgttggccaagtgaaccatg 729

                         
Query: 493 aacacggcgaagcc 506
           ||||| || |||||
Sbjct: 728 aacacagcaaagcc 715



to top

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 436 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 495
           ||||| || ||||||||||||||||| ||||| |||||||||||||  || |||||||||
Sbjct: 592 ctcctagcagggttgatgccggtgccagtgatggggatggtggccaaatgaaccatgaac 533

             
Query: 496 ac 497
           ||
Sbjct: 532 ac 531



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 394 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 453
           ||||| || |||||||||||| ||||||  || || || || ||||| || |||||||||
Sbjct: 779 tcccaagcgttgtccttgttgaagatgattgcagctccaagactccttgctgggttgatg 720

                                                                       
Query: 454 ccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaagccgatcggg 513
           || || || ||||| |||||||| || | |||||||| |||||| ||||| ||||| |||
Sbjct: 719 ccagtaccagtgatggggatggttgctaagtggaccaagaacacagcgaatccgataggg 660

             
Query: 514 ag 515
           ||
Sbjct: 659 ag 658



to top

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 417
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 418 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 477
           || ||||| || || | ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

                                        
Query: 478 gccaggtggaccatgaacacggcgaagcc 506
           || |  || |||||||| ||||| |||||
Sbjct: 703 gctaaatgaaccatgaagacggcaaagcc 675



to top

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 436 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 495
           ||||| ||||||||||| ||||| ||||||||||| || ||||| ||||| |||||||| 
Sbjct: 791 ctcctcgccgggttgattccggtaccggtgatcggaatagtggcaaggtgaaccatgaat 732

                
Query: 496 acggc 500
           |||||
Sbjct: 731 acggc 727



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 147/185 (79%)
 Strand = Plus / Minus

                                                                       
Query: 325 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 384
           ||||||||||| ||||| || || || || || || || | ||| ||||||||||| |||
Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878

                                                                       
Query: 385 cactgatcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggcc 444
           || || |||||||| ||||| ||||||   ||||| || || || || | ||| |  |||
Sbjct: 877 cattggtcatcccatgccttatccttgccatagatcacagcagctccgaagcttcgagcc 818

                                                                       
Query: 445 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaag 504
           || || || || || |||||||| || |||||||||||||| |||||||||||||| || 
Sbjct: 817 ggattaataccagttccggtgattggaatggtggccaggtgaaccatgaacacggcaaat 758

                
Query: 505 ccgat 509
           |||||
Sbjct: 757 ccgat 753



to top

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggcca 481
           ||||||||||| ||||||||||| ||||||||||| || ||||||||||
Sbjct: 380 aggctcctggcagggttgatgccagtgccggtgataggtatggtggcca 332



to top

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 411 gttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgg 470
           |||| |||| ||||| || || || ||||| ||||||||||| |||||||||||||||||
Sbjct: 742 gttgaagataacggcagcgccaagactcctagccgggttgattccggtgccggtgatcgg 683

                    
Query: 471 gatggtggc 479
            ||||||||
Sbjct: 682 aatggtggc 674



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| |||| ||| || |||||||| || |||||||||||| |||||| ||| || || 
Sbjct: 798 acccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatgatggcagctcca 739

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || ||||| || |||||||| || || || || || |||||||| || | |||||||| |
Sbjct: 738 agactccttgctgggttgattccagttccagtaatggggatggttgctaagtggaccaag 679

                            
Query: 493 aacacggcgaagccgat 509
           ||||| ||||| |||||
Sbjct: 678 aacacagcgaatccgat 662



to top

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtag 417
           |||||||| || || ||||| || ||||| || || ||||||||||| || |||||||| 
Sbjct: 823 ccgatcatcggtccaacccaaaaaatccattggtcgtcccaggccttttcgttgttgtaa 764

                                                                       
Query: 418 atgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtg 477
           || ||||| || || | ||| |  ||||||||||| ||||| |||||||| || ||||||
Sbjct: 763 ataacggcagctccaaagctacgagccgggttgataccggttccggtgatgggaatggtg 704

                                        
Query: 478 gccaggtggaccatgaacacggcgaagcc 506
           || |  || |||||||| ||||| |||||
Sbjct: 703 gctaaatgaaccatgaagacggcaaagcc 675



to top

>gb|DQ228343.1| Solanum tuberosum clone 148A12 unknown mRNA
          Length = 1082

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 436 ctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaac 495
           |||||||| ||||||||||| || |||||||| |||||||||||||  || |||| ||||
Sbjct: 775 ctcctggcggggttgatgccagttccggtgatggggatggtggccaaatgaaccaagaac 716

                   
Query: 496 acggcgaa 503
           || |||||
Sbjct: 715 accgcgaa 708



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| ||||| ||||| || | ||| |||||||||||||  || || || 
Sbjct: 801 acccagaatatccaatgatcgtcccatgcgtggtctttgttgtagatgattgctgctcca 742

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           || |||||||| ||||| || || || || || || |||||||| |||| |||||||| |
Sbjct: 741 agactcctggcggggttaataccagtacccgtaatagggatggtcgccaagtggaccaag 682

                   
Query: 493 aacacggc 500
           ||||||||
Sbjct: 681 aacacggc 674



to top

>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1
          Length = 197119

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                          
Query: 405    gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 464
              ||||||||||||||| |  ||||| || || || || || |||||||| ||||| |||||
Sbjct: 185351 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 185410

                                                                          
Query: 465    gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 524
              |||||| || || |||| ||| |||| |||||| || || ||||| ||||| ||||||||
Sbjct: 185411 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 185470



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 408 cttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgat 467
           ||||||||| |||||||| || || |  || ||||| ||||||||||| ||||| |||||
Sbjct: 763 cttgttgtaaatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgat 704

                                               
Query: 468 cgggatggtggccaggtggaccatgaacacggcgaa 503
            ||||||||||| ||||| || | |||||| |||||
Sbjct: 703 ggggatggtggcaaggtgaacaaggaacacagcgaa 668



to top

>emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for putative aquaporin, exon 1
          Length = 880

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 408 cttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgat 467
           ||||||||| |||||||| || || |  || ||||| ||||||||||| ||||| |||||
Sbjct: 741 cttgttgtaaatgacggcagctccaaaacttctggctgggttgatgccagtgccagtgat 682

                                               
Query: 468 cgggatggtggccaggtggaccatgaacacggcgaa 503
            ||||||||||| ||||| || | |||||| |||||
Sbjct: 681 ggggatggtggcaaggtgaacaaggaacacagcgaa 646



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 394 tcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttgatg 453
           |||||||||||||| ||||||||||| || || || || ||||| || || ||||| |||
Sbjct: 485 tcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgctgggtttatg 426

                                           
Query: 454 ccggtgccggtgatcgggatggtggccaggtg 485
           || ||||| ||||| ||||| ||||| |||||
Sbjct: 425 ccagtgccagtgattgggattgtggcaaggtg 394



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 tcatcccaggccttgtccttgttgtagatgacggcggcccccaggctcctggccgggttg 450
           ||||||||||||||||||| |||||| || || || || || |  ||||| || ||||||
Sbjct: 428 tcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctgggttg 369

                                                       
Query: 451 atgccggtgccggtgatcgggatggtggccaggtggaccatgaa 494
           ||||| ||||| ||||| || ||||| |||| ||| ||||||||
Sbjct: 368 atgccagtgccagtgattggaatggtagccaagtgaaccatgaa 325



to top

>gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10
          Length = 111906

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                         
Query: 405   gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 464
             ||||||||||||||| |  ||||| || || || || || |||||||| ||||| |||||
Sbjct: 85870 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 85929

                                                                         
Query: 465   gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 524
             |||||| || || |||| ||| |||| |||||| || || ||||| ||||| ||||||||
Sbjct: 85930 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 85989



to top

>gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10
          Length = 111906

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Minus

                                                                         
Query: 405   gtccttgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggt 464
             ||||||||||||||| |  ||||| || || || || || |||||||| ||||| |||||
Sbjct: 26037 gtccttgttgtagataattgcggctccaagacttctagctgggttgattccggtcccggt 25978

                                                                         
Query: 465   gatcgggatggtggccaggtggaccatgaacacggcgaagccgatcgggaggggcgccaa 524
             |||||| || || |||| ||| |||| |||||| || || ||||| ||||| ||||||||
Sbjct: 25977 gatcggtattgttgccaagtgtaccaagaacactgcaaatccgattgggagcggcgccaa 25918



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 849

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 848 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 789

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 788 aagaacacagcgaatccgattgggagtggtgccaa 754



to top

>gb|DQ226558.1| Boechera divaricarpa isolate SLW-1-E08 mRNA sequence
          Length = 591

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 487 accatgaacacggcgaagccgatcgggaggggcgccaacaccg 529
           ||||||||||||||||| |||||||| || |||||||||||||
Sbjct: 1   accatgaacacggcgaatccgatcggaagtggcgccaacaccg 43



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 736

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 735 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 676

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 675 aagaacacagcgaatccgattgggagtggtgccaa 641



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 723

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 722 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 663

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 662 aagaacacagcgaatccgattgggagtggtgccaa 628



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcc 429
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||  || || 
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatgattgcagct 767

                                                                       
Query: 430 cccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggacc 489
           || || ||||| || ||||| || || || |||||||| || || || |||| ||| |||
Sbjct: 766 ccaagactcctagctgggttaattcctgttccggtgattggaatcgtcgccaagtgaacc 707

                                              
Query: 490 atgaacacggcgaagccgatcgggaggggcgccaa 524
           | |||||| ||||| ||||| ||||| || |||||
Sbjct: 706 aagaacacagcgaatccgattgggagtggtgccaa 672



to top

>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1026

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           |||||||| ||||| || |||||||| | ||||  || ||||||||| || || || || 
Sbjct: 777 acccagaatatccagtggtcatcccacggcttggactcgttgtagataaccgcagctccg 718

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || || || ||||||||||| || ||||||| ||| ||||||
Sbjct: 717 aaactccttgccgggttaattcctgttccggtgatcggaatagtggccaagtgaaccatg 658

                                              
Query: 493 aacacggcgaagccgatcgggaggggcgccaacac 527
           || || || || || ||||| || |||||||||||
Sbjct: 657 aagaccgcaaaccctatcggaagtggcgccaacac 623



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 445 gggttgatgccggtgccggtgatcgggatggtggccaggtggaccatgaacacggcgaa 503
           |||||||||||||| |||||||| ||||||||||||| ||| ||||  ||||| |||||
Sbjct: 774 gggttgatgccggttccggtgatggggatggtggccaagtgaaccaaaaacacagcgaa 716



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 367 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcg 426
           ||||| ||||||||||||||||| || ||||| |||||| |    ||||| |  ||||||
Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttgccgccattgtacaccacggcg 718

                                                                       
Query: 427 gcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtgg 486
           || || | |||||| || || ||||| ||||| |||||||  ||||| ||||| ||||| 
Sbjct: 717 gcgccaaagctccttgctggattgatcccggttccggtgacggggatagtggcgaggtgc 658

                                  
Query: 487 accatgaacacggcgaagccgat 509
            |||||| ||||||||| |||||
Sbjct: 657 gccatgagcacggcgaacccgat 635



to top

>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2),
           complete cds
          Length = 1126

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 124/155 (80%)
 Strand = Plus / Minus

                                                                       
Query: 373 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggccccc 432
           ||||| || ||||| || |||||||||| ||||  || |||| |||||||||| || || 
Sbjct: 804 acccaaaatatccagtggtcatcccagggcttgctctcgttgaagatgacggctgctccg 745

                                                                       
Query: 433 aggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtggaccatg 492
           |  ||||| |||||||| || || || |||||||| || ||||| |||| ||| ||||||
Sbjct: 744 aaactccttgccgggttaataccagttccggtgatgggaatggtagccaagtgcaccatg 685

                                              
Query: 493 aacacggcgaagccgatcgggaggggcgccaacac 527
           ||||| || || || || || || |||||||||||
Sbjct: 684 aacaccgcaaatccaattggaagtggcgccaacac 650



to top

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 120/150 (80%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 969 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 910

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||| |||
Sbjct: 909 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgccaagtg 850

                                         
Query: 486 gaccatgaacacggcgaagccgatcgggag 515
            |||| ||| || || || ||||| |||||
Sbjct: 849 aaccaagaaaaccgcaaacccgattgggag 820



to top

>gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrinsic protein (PIP1)
           mRNA, complete cds
          Length = 1268

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 410 tgttgtagatgacggcggcccccaggctcctggccgggttgatgccggtgccggtgatcg 469
           |||||||||||| ||| |  || || ||||| || |||||||| |||||||| || |  |
Sbjct: 824 tgttgtagatgatggcagtaccaagactcctagcagggttgataccggtgccagtaacgg 765

                                             
Query: 470 ggatggtggccaggtggaccatgaacacggcgaa 503
           |||||||||||| ||| |||| ||||||||||||
Sbjct: 764 ggatggtggccaagtgaaccaagaacacggcgaa 731



to top

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 120/150 (80%)
 Strand = Plus / Minus

                                                                       
Query: 366 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacggc 425
           |||||| ||||| || | ||| || ||||||||||  | ||| |||||||||||||  ||
Sbjct: 873 ggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttgtagatgattgc 814

                                                                       
Query: 426 ggcccccaggctcctggccgggttgatgccggtgccggtgatcgggatggtggccaggtg 485
            || || ||||| || || ||||||||||| ||||| ||||| |||||||| |||| |||
Sbjct: 813 agctccaaggcttctagctgggttgatgcctgtgccagtgattgggatggttgccaagtg 754

                                         
Query: 486 gaccatgaacacggcgaagccgatcgggag 515
            |||| ||| || || || ||||| |||||
Sbjct: 753 aaccaagaaaaccgcaaacccgattgggag 724


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,246,737
Number of Sequences: 3902068
Number of extensions: 4246737
Number of successful extensions: 80041
Number of sequences better than 10.0: 399
Number of HSP's better than 10.0 without gapping: 398
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 77939
Number of HSP's gapped (non-prelim): 2063
length of query: 529
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 506
effective length of database: 17,143,297,704
effective search space: 8674508638224
effective search space used: 8674508638224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top