ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags3l21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_638595.1| Dictyostelium discoideum hypothetical protein (... 52 0.002
2ref|XM_638616.1| Dictyostelium discoideum transforming acidic co... 48 0.036
3ref|XM_635276.1| Dictyostelium discoideum hypothetical protein (... 46 0.14
4gb|BC046262.1| Xenopus laevis similar to Heat shock cognate prot... 46 0.14
5gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001... 46 0.14
6gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B0702... 46 0.14
7gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B5701... 46 0.14
8gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/... 46 0.14
9gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B1501... 46 0.14
10gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/... 46 0.14
11gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B0801... 46 0.14
12gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B0801... 46 0.14
13ref|NG_002397.2| Homo sapiens major histocompatibility complex, ... 46 0.14
14emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chr... 46 0.14
15emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on ch... 46 0.14
16emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chro... 46 0.14
17emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chr... 46 0.14
18emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chro... 46 0.14
19dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 46 0.14
20gb|DQ310791.1| Tetranychus urticae heat shock cognate 70 (hsc70)... 46 0.14
21gb|AC004210.1|AC004210 Homo sapiens clone UWGC:y5c028 from 6p21,... 46 0.14
22dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21... 46 0.14
23ref|XM_632700.1| Dictyostelium discoideum hypothetical protein (... 44 0.57
24ref|XM_632606.1| Dictyostelium discoideum hypothetical protein (... 44 0.57
25emb|CR381700.6| Zebrafish DNA sequence from clone CH211-198F4 in... 44 0.57
26emb|BX649276.6| Zebrafish DNA sequence from clone CH211-79C14 in... 44 0.57
27emb|AL359402.3|CNS05TEX Human chromosome 14 DNA sequence BAC C-2... 44 0.57
28ref|XM_631750.1| Dictyostelium discoideum hypothetical protein (... 42 2.2
29ref|XM_641244.1| Dictyostelium discoideum hypothetical protein (... 42 2.2
30gb|DQ483832.1| Gymnogyps californianus clone 255F microsatellite... 42 2.2
31gb|DQ483780.1| Gymnogyps californianus clone 203F microsatellite... 42 2.2
32gb|DQ483761.1| Gymnogyps californianus clone 184F microsatellite... 42 2.2
33gb|DQ483754.1| Gymnogyps californianus clone 177F microsatellite... 42 2.2
34gb|DQ483739.1| Gymnogyps californianus clone 162F microsatellite... 42 2.2
35gb|AC110259.17| Mus musculus chromosome 5, clone RP23-287A8, com... 42 2.2
36emb|CR788305.17| Zebrafish DNA sequence from clone DKEYP-59G5 in... 42 2.2
37emb|AL445071.15| Human DNA sequence from clone RP11-460H18 on ch... 42 2.2
38emb|AL391241.21| Human DNA sequence from clone RP13-158L7 on chr... 42 2.2
39gb|AC103596.2| Homo sapiens chromosome 1 clone RP4-669H10, compl... 42 2.2
40gb|AC009785.8| Homo sapiens chromosome 7 clone RP11-198E23, comp... 42 2.2
41gb|AC104260.5| Homo sapiens chromosome 15, clone CTD-2536I1, com... 42 2.2
42gb|AC016322.9| Homo sapiens chromosome 15, clone RP11-29B16, com... 42 2.2
43gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete... 42 2.2
44dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
45gb|AY963685.1| Homo sapiens mutL 3 homolog (E.coli) (MLH3) gene,... 42 2.2
46dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
47gb|AC006530.4|AC006530 Homo sapiens chromosome 14 clone BAC 316E... 42 2.2
48gb|AF195658.1|AF195658 Homo sapiens DNA mismatch repair protein ... 42 2.2
49emb|AL049780.4|CNS00007 Human chromosome 14 DNA sequence BAC R-9... 42 2.2
50ref|XM_633505.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
51gb|AY312461.1| Accipiter gentilis clone Age-11 microsatellite se... 40 8.9
52ref|XM_633443.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
53ref|XM_633380.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
54ref|XM_633212.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
55ref|XM_633211.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
56ref|XM_632573.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
57ref|XM_632489.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
58ref|XM_632163.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
59ref|XM_632086.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
60ref|XM_631654.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
61ref|XM_641564.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
62ref|XM_641219.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
63ref|XM_641150.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
64ref|XM_640483.1| Dictyostelium discoideum putative LISK family p... 40 8.9
65ref|XM_640983.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
66ref|XM_639840.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
67ref|XM_638754.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
68ref|XM_637092.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
69ref|XM_636973.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
70ref|XM_636611.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
71ref|XM_636336.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
72ref|XM_635818.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
73ref|XM_635579.1| Dictyostelium discoideum AAA ATPase domain-cont... 40 8.9
74ref|XM_635400.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
75ref|XM_630438.1| Dictyostelium discoideum putative myb transcrip... 40 8.9
76ref|XM_630212.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
77ref|XM_629866.1| Dictyostelium discoideum putative alpha kinase ... 40 8.9
78ref|XM_629827.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
79ref|XM_628897.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
80ref|XM_628747.1| Dictyostelium discoideum hypothetical protein (... 40 8.9
81ref|XM_482489.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.9
82ref|XM_459491.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 8.9
83gb|AC034255.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 8.9
84gb|AC026891.3| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 8.9
85gb|AY382207.1| Polistes annularis cytochrome oxidase subunit I (... 40 8.9
86gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, co... 40 8.9
87gb|AC092129.3| Homo sapiens chromosome 16 clone RP11-140O8, comp... 40 8.9
88gb|DQ483807.1| Gymnogyps californianus clone 230F microsatellite... 40 8.9
89gb|DQ483795.1| Gymnogyps californianus clone 218F microsatellite... 40 8.9
90gb|DQ483793.1| Gymnogyps californianus clone 216F microsatellite... 40 8.9
91gb|DQ483788.1| Gymnogyps californianus clone 211F microsatellite... 40 8.9
92gb|DQ483783.1| Gymnogyps californianus clone 206F microsatellite... 40 8.9
93gb|DQ483774.1| Gymnogyps californianus clone 197F microsatellite... 40 8.9
94gb|DQ483769.1| Gymnogyps californianus clone 192F microsatellite... 40 8.9
95gb|DQ483764.1| Gymnogyps californianus clone 187F microsatellite... 40 8.9
96gb|DQ483757.1| Gymnogyps californianus clone 180F microsatellite... 40 8.9
97gb|DQ483749.1| Gymnogyps californianus clone 172F microsatellite... 40 8.9
98gb|DQ483740.1| Gymnogyps californianus clone 163F microsatellite... 40 8.9
99gb|DQ483737.1| Gymnogyps californianus clone 160F microsatellite... 40 8.9
100gb|DQ483725.1| Gymnogyps californianus clone 148F microsatellite... 40 8.9
101gb|DQ483699.1| Gymnogyps californianus clone 122F microsatellite... 40 8.9
102gb|DQ483695.1| Gymnogyps californianus clone 118F microsatellite... 40 8.9
103gb|DQ483682.1| Gymnogyps californianus clone 105F microsatellite... 40 8.9
104gb|DQ483643.1| Gymnogyps californianus clone 66F microsatellite ... 40 8.9
105gb|DQ483639.1| Gymnogyps californianus clone 62F microsatellite ... 40 8.9
106gb|DQ483631.1| Gymnogyps californianus clone 54F microsatellite ... 40 8.9
107gb|DQ483624.1| Gymnogyps californianus clone 47F microsatellite ... 40 8.9
108gb|DQ483623.1| Gymnogyps californianus clone 46F microsatellite ... 40 8.9
109gb|DQ483607.1| Gymnogyps californianus clone 30F microsatellite ... 40 8.9
110gb|DQ483606.1| Gymnogyps californianus clone 29F microsatellite ... 40 8.9
111gb|DQ483601.1| Gymnogyps californianus clone 24F microsatellite ... 40 8.9
112gb|DQ483524.1| Gymnogyps californianus clone 83D microsatellite ... 40 8.9
113gb|DQ483499.1| Gymnogyps californianus clone 58D microsatellite ... 40 8.9
114gb|DQ483961.1| Gymnogyps californianus clone 127G microsatellite... 40 8.9
115gb|DQ483299.1| Gymnogyps californianus clone 2H microsatellite s... 40 8.9
116emb|CT010456.8| Mouse DNA sequence from clone RP23-96D14 on chro... 40 8.9
117emb|BX936451.13| Zebrafish DNA sequence from clone CH211-201F1 i... 40 8.9
118gb|AC124349.4| Mus musculus BAC clone RP24-463G19 from chromosom... 40 8.9
119gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosom... 40 8.9
120emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in... 40 8.9
121ref|XM_718951.1| Plasmodium yoelii yoelii str. 17XNL erythrocyte... 40 8.9
122ref|XM_950215.1| Theileria annulata strain Ankara hypothetical p... 40 8.9
123gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, comple... 40 8.9
124gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B1402... 40 8.9
125gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B1402... 40 8.9
126ref|XM_661677.1| Cryptosporidium hominis TU502 F6D8.20 (Chro.703... 40 8.9
127ref|XM_661868.1| Cryptosporidium hominis TU502 hypothetical prot... 40 8.9
128gb|AC117598.7| Mus musculus chromosome 1, clone RP23-398H16, com... 40 8.9
129gb|AC145985.2| Pan troglodytes BAC clone RP43-17I24 from 7, comp... 40 8.9
130emb|BX957319.7| Zebrafish DNA sequence from clone CH211-113J14 i... 40 8.9
131gb|AC144928.17| Medicago truncatula clone mth2-8a18, complete se... 40 8.9
132emb|CR524825.5| Zebrafish DNA sequence from clone CH211-15N24 in... 40 8.9
133emb|AL163249.2|HS21C049 Homo sapiens chromosome 21 segment HS21C049 40 8.9
134emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chro... 40 8.9
135emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chrom... 40 8.9
136gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9... 40 8.9
137gb|AF129075.3| Homo sapiens chromosome 21 clone RP1-100J12, Rp1-... 40 8.9
138emb|AL161911.17| Human DNA sequence from clone RP11-27I1 on chro... 40 8.9
139emb|AL023807.6|HS525L6 Human DNA sequence from clone RP3-525L6 o... 40 8.9
140emb|CR853297.8| Zebrafish DNA sequence from clone DKEYP-118B3 in... 40 8.9
141emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS... 40 8.9
142emb|AL031745.8|PFMAL1P2 Plasmodium falciparum DNA from MAL1P2 40 8.9
143emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2 40 8.9
144emb|BX323836.9| Zebrafish DNA sequence from clone CH211-249D6 in... 40 8.9
145gb|AC092125.2| Homo sapiens chromosome 16 clone RP11-109D24, com... 40 8.9
146emb|CR385052.5| Zebrafish DNA sequence from clone CH211-166F3 in... 40 8.9
147emb|BX510939.5| Zebrafish DNA sequence from clone CH211-78C9 in ... 40 8.9
148emb|BX537280.12| Zebrafish DNA sequence from clone DKEY-228C11 i... 40 8.9
149gb|AC016525.11| Homo sapiens chromosome 15 clone RP11-358M11 map... 40 8.9
150gb|AF286016.1|AF286016 Macrosiphoniella tanacetaria microsatelli... 40 8.9
151gb|AC010647.5| Homo sapiens chromosome 19 clone LLNLR-279F8, com... 40 8.9
152ref|XM_696907.1| PREDICTED: Danio rerio hypothetical protein LOC... 40 8.9
153emb|BX649265.5| Zebrafish DNA sequence from clone CH211-134G22 i... 40 8.9
154emb|BX296532.7| Zebrafish DNA sequence from clone CH211-281C19 i... 40 8.9
155gb|AC159251.2| Mus musculus BAC clone RP24-113B8 from chromosome... 40 8.9
156emb|BX511021.9| Zebrafish DNA sequence from clone DKEY-16P21 in ... 40 8.9
157gb|AC148665.1| Macaca mulatta Major Histocompatibility Complex B... 40 8.9
158emb|AL844567.22| Zebrafish DNA sequence from clone DKEY-77D17 in... 40 8.9
159ref|XM_625139.1| PREDICTED: Apis mellifera similar to CG5971-PA ... 40 8.9
160gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, co... 40 8.9
161dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
162gb|AC078776.12|AC078776 Homo sapiens 12 BAC RP11-155I9 (Roswell ... 40 8.9
163gb|AF349437.2| Danio rerio Dlx1a protein (dlx1a) gene, partial s... 40 8.9
164emb|BX784022.6| Zebrafish DNA sequence from clone CH211-152C8 in... 40 8.9
165gb|AC090532.1|AC090532 Homo sapiens chromosome 15 clone RP11-325... 40 8.9
166dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 40 8.9
167gb|AY518271.1| Dictyostelium minutum SpkA gene, partial cds; and... 40 8.9
168gb|AC037198.7|AC037198 Homo sapiens chromosome 15 clone CTD-2033... 40 8.9
169gb|AC008072.3| Homo sapiens BAC clone RP11-408N22 from 2, comple... 40 8.9
170gb|AC018741.5| Homo sapiens BAC clone RP11-458J18 from 2, comple... 40 8.9
171gb|AC116982.2| Dictyostelium discoideum chromosome 2 map 3622643... 40 8.9
172gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175... 40 8.9
173gb|AC117075.2| Dictyostelium discoideum chromosome 2 map 5201047... 40 8.9
174gb|AE014847.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 8.9
175gb|AE014846.1| Plasmodium falciparum 3D7 chromosome 12, section ... 40 8.9
176ref|NM_131877.2| Danio rerio caspase 3, apoptosis-related cystei... 40 8.9
177emb|BX005044.9| Zebrafish DNA sequence from clone DKEY-7L6 in li... 40 8.9
178dbj|AP007207.1| Mus musculus molossinus genomic DNA, chromosome ... 40 8.9
179dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 40 8.9
180emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in ... 40 8.9
181emb|BX119909.5| Zebrafish DNA sequence from clone CH211-223I3 in... 40 8.9
182emb|BX005141.5| Zebrafish DNA sequence from clone CH211-13K16, c... 40 8.9
183emb|BX248116.8| Zebrafish DNA sequence from clone CH211-245G15 i... 40 8.9
184dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
185dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
186dbj|AK102608.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.9
187gb|BC078310.1| Danio rerio caspase 3, apoptosis-related cysteine... 40 8.9
188emb|BX890563.6| Zebrafish DNA sequence from clone DKEY-195C14 in... 40 8.9
189emb|AL935186.22| Zebrafish DNA sequence from clone CH211-250M6 i... 40 8.9
190emb|BX088554.8| Zebrafish DNA sequence from clone DKEYP-4F12 in ... 40 8.9
191emb|BX248111.7| Zebrafish DNA sequence from clone DKEY-22L11 in ... 40 8.9
192emb|BX936337.9| Zebrafish DNA sequence from clone DKEY-100N23 in... 40 8.9
193gb|AC170740.3| Sorex araneus clone SA_Ba-535D8, complete sequence 40 8.9
194gb|AC004205.1|AC004205 Homo sapiens clone UWGC:y3c071 from 6p21,... 40 8.9
195gb|AC003688.1|AC003688 Homo sapiens chromosome 17, clone hRPC.4_... 40 8.9
196gb|AF275345.3| Lycopersicon esculentum putative permease gene, p... 40 8.9
197emb|AL928800.5| Zebrafish DNA sequence from clone CH211-233G21 i... 40 8.9
198gb|AC133709.11| Medicago truncatula clone mth2-7b3, complete seq... 40 8.9
199emb|CT476806.2| Pan troglodytes chromosome X BAC RP43-032D14, co... 40 8.9
200gb|U20661.1|DDU20661 Dictyostelium discoideum unknown internal r... 40 8.9
201emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chr... 40 8.9
202dbj|AB256346.1| Homo sapiens DNA, HIV-1 integration site, isolat... 40 8.9

>ref|XM_638595.1| Dictyostelium discoideum hypothetical protein (DDB0217656), partial
            mRNA
          Length = 8976

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 2    ataataataatagtaatgaagatggt 27
            ||||||||||||||||||||||||||
Sbjct: 2894 ataataataatagtaatgaagatggt 2919



to top

>ref|XM_638616.1| Dictyostelium discoideum transforming acidic coiled-coil-containing
            protein (DDB0220500), partial mRNA
          Length = 4437

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            ||||||||||||||||||||||||
Sbjct: 3050 ataataataatagtaatgaagatg 3073



to top

>ref|XM_635276.1| Dictyostelium discoideum hypothetical protein (DDB0205148), partial
           mRNA
          Length = 2652

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 2   ataataataatagtaatgaagat 24
           |||||||||||||||||||||||
Sbjct: 599 ataataataatagtaatgaagat 621



to top

>gb|BC046262.1| Xenopus laevis similar to Heat shock cognate protein 70, mRNA (cDNA
            clone MGC:53952 IMAGE:5570547), complete cds
          Length = 2202

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 383  aagagcaatgaccaaagataaca 405
            |||||||||||||||||||||||
Sbjct: 1386 aagagcaatgaccaaagataaca 1408



to top

>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic
             sequence
          Length = 346809

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 71931 atgccatgatgcaaacaccattg 71909



to top

>gb|DQ249181.1| Homo sapiens isolate 541CLS37 haplotype HLA-B070201/HLA-Cw07020103
             genomic sequence
          Length = 341361

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 70632 atgccatgatgcaaacaccattg 70610



to top

>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic
             sequence
          Length = 265420

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 75092 atgccatgatgcaaacaccattg 75070



to top

>gb|DQ249179.1| Homo sapiens isolate 495CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 338517

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 71117 atgccatgatgcaaacaccattg 71095



to top

>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401
             genomic sequence
          Length = 351341

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 86724 atgccatgatgcaaacaccattg 86702



to top

>gb|DQ249175.1| Homo sapiens isolate 144CLS7 haplotype HLA-B3801/HLA-Cw120301 genomic
             sequence
          Length = 328871

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 72100 atgccatgatgcaaacaccattg 72078



to top

>gb|DQ249174.1| Homo sapiens isolate 144CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 338544

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 82836 atgccatgatgcaaacaccattg 82814



to top

>gb|DQ249172.1| Homo sapiens isolate 135CLS49 haplotype HLA-B080101/HLA-Cw070101
             genomic sequence
          Length = 342745

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 63445 atgccatgatgcaaacaccattg 63423



to top

>ref|NG_002397.2| Homo sapiens major histocompatibility complex, class I, BC (HLA-BC) on
             chromosome 6
          Length = 89417

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 37407 atgccatgatgcaaacaccattg 37429



to top

>emb|AL662833.4| Human DNA sequence from clone XXbac-101P6 on chromosome 6 contains the
              gene for HCR, the TCF19 gene for  transcription factor 19,
              the POU5F1 gene for POU domain, class 5, transcription
              factor 1, a putative novel transcript, the HLA-C gene for
              major histocompatibility complex, class I, C, a ubiquitin
              specific protease 8 (USP8) pseudogene, a ribosomal protein
              L3 (RPL3) pseudogene, a WAS protein family, member 3
              (WASF3) pseudogene and  three CpG islands, complete
              sequence
          Length = 168887

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 267    atgccatgatgcaaacaccattg 289
              |||||||||||||||||||||||
Sbjct: 165300 atgccatgatgcaaacaccattg 165322



to top

>emb|AL671883.3| Human DNA sequence from clone XXbac-248L24 on chromosome 6 contains the
             HLA-C gene for major histocompatibility complex, class I,
             C, a ubiquitin specific protease 8 (USP8) pseudogene, a
             ribosomal protein L3 (RPL3) pseudogene, a WAS protein
             family, member 3 (WASF3) pseudogene, the HLA-B gene for
             major histocompatibility complex, class I, B, a
             dihydrofolate reductase pseudogene, a fibroblast growth
             factor receptor 3 (FGFR3) pseudogene and two CpG islands,
             complete sequence
          Length = 120197

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 40854 atgccatgatgcaaacaccattg 40876



to top

>emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chromosome 6, complete
             sequence
          Length = 106199

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 44867 atgccatgatgcaaacaccattg 44889



to top

>emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chromosome 6, complete
             sequence
          Length = 102821

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 44300 atgccatgatgcaaacaccattg 44322



to top

>emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chromosome 6, complete
             sequence
          Length = 63499

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 26225 atgccatgatgcaaacaccattg 26247



to top

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 267    atgccatgatgcaaacaccattg 289
              |||||||||||||||||||||||
Sbjct: 637959 atgccatgatgcaaacaccattg 637937



to top

>gb|DQ310791.1| Tetranychus urticae heat shock cognate 70 (hsc70) mRNA, complete cds
          Length = 2275

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 383  aagagcaatgaccaaagataaca 405
            |||||||||||||||||||||||
Sbjct: 1444 aagagcaatgaccaaagataaca 1466



to top

>gb|AC004210.1|AC004210 Homo sapiens clone UWGC:y5c028 from 6p21, complete sequence
          Length = 42601

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 267   atgccatgatgcaaacaccattg 289
             |||||||||||||||||||||||
Sbjct: 39699 atgccatgatgcaaacaccattg 39677



to top

>dbj|D84394.1| Homo sapiens genomic DNA, 237 kb segment from 6p21.3 region including HLA
              genes, complete sequence
          Length = 236822

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 267    atgccatgatgcaaacaccattg 289
              |||||||||||||||||||||||
Sbjct: 109129 atgccatgatgcaaacaccattg 109107



to top

>ref|XM_632700.1| Dictyostelium discoideum hypothetical protein (DDB0186866), partial
           mRNA
          Length = 2304

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 2   ataataataatagtaatgaagatggt 27
           |||||||||||| |||||||||||||
Sbjct: 86  ataataataataataatgaagatggt 111



to top

>ref|XM_632606.1| Dictyostelium discoideum hypothetical protein (DDB0186996), partial
            mRNA
          Length = 1197

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 2    ataataataatagtaatgaaga 23
            ||||||||||||||||||||||
Sbjct: 1085 ataataataatagtaatgaaga 1106



to top

>emb|CR381700.6| Zebrafish DNA sequence from clone CH211-198F4 in linkage group 14,
              complete sequence
          Length = 203630

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 2      ataataataatagtaatgaagatggt 27
              |||||||||||| |||||||||||||
Sbjct: 168655 ataataataataataatgaagatggt 168630



to top

>emb|BX649276.6| Zebrafish DNA sequence from clone CH211-79C14 in linkage group 22,
             complete sequence
          Length = 84049

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 2     ataataataatagtaatgaaga 23
             ||||||||||||||||||||||
Sbjct: 51752 ataataataatagtaatgaaga 51773



to top

>emb|AL359402.3|CNS05TEX Human chromosome 14 DNA sequence BAC C-2273N11 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 119296

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 2     ataataataatagtaatgaaga 23
             ||||||||||||||||||||||
Sbjct: 71327 ataataataatagtaatgaaga 71348



to top

>ref|XM_631750.1| Dictyostelium discoideum hypothetical protein (DDB0187832), partial
           mRNA
          Length = 2319

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   tataataataatagtaatgaa 21
           |||||||||||||||||||||
Sbjct: 406 tataataataatagtaatgaa 426



to top

>ref|XM_641244.1| Dictyostelium discoideum hypothetical protein (DDB0190606), partial
            mRNA
          Length = 4785

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 2    ataataataatagtaatgaag 22
            |||||||||||||||||||||
Sbjct: 2783 ataataataatagtaatgaag 2803



to top

>gb|DQ483832.1| Gymnogyps californianus clone 255F microsatellite sequence
          Length = 1198

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   tataataataatagtaatgaa 21
           |||||||||||||||||||||
Sbjct: 693 tataataataatagtaatgaa 673



to top

>gb|DQ483780.1| Gymnogyps californianus clone 203F microsatellite sequence
          Length = 1041

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   tataataataatagtaatgaa 21
           |||||||||||||||||||||
Sbjct: 268 tataataataatagtaatgaa 288



to top

>gb|DQ483761.1| Gymnogyps californianus clone 184F microsatellite sequence
          Length = 797

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   tataataataatagtaatgaa 21
           |||||||||||||||||||||
Sbjct: 171 tataataataatagtaatgaa 151



to top

>gb|DQ483754.1| Gymnogyps californianus clone 177F microsatellite sequence
          Length = 720

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   tataataataatagtaatgaa 21
           |||||||||||||||||||||
Sbjct: 602 tataataataatagtaatgaa 622



to top

>gb|DQ483739.1| Gymnogyps californianus clone 162F microsatellite sequence
          Length = 537

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   tataataataatagtaatgaa 21
           |||||||||||||||||||||
Sbjct: 402 tataataataatagtaatgaa 382



to top

>gb|AC110259.17| Mus musculus chromosome 5, clone RP23-287A8, complete sequence
          Length = 230585

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 4     aataataatagtaatgaagat 24
             |||||||||||||||||||||
Sbjct: 92916 aataataatagtaatgaagat 92896



to top

>emb|CR788305.17| Zebrafish DNA sequence from clone DKEYP-59G5 in linkage group 20,
             complete sequence
          Length = 187351

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 2     ataataataatagtaatgaag 22
             |||||||||||||||||||||
Sbjct: 65863 ataataataatagtaatgaag 65843



to top

>emb|AL445071.15| Human DNA sequence from clone RP11-460H18 on chromosome 10 Contains a
              peptidylprolyl isomerase A (cyclophilin A) (PPIA)(CYPA,
              CYPH) pseudogene, a ribosomal protein S24 (RPS24)
              pseudogene, the 5' end of a novel gene and a CpG island,
              complete sequence
          Length = 151478

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      ataataataatagtaatgaagatgg 26
              |||||||||||| ||||||||||||
Sbjct: 113214 ataataataataataatgaagatgg 113190



to top

>emb|AL391241.21| Human DNA sequence from clone RP13-158L7 on chromosome X Contains a
             zinc finger pseudogene, heat shock 70kD protein 8 (HSPA8)
             pseudogene and a nucleophosmin (nucleolar phosphoprotein
             B23, numatrin (NPM1)) pseudogene, complete sequence
          Length = 157860

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 120   ggcagcatatccatccagata 140
             |||||||||||||||||||||
Sbjct: 48116 ggcagcatatccatccagata 48096



to top

>gb|AC103596.2| Homo sapiens chromosome 1 clone RP4-669H10, complete sequence
          Length = 121021

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     tataataataatagtaatgaa 21
             |||||||||||||||||||||
Sbjct: 71260 tataataataatagtaatgaa 71240



to top

>gb|AC009785.8| Homo sapiens chromosome 7 clone RP11-198E23, complete sequence
          Length = 179145

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 365   gaaacagcagcaacttccaag 385
             |||||||||||||||||||||
Sbjct: 87475 gaaacagcagcaacttccaag 87495



to top

>gb|AC104260.5| Homo sapiens chromosome 15, clone CTD-2536I1, complete sequence
          Length = 191528

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 2     ataataataatagtaatgaagatgg 26
             ||||||||||||||||||| |||||
Sbjct: 82404 ataataataatagtaatgatgatgg 82380



to top

>gb|AC016322.9| Homo sapiens chromosome 15, clone RP11-29B16, complete sequence
          Length = 187466

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 2      ataataataatagtaatgaagatgg 26
              ||||||||||||||||||| |||||
Sbjct: 166244 ataataataatagtaatgatgatgg 166268



to top

>gb|AF222718.1| Chrysodidymus synuroideus mitochondrion, complete genome
          Length = 34119

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 2     ataataataatagtaatgaag 22
             |||||||||||||||||||||
Sbjct: 13214 ataataataatagtaatgaag 13234



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 356    accaaaccagaaacagcagca 376
              |||||||||||||||||||||
Sbjct: 931158 accaaaccagaaacagcagca 931178



to top

>gb|AY963685.1| Homo sapiens mutL 3 homolog (E.coli) (MLH3) gene, complete cds
          Length = 38902

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     ataataataatagtaatgaagatgg 26
             |||||||||||| ||||||||||||
Sbjct: 32595 ataataataataataatgaagatgg 32619



to top

>dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0019F11
          Length = 123673

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 356    accaaaccagaaacagcagca 376
              |||||||||||||||||||||
Sbjct: 112053 accaaaccagaaacagcagca 112073



to top

>gb|AC006530.4|AC006530 Homo sapiens chromosome 14 clone BAC 316E14 map 14q24.3, complete
              sequence
          Length = 203010

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      ataataataatagtaatgaagatgg 26
              |||||||||||| ||||||||||||
Sbjct: 170946 ataataataataataatgaagatgg 170922



to top

>gb|AF195658.1|AF195658 Homo sapiens DNA mismatch repair protein (MLH3) gene, complete cds
          Length = 36560

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     ataataataatagtaatgaagatgg 26
             |||||||||||| ||||||||||||
Sbjct: 32065 ataataataataataatgaagatgg 32089



to top

>emb|AL049780.4|CNS00007 Human chromosome 14 DNA sequence BAC R-950C14 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195891

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 2      ataataataatagtaatgaagatgg 26
              |||||||||||| ||||||||||||
Sbjct: 140872 ataataataataataatgaagatgg 140896



to top

>ref|XM_633505.1| Dictyostelium discoideum hypothetical protein (DDB0185981), partial
            mRNA
          Length = 3270

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 4    aataataatagtaatgaaga 23
            ||||||||||||||||||||
Sbjct: 2278 aataataatagtaatgaaga 2297



to top

>gb|AY312461.1| Accipiter gentilis clone Age-11 microsatellite sequence
          Length = 482

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 287 ataataataatagtaatgaa 306



to top

>ref|XM_633443.1| Dictyostelium discoideum hypothetical protein (DDB0186043),
          partial mRNA
          Length = 1146

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 2  ataataataatagtaatgaagatg 25
          |||||||||||| |||||||||||
Sbjct: 62 ataataataatattaatgaagatg 85



to top

>ref|XM_633380.1| Dictyostelium discoideum hypothetical protein (DDB0186138), partial
            mRNA
          Length = 1221

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 1052 ataataataataataatgaagatg 1075



to top

>ref|XM_633212.1| Dictyostelium discoideum hypothetical protein (DDB0186422), partial
           mRNA
          Length = 3114

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 626 ataataataatagtaatgaa 645



to top

>ref|XM_633211.1| Dictyostelium discoideum hypothetical protein (DDB0215823), partial
           mRNA
          Length = 3198

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 539 ataataataatagtaatgaa 558



to top

>ref|XM_632573.1| Dictyostelium discoideum hypothetical protein (DDB0187137), partial
           mRNA
          Length = 1869

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ataataataatagtaatgaagatg 25
           |||||||||||| |||||||||||
Sbjct: 824 ataataataataataatgaagatg 847



to top

>ref|XM_632489.1| Dictyostelium discoideum hypothetical protein (DDB0218854), partial
           mRNA
          Length = 2067

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ataataataatagtaatgaagatg 25
           |||||||||||| |||||||||||
Sbjct: 476 ataataataataataatgaagatg 499



to top

>ref|XM_632163.1| Dictyostelium discoideum hypothetical protein (DDB0187437), partial
            mRNA
          Length = 4386

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 2447 ataataataataataatgaagatg 2470



to top

>ref|XM_632086.1| Dictyostelium discoideum hypothetical protein (DDB0219241), partial
            mRNA
          Length = 1830

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1574 ataataataatagtaatgaa 1593



to top

>ref|XM_631654.1| Dictyostelium discoideum hypothetical protein (DDB0219336), partial
           mRNA
          Length = 2913

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 155 ataataataatagtaatgaa 174



to top

>ref|XM_641564.1| Dictyostelium discoideum hypothetical protein (DDB0190919), partial
           mRNA
          Length = 1158

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 845 ataataataatagtaatgaa 864



to top

>ref|XM_641219.1| Dictyostelium discoideum hypothetical protein (DDB0190583), partial
            mRNA
          Length = 4146

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1553 ataataataatagtaatgaa 1572



to top

>ref|XM_641150.1| Dictyostelium discoideum hypothetical protein (DDB0190519), partial
           mRNA
          Length = 1380

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ataataataatagtaatgaagatg 25
           |||||||||||| |||||||||||
Sbjct: 266 ataataataataataatgaagatg 289



to top

>ref|XM_640483.1| Dictyostelium discoideum putative LISK family protein kinase
            (DDB0229853), partial mRNA
          Length = 1584

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1055 ataataataatagtaatgaa 1074



to top

>ref|XM_640983.1| Dictyostelium discoideum hypothetical protein (DDB0201763), partial
           mRNA
          Length = 1113

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ataataataatagtaatgaagatg 25
           |||||||||||| |||||||||||
Sbjct: 287 ataataataataataatgaagatg 310



to top

>ref|XM_639840.1| Dictyostelium discoideum hypothetical protein (DDB0168944), partial
            mRNA
          Length = 1593

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 1232 ataataataataataatgaagatg 1255



to top

>ref|XM_638754.1| Dictyostelium discoideum hypothetical protein (DDB0217635), partial
            mRNA
          Length = 5394

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 4238 ataataataatagtaatgaa 4257



to top

>ref|XM_637092.1| Dictyostelium discoideum hypothetical protein (DDB0204481), partial
            mRNA
          Length = 2802

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1682 ataataataatagtaatgaa 1701



to top

>ref|XM_636973.1| Dictyostelium discoideum hypothetical protein (DDB0204362), partial
           mRNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ataataataatagtaatgaagatg 25
           |||||||||||| |||||||||||
Sbjct: 515 ataataataataataatgaagatg 538



to top

>ref|XM_636611.1| Dictyostelium discoideum hypothetical protein (DDB0205852), partial
           mRNA
          Length = 3285

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ataataataatagtaatgaagatg 25
           |||||||||||| |||||||||||
Sbjct: 521 ataataataataataatgaagatg 544



to top

>ref|XM_636336.1| Dictyostelium discoideum hypothetical protein (DDB0218209), partial
            mRNA
          Length = 2226

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1277 ataataataatagtaatgaa 1296



to top

>ref|XM_635818.1| Dictyostelium discoideum hypothetical protein (DDB0204107), partial
            mRNA
          Length = 4242

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1814 ataataataatagtaatgaa 1833



to top

>ref|XM_635579.1| Dictyostelium discoideum AAA ATPase domain-containing protein
            (DDB0220704), partial mRNA
          Length = 5403

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 3209 ataataataatagtaatgaa 3228



to top

>ref|XM_635400.1| Dictyostelium discoideum hypothetical protein (DDB0204281), partial
           mRNA
          Length = 3996

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 182 ataataataatagtaatgaa 201



to top

>ref|XM_630438.1| Dictyostelium discoideum putative myb transcription factor
            (DDB0220516), partial mRNA
          Length = 3984

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 2276 ataataataataataatgaagatg 2299



to top

>ref|XM_630212.1| Dictyostelium discoideum hypothetical protein (DDB0219680), partial
            mRNA
          Length = 7629

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    taataataatagtaatgaag 22
            ||||||||||||||||||||
Sbjct: 2439 taataataatagtaatgaag 2458



to top

>ref|XM_629866.1| Dictyostelium discoideum putative alpha kinase (DDB0220120),
           partial mRNA
          Length = 4059

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 48  aatatatagataaaagatggactt 71
           |||||||||| |||||||||||||
Sbjct: 338 aatatatagaaaaaagatggactt 361



to top

>ref|XM_629827.1| Dictyostelium discoideum hypothetical protein (DDB0184223), partial
            mRNA
          Length = 1602

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1520 ataataataatagtaatgaa 1539



to top

>ref|XM_628897.1| Dictyostelium discoideum hypothetical protein (DDB0219915), partial
            mRNA
          Length = 4212

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 1331 ataataataataataatgaagatg 1354



to top

>ref|XM_628747.1| Dictyostelium discoideum hypothetical protein (DDB0215138), partial
            mRNA
          Length = 2934

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 1532 ataataataataataatgaagatg 1555



to top

>ref|XM_482489.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3181

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 3    taataataatagtaatgaagatgg 26
            ||||| ||||||||||||||||||
Sbjct: 2187 taatagtaatagtaatgaagatgg 2210



to top

>ref|XM_459491.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0E04554g)
            partial mRNA
          Length = 2499

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 4    aataataatagtaatgaaga 23
            ||||||||||||||||||||
Sbjct: 1135 aataataatagtaatgaaga 1154



to top

>gb|AC034255.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-447L9, complete
             sequence
          Length = 37982

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 35396 ataataataatagtaatgatgatg 35419



to top

>gb|AC026891.3| Mus musculus strain C57BL6/J chromosome 6 clone RP23-56M2, complete
             sequence
          Length = 232327

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 13660 ataataataatagtaatgatgatg 13683



to top

>gb|AY382207.1| Polistes annularis cytochrome oxidase subunit I (COI) gene,
          partial cds; mitochondrial
          Length = 378

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                  
Query: 3  taataataatagtaatgaagatgg 26
          |||||||||||||||| |||||||
Sbjct: 31 taataataatagtaataaagatgg 8



to top

>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 158719 ataataataatagtaatgaa 158738



to top

>gb|AC092129.3| Homo sapiens chromosome 16 clone RP11-140O8, complete sequence
          Length = 190333

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 473   tttgcaggcttattggaaac 492
             ||||||||||||||||||||
Sbjct: 60890 tttgcaggcttattggaaac 60871



to top

>gb|DQ483807.1| Gymnogyps californianus clone 230F microsatellite sequence
          Length = 528

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 388 ataataataatagtaatgaa 369



to top

>gb|DQ483795.1| Gymnogyps californianus clone 218F microsatellite sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 219 ataataataatagtaatgaa 200



to top

>gb|DQ483793.1| Gymnogyps californianus clone 216F microsatellite sequence
          Length = 758

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 232 ataataataatagtaatgaa 213



to top

>gb|DQ483788.1| Gymnogyps californianus clone 211F microsatellite sequence
          Length = 641

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 401 ataataataatagtaatgaa 382



to top

>gb|DQ483783.1| Gymnogyps californianus clone 206F microsatellite sequence
          Length = 784

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 411 ataataataatagtaatgaa 392



to top

>gb|DQ483774.1| Gymnogyps californianus clone 197F microsatellite sequence
          Length = 1177

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 201 ataataataatagtaatgaa 182



to top

>gb|DQ483769.1| Gymnogyps californianus clone 192F microsatellite sequence
          Length = 661

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 460 ataataataatagtaatgaa 479



to top

>gb|DQ483764.1| Gymnogyps californianus clone 187F microsatellite sequence
          Length = 611

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 206 ataataataatagtaatgaa 187



to top

>gb|DQ483757.1| Gymnogyps californianus clone 180F microsatellite sequence
          Length = 733

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 566 ataataataatagtaatgaa 585



to top

>gb|DQ483749.1| Gymnogyps californianus clone 172F microsatellite sequence
          Length = 707

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 559 ataataataatagtaatgaa 578



to top

>gb|DQ483740.1| Gymnogyps californianus clone 163F microsatellite sequence
          Length = 1337

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 227 ataataataatagtaatgaa 208



to top

>gb|DQ483737.1| Gymnogyps californianus clone 160F microsatellite sequence
          Length = 617

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 476 ataataataatagtaatgaa 495



to top

>gb|DQ483725.1| Gymnogyps californianus clone 148F microsatellite sequence
          Length = 327

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 185 ataataataatagtaatgaa 204



to top

>gb|DQ483699.1| Gymnogyps californianus clone 122F microsatellite sequence
          Length = 550

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 346 ataataataatagtaatgaa 365



to top

>gb|DQ483695.1| Gymnogyps californianus clone 118F microsatellite sequence
          Length = 512

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 181 ataataataatagtaatgaa 162



to top

>gb|DQ483682.1| Gymnogyps californianus clone 105F microsatellite sequence
          Length = 757

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 210 ataataataatagtaatgaa 191



to top

>gb|DQ483643.1| Gymnogyps californianus clone 66F microsatellite sequence
          Length = 513

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 218 ataataataatagtaatgaa 199



to top

>gb|DQ483639.1| Gymnogyps californianus clone 62F microsatellite sequence
          Length = 550

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 409 ataataataatagtaatgaa 428



to top

>gb|DQ483631.1| Gymnogyps californianus clone 54F microsatellite sequence
          Length = 593

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 146 ataataataatagtaatgaa 127



to top

>gb|DQ483624.1| Gymnogyps californianus clone 47F microsatellite sequence
          Length = 470

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 281 ataataataatagtaatgaa 300



to top

>gb|DQ483623.1| Gymnogyps californianus clone 46F microsatellite sequence
          Length = 740

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 595 ataataataatagtaatgaa 614



to top

>gb|DQ483607.1| Gymnogyps californianus clone 30F microsatellite sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 177 ataataataatagtaatgaa 158



to top

>gb|DQ483606.1| Gymnogyps californianus clone 29F microsatellite sequence
          Length = 470

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 297 ataataataatagtaatgaa 316



to top

>gb|DQ483601.1| Gymnogyps californianus clone 24F microsatellite sequence
          Length = 547

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 177 ataataataatagtaatgaa 158



to top

>gb|DQ483524.1| Gymnogyps californianus clone 83D microsatellite sequence
          Length = 507

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 172 ataataataatagtaatgaa 153



to top

>gb|DQ483499.1| Gymnogyps californianus clone 58D microsatellite sequence
          Length = 806

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 178 ataataataatagtaatgaa 159



to top

>gb|DQ483961.1| Gymnogyps californianus clone 127G microsatellite sequence
          Length = 366

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 169 ataataataatagtaatgaa 150



to top

>gb|DQ483299.1| Gymnogyps californianus clone 2H microsatellite sequence
          Length = 360

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ataataataatagtaatgaa 21
           ||||||||||||||||||||
Sbjct: 181 ataataataatagtaatgaa 162



to top

>emb|CT010456.8| Mouse DNA sequence from clone RP23-96D14 on chromosome 12, complete
            sequence
          Length = 217223

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 4507 ataataataatagtaatgaa 4488



to top

>emb|BX936451.13| Zebrafish DNA sequence from clone CH211-201F1 in linkage group 21,
             complete sequence
          Length = 169828

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 26138 ataataataatagtaatgaa 26157



to top

>gb|AC124349.4| Mus musculus BAC clone RP24-463G19 from chromosome 12, complete
            sequence
          Length = 122944

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 9179 ataataataatagtaatgaa 9160



to top

>gb|AC122337.4| Mus musculus BAC clone RP23-351M10 from chromosome 12, complete
             sequence
          Length = 196396

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 20042 ataataataatagtaatgaa 20061



to top

>emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in linkage group 9,
             complete sequence
          Length = 153947

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 40381 ataataataatagtaatgaa 40400



to top

>ref|XM_718951.1| Plasmodium yoelii yoelii str. 17XNL erythrocyte membrane protein
            (PY03838) partial mRNA
          Length = 3270

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1    tataataataatagtaatga 20
            ||||||||||||||||||||
Sbjct: 1228 tataataataatagtaatga 1247



to top

>ref|XM_950215.1| Theileria annulata strain Ankara hypothetical protein (TA18595)
           partial mRNA
          Length = 708

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 1   tataataataatagtaatga 20
           ||||||||||||||||||||
Sbjct: 277 tataataataatagtaatga 258



to top

>gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, complete sequence
          Length = 172291

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 116509 ataataataatagtaatgaa 116528



to top

>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 363675

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   atgccatgatgcaaacacca 286
             ||||||||||||||||||||
Sbjct: 86324 atgccatgatgcaaacacca 86305



to top

>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic
             sequence
          Length = 336776

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   atgccatgatgcaaacacca 286
             ||||||||||||||||||||
Sbjct: 65428 atgccatgatgcaaacacca 65409



to top

>ref|XM_661677.1| Cryptosporidium hominis TU502 F6D8.20 (Chro.70339) partial mRNA
          Length = 1395

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1222 ataataataatagtaatgaa 1203



to top

>ref|XM_661868.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.70125)
            partial mRNA
          Length = 12237

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 6404 ataataataatagtaatgaa 6423



to top

>gb|AC117598.7| Mus musculus chromosome 1, clone RP23-398H16, complete sequence
          Length = 196300

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 2      ataataataatagtaatgaagatg 25
              ||||||||||||||||||| ||||
Sbjct: 143936 ataataataatagtaatgatgatg 143959



to top

>gb|AC145985.2| Pan troglodytes BAC clone RP43-17I24 from 7, complete sequence
          Length = 162953

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   cttcaaaagagcagcagcga 267
             ||||||||||||||||||||
Sbjct: 31068 cttcaaaagagcagcagcga 31087



to top

>emb|BX957319.7| Zebrafish DNA sequence from clone CH211-113J14 in linkage group 6,
             complete sequence
          Length = 59626

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 11709 ataataataatagtaatgatgatg 11686



to top

>gb|AC144928.17| Medicago truncatula clone mth2-8a18, complete sequence
          Length = 138948

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 416   tcaaaagttgctgtctaagagaat 439
             |||||||||| |||||||||||||
Sbjct: 36821 tcaaaagttgttgtctaagagaat 36798



to top

>emb|CR524825.5| Zebrafish DNA sequence from clone CH211-15N24 in linkage group 16,
             complete sequence
          Length = 134382

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 35788 ataataataatagtaatgaa 35807



to top

>emb|AL163249.2|HS21C049 Homo sapiens chromosome 21 segment HS21C049
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ccaaaccagcagaaaacagt 169
              ||||||||||||||||||||
Sbjct: 107030 ccaaaccagcagaaaacagt 107049



to top

>emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chromosome 6, complete
             sequence
          Length = 116320

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   atgccatgatgcaaacacca 286
             ||||||||||||||||||||
Sbjct: 42697 atgccatgatgcaaacacca 42716



to top

>emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chromosome 6 Contains the
             USP8P pseudogene for ubiquitin specific protease 8, the
             RPL3P2 pseudogene for ribosomal protein L3 pseudogene 2,
             the WASF5P pseudogene for WAS protein family, member 5,
             the HLA-B gene for major histocompatibility complex, class
             I, B, the DHFRP2 pseudogene for dihydrofolate reductase 2,
             the FGFR3P pseudogene for fibroblast growth factor
             receptor 3, the HLA-S gene for major histocompatibility
             complex, class I, S, the MICA gene for MHC class I
             polypeptide-related sequence A and 3 CpG islands, complete
             sequence
          Length = 148076

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   atgccatgatgcaaacacca 286
             ||||||||||||||||||||
Sbjct: 34124 atgccatgatgcaaacacca 34143



to top

>gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9 of 13 of the complete
             sequence
          Length = 250022

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             |||||||||||| |||||||||||
Sbjct: 18267 ataataataataataatgaagatg 18290



to top

>gb|AF129075.3| Homo sapiens chromosome 21 clone RP1-100J12, Rp1-P79E4 map q21.3-22.11,
              complete sequence
          Length = 190837

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    ccaaaccagcagaaaacagt 169
              ||||||||||||||||||||
Sbjct: 106866 ccaaaccagcagaaaacagt 106885



to top

>emb|AL161911.17| Human DNA sequence from clone RP11-27I1 on chromosome 9 Contains the
             FBXW2 gene for F-box and WD-40 domain protein 2 (FBW2),
             two novel genes, a UDP-Gal:betaGlcNAc beta
             1,3-galactosyltransferase, polypeptide 3 (B3GALT3)
             pseudogene, the PSMD5 gene for proteasome (prosome,
             macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072,
             MGC23145), the 3' end of a novel gene (DKFZP727G051) and
             two CpG islands, complete sequence
          Length = 109176

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||| ||||||
Sbjct: 50469 ataataataatagtaataaagatg 50446



to top

>emb|AL023807.6|HS525L6 Human DNA sequence from clone RP3-525L6 on chromosome 6p22.3-23 Contains
              the 5' end of a gene for a kinesin-like protein (RBKIN)
              protein, a ribosomal protein S12 (RPS12) pseudogene and a
              CpG Island, complete sequence
          Length = 168111

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 442    gtctttcatggttgggttca 461
              ||||||||||||||||||||
Sbjct: 165905 gtctttcatggttgggttca 165924



to top

>emb|CR853297.8| Zebrafish DNA sequence from clone DKEYP-118B3 in linkage group 15,
             complete sequence
          Length = 182283

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 34878 ataataataatagtaatgatgatg 34901



to top

>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces
              hansenii
          Length = 2037969

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      aataataatagtaatgaaga 23
              ||||||||||||||||||||
Sbjct: 324678 aataataatagtaatgaaga 324697



to top

>emb|AL031745.8|PFMAL1P2 Plasmodium falciparum DNA from MAL1P2
          Length = 384550

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 381318 ataataataatagtaatgaa 381337



to top

>emb|AL035475.7|PFMAL4P2 Plasmodium falciparum MAL4P2
          Length = 234081

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 184281 ataataataatagtaatgaa 184262



to top

>emb|BX323836.9| Zebrafish DNA sequence from clone CH211-249D6 in linkage group 13,
             complete sequence
          Length = 74669

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 34700 ataataataatagtaatgatgatg 34677



to top

>gb|AC092125.2| Homo sapiens chromosome 16 clone RP11-109D24, complete sequence
          Length = 173905

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 473   tttgcaggcttattggaaac 492
             ||||||||||||||||||||
Sbjct: 29997 tttgcaggcttattggaaac 30016



to top

>emb|CR385052.5| Zebrafish DNA sequence from clone CH211-166F3 in linkage group 1,
              complete sequence
          Length = 163401

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 110101 ataataataatagtaatgaa 110082



to top

>emb|BX510939.5| Zebrafish DNA sequence from clone CH211-78C9 in linkage group 16,
              complete sequence
          Length = 163843

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 123408 ataataataatagtaatgaa 123389



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 123261 ataataataatagtaatgaa 123242



to top

>emb|BX537280.12| Zebrafish DNA sequence from clone DKEY-228C11 in linkage group 1,
              complete sequence
          Length = 163151

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 109772 ataataataatagtaatgaa 109791



to top

>gb|AC016525.11| Homo sapiens chromosome 15 clone RP11-358M11 map 15q21.3, complete
             sequence
          Length = 256019

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     tataataataatagtaatga 20
             ||||||||||||||||||||
Sbjct: 31981 tataataataatagtaatga 32000



to top

>gb|AF286016.1|AF286016 Macrosiphoniella tanacetaria microsatellite Mt-8 sequence
          Length = 500

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   tataataataatagtaatga 20
           ||||||||||||||||||||
Sbjct: 304 tataataataatagtaatga 323



to top

>gb|AC010647.5| Homo sapiens chromosome 19 clone LLNLR-279F8, complete sequence
          Length = 40102

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    atatatagataaaagatgga 68
             ||||||||||||||||||||
Sbjct: 31615 atatatagataaaagatgga 31596



to top

>ref|XM_696907.1| PREDICTED: Danio rerio hypothetical protein LOC554369 (LOC554369),
            mRNA
          Length = 2918

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1413 ataataataatagtaatgaa 1432



to top

>emb|BX649265.5| Zebrafish DNA sequence from clone CH211-134G22 in linkage group 16,
            complete sequence
          Length = 178901

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 7559 ataataataatagtaatgaa 7578



to top

>emb|BX296532.7| Zebrafish DNA sequence from clone CH211-281C19 in linkage group 24,
             complete sequence
          Length = 155029

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 13805 ataataataatagtaatgatgatg 13828



to top

>gb|AC159251.2| Mus musculus BAC clone RP24-113B8 from chromosome 12, complete sequence
          Length = 200896

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 115973 ataataataatagtaatgaa 115954



to top

>emb|BX511021.9| Zebrafish DNA sequence from clone DKEY-16P21 in linkage group 3,
            complete sequence
          Length = 235632

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            ||||||||||||||||||| ||||
Sbjct: 3680 ataataataatagtaatgatgatg 3657



to top

>gb|AC148665.1| Macaca mulatta Major Histocompatibility Complex BAC MMU023M02, complete
             sequence
          Length = 182939

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   atgccatgatgcaaacacca 286
             ||||||||||||||||||||
Sbjct: 90021 atgccatgatgcaaacacca 90040



to top

>emb|AL844567.22| Zebrafish DNA sequence from clone DKEY-77D17 in linkage group 16,
             complete sequence
          Length = 174845

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 10229 ataataataatagtaatgaa 10210



to top

>ref|XM_625139.1| PREDICTED: Apis mellifera similar to CG5971-PA (LOC552763), mRNA
          Length = 1650

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 361  accagaaacagcagcaactt 380
            ||||||||||||||||||||
Sbjct: 1122 accagaaacagcagcaactt 1103



to top

>gb|AC120057.9| Homo sapiens chromosome 17, clone CTD-2545G14, complete sequence
          Length = 198821

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 148    ttccaaaccagcagaaaacagttt 171
              ||||||| ||||||||||||||||
Sbjct: 195257 ttccaaagcagcagaaaacagttt 195234



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 3        taataataatagtaatgaagatgg 26
                ||||| ||||||||||||||||||
Sbjct: 20557239 taatagtaatagtaatgaagatgg 20557262



to top

>gb|AC078776.12|AC078776 Homo sapiens 12 BAC RP11-155I9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 95801

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     tataataataatagtaatga 20
             ||||||||||||||||||||
Sbjct: 93387 tataataataatagtaatga 93368



to top

>gb|AF349437.2| Danio rerio Dlx1a protein (dlx1a) gene, partial sequence; dlx1a/dlx2a
            intergenic region, complete sequence; and Dlx2a protein
            (dlx2a) gene, partial sequence
          Length = 8387

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 6499 ataataataataataatgaagatg 6522



to top

>emb|BX784022.6| Zebrafish DNA sequence from clone CH211-152C8 in linkage group 18,
             complete sequence
          Length = 153244

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 13374 ataataataatagtaatgatgatg 13397



to top

>gb|AC090532.1|AC090532 Homo sapiens chromosome 15 clone RP11-325L11 map 15q21.3, complete
              sequence
          Length = 168862

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      tataataataatagtaatga 20
              ||||||||||||||||||||
Sbjct: 143701 tataataataatagtaatga 143720



to top

>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 267    atgccatgatgcaaacacca 286
              ||||||||||||||||||||
Sbjct: 591735 atgccatgatgcaaacacca 591716



to top

>gb|AY518271.1| Dictyostelium minutum SpkA gene, partial cds; and cAMP receptor 1 and
            DtmA genes, complete cds
          Length = 4873

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 2928 ataataataatagtaatgaa 2947



to top

>gb|AC037198.7|AC037198 Homo sapiens chromosome 15 clone CTD-2033D15 map 15q14, complete sequence
          Length = 185695

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 1      tataataataatagtaatgaagat 24
              |||||||||||||||||| |||||
Sbjct: 137971 tataataataatagtaataaagat 137994



to top

>gb|AC008072.3| Homo sapiens BAC clone RP11-408N22 from 2, complete sequence
          Length = 206177

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 161121 ataataataatagtaatgaa 161140



to top

>gb|AC018741.5| Homo sapiens BAC clone RP11-458J18 from 2, complete sequence
          Length = 151231

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1164 ataataataatagtaatgaa 1183



to top

>gb|AC116982.2| Dictyostelium discoideum chromosome 2 map 3622643-3879522 strain AX4,
              complete sequence
          Length = 256879

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 125876 ataataataatagtaatgaa 125857



to top

>gb|AC116305.2| Dictyostelium discoideum chromosome 2 map 1005175-1418323 strain AX4,
             complete sequence
          Length = 413138

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 66528 ataataataatagtaatgaa 66547



to top

>gb|AC117075.2| Dictyostelium discoideum chromosome 2 map 5201047-5455781 strain AX4,
            complete sequence
          Length = 254733

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 2157 ataataataataataatgaagatg 2134



to top

>gb|AE014847.1| Plasmodium falciparum 3D7 chromosome 12, section 4 of 9 of the complete
             sequence
          Length = 252650

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 55082 ataataataatagtaatgaa 55101



to top

>gb|AE014846.1| Plasmodium falciparum 3D7 chromosome 12, section 3 of 9 of the complete
             sequence
          Length = 253132

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 65392 ataataataatagtaatgaa 65373



to top

>ref|NM_131877.2| Danio rerio caspase 3, apoptosis-related cysteine protease (casp3),
            mRNA
          Length = 2950

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1417 ataataataatagtaatgaa 1436



to top

>emb|BX005044.9| Zebrafish DNA sequence from clone DKEY-7L6 in linkage group 2,
            complete sequence
          Length = 174623

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 2926 ataataataatagtaatgaa 2907



to top

>dbj|AP007207.1| Mus musculus molossinus genomic DNA, chromosome 1 clone:MSMg01-122K03,
             complete sequence
          Length = 173324

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 79967 ataataataatagtaatgatgatg 79990



to top

>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 267    atgccatgatgcaaacacca 286
              ||||||||||||||||||||
Sbjct: 187993 atgccatgatgcaaacacca 187974



to top

>emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in linkage group 7, complete
              sequence
          Length = 199752

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      ataataataatagtaatgaagatg 25
              ||||||||||||||||| ||||||
Sbjct: 190545 ataataataatagtaataaagatg 190522



to top

>emb|BX119909.5| Zebrafish DNA sequence from clone CH211-223I3 in linkage group 6,
             complete sequence
          Length = 221755

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             ||||||||||||||||||| ||||
Sbjct: 20035 ataataataatagtaatgatgatg 20058



to top

>emb|BX005141.5| Zebrafish DNA sequence from clone CH211-13K16, complete sequence
          Length = 166576

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      ataataataatagtaatgaagatg 25
              ||||||||||||||||||| ||||
Sbjct: 149464 ataataataatagtaatgatgatg 149441



to top

>emb|BX248116.8| Zebrafish DNA sequence from clone CH211-245G15 in linkage group 9,
             complete sequence
          Length = 161065

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 2     ataataataatagtaatgaagatg 25
             |||||||||||| |||||||||||
Sbjct: 30298 ataataataataataatgaagatg 30275



to top

>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBb0032E15
          Length = 120419

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     taataataatagtaatgaagatgg 26
             ||||| ||||||||||||||||||
Sbjct: 61200 taatagtaatagtaatgaagatgg 61223



to top

>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1663_D06
          Length = 139103

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     taataataatagtaatgaagatgg 26
             ||||| ||||||||||||||||||
Sbjct: 31611 taatagtaatagtaatgaagatgg 31634



to top

>dbj|AK102608.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033099B08, full
            insert sequence
          Length = 3182

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 3    taataataatagtaatgaagatgg 26
            ||||| ||||||||||||||||||
Sbjct: 2188 taatagtaatagtaatgaagatgg 2211



to top

>gb|BC078310.1| Danio rerio caspase 3, apoptosis-related cysteine protease, mRNA
            (cDNA clone MGC:100890 IMAGE:7142903), complete cds
          Length = 2950

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ataataataatagtaatgaa 21
            ||||||||||||||||||||
Sbjct: 1417 ataataataatagtaatgaa 1436



to top

>emb|BX890563.6| Zebrafish DNA sequence from clone DKEY-195C14 in linkage group 19,
            complete sequence
          Length = 35376

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 7246 ataataataataataatgaagatg 7223



to top

>emb|AL935186.22| Zebrafish DNA sequence from clone CH211-250M6 in linkage group 4,
              complete sequence
          Length = 166476

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ataataataatagtaatgaa 21
              ||||||||||||||||||||
Sbjct: 103601 ataataataatagtaatgaa 103620



to top

>emb|BX088554.8| Zebrafish DNA sequence from clone DKEYP-4F12 in linkage group 20,
             complete sequence
          Length = 160766

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 10609 ataataataatagtaatgaa 10590



to top

>emb|BX248111.7| Zebrafish DNA sequence from clone DKEY-22L11 in linkage group 4, complete
              sequence
          Length = 185023

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 255    agagcagcagcgatgccatg 274
              ||||||||||||||||||||
Sbjct: 130246 agagcagcagcgatgccatg 130227



to top

>emb|BX936337.9| Zebrafish DNA sequence from clone DKEY-100N23 in linkage group 9,
             complete sequence
          Length = 64132

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     tataataataatagtaatga 20
             ||||||||||||||||||||
Sbjct: 32419 tataataataatagtaatga 32400



to top

>gb|AC170740.3| Sorex araneus clone SA_Ba-535D8, complete sequence
          Length = 121913

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ataataataatagtaatgaa 21
             ||||||||||||||||||||
Sbjct: 75771 ataataataatagtaatgaa 75752



to top

>gb|AC004205.1|AC004205 Homo sapiens clone UWGC:y3c071 from 6p21, complete sequence
          Length = 41506

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   atgccatgatgcaaacacca 286
             ||||||||||||||||||||
Sbjct: 36144 atgccatgatgcaaacacca 36125



to top

>gb|AC003688.1|AC003688 Homo sapiens chromosome 17, clone hRPC.4_G_17, complete sequence
          Length = 98117

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 148   ttccaaaccagcagaaaacagttt 171
             ||||||| ||||||||||||||||
Sbjct: 43509 ttccaaagcagcagaaaacagttt 43486



to top

>gb|AF275345.3| Lycopersicon esculentum putative permease gene, partial cds;
             suppressor-like protein, putative centromere protein,
             putative auxin growth promotor protein, and putative
             protein phosphatase genes, complete cds; LTR-A long
             terminal repeat, complete sequence; putative copia-like
             polyprotein gene, complete cds; LTR-B long terminal
             repeat, complete sequence; MADS-box transcription factor
             JOINTLESS gene, complete cds; TH65-like protein gene,
             partial cds; and unknown genes
          Length = 118761

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     taataataatagtaatgaagatgg 26
             ||||||||||| ||||||||||||
Sbjct: 89196 taataataataataatgaagatgg 89173



to top

>emb|AL928800.5| Zebrafish DNA sequence from clone CH211-233G21 in linkage group 1,
             complete sequence
          Length = 153880

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     tataataataatagtaatga 20
             ||||||||||||||||||||
Sbjct: 95508 tataataataatagtaatga 95489



to top

>gb|AC133709.11| Medicago truncatula clone mth2-7b3, complete sequence
          Length = 138950

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 416    tcaaaagttgctgtctaagagaat 439
              |||||||||| |||||||||||||
Sbjct: 102129 tcaaaagttgttgtctaagagaat 102152



to top

>emb|CT476806.2| Pan troglodytes chromosome X BAC RP43-032D14, complete sequence
          Length = 145919

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 1      tataataataatagtaatgaagat 24
              ||||||||||||| ||||||||||
Sbjct: 126028 tataataataataataatgaagat 126051



to top

>gb|U20661.1|DDU20661 Dictyostelium discoideum unknown internal repeat protein gene,
            complete cds, and unknown orf1, orf2 and orf3 genes,
            partial cds
          Length = 4284

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 2    ataataataatagtaatgaagatg 25
            |||||||||||| |||||||||||
Sbjct: 4100 ataataataataataatgaagatg 4123



to top

>emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chromosome 2, complete
             sequence
          Length = 185348

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     tataataataatagtaatga 20
             ||||||||||||||||||||
Sbjct: 37556 tataataataatagtaatga 37575



to top

>dbj|AB256346.1| Homo sapiens DNA, HIV-1 integration site, isolate:041119Pt.2#6
          Length = 350

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 49  atatatagataaaagatgga 68
           ||||||||||||||||||||
Sbjct: 223 atatatagataaaagatgga 242


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,840,049
Number of Sequences: 3902068
Number of extensions: 7840049
Number of successful extensions: 276988
Number of sequences better than 10.0: 202
Number of HSP's better than 10.0 without gapping: 202
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 275496
Number of HSP's gapped (non-prelim): 1492
length of query: 649
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 626
effective length of database: 17,143,297,704
effective search space: 10731704362704
effective search space used: 10731704362704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top